Starting /dee2/code/volunteer_pipeline.sh SRR7171918 current disk space = 3112524476416 free memory = 1577528300 SRR7171918 SRAfilesize 37ea57a6807860b34c62ce18681aaa4b SRR7171918.sra SRR7171918.sra file validated SRR7171918 is paired end SRR7171918 is conventional basespace SRR7171918 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171918_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.0105 18.0 18.0 18.0 18.0 30.0 2 22.50175 18.0 18.0 27.0 18.0 32.0 3 26.15225 27.0 25.0 29.0 18.0 31.0 4 30.81 32.0 32.0 32.0 27.0 33.0 5 32.18775 33.0 32.0 33.0 32.0 33.0 6 36.72425 38.0 37.0 38.0 34.0 38.0 7 37.125 38.0 38.0 38.0 36.0 38.0 8 37.36425 38.0 38.0 38.0 37.0 38.0 9 37.42675 38.0 38.0 38.0 37.0 38.0 10-14 37.509100000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.535999999999994 38.0 38.0 38.0 37.8 38.0 20-24 37.4904 38.0 38.0 38.0 37.4 38.0 25-29 37.5 38.0 38.0 38.0 37.2 38.0 30-34 37.47145 38.0 38.0 38.0 37.0 38.0 35-39 37.43245 38.0 38.0 38.0 37.0 38.0 40-44 37.451 38.0 38.0 38.0 37.0 38.0 45-49 37.399150000000006 38.0 38.0 38.0 37.0 38.0 50-54 37.3488 38.0 38.0 38.0 37.0 38.0 55-59 37.25135 38.0 38.0 38.0 36.8 38.0 60-64 37.265150000000006 38.0 38.0 38.0 37.0 38.0 65-69 37.16305 38.0 38.0 38.0 36.4 38.0 70-74 37.14505 38.0 38.0 38.0 36.2 38.0 75-79 37.0758 38.0 38.0 38.0 36.0 38.0 80-84 37.0252 38.0 38.0 38.0 36.0 38.0 85-89 37.0194 38.0 38.0 38.0 36.0 38.0 90-94 36.90315 38.0 38.0 38.0 36.0 38.0 95-99 36.762 38.0 38.0 38.0 35.0 38.0 100-104 36.6885 38.0 38.0 38.0 35.0 38.0 105-109 36.568 38.0 38.0 38.0 34.4 38.0 110-114 36.45285 38.0 38.0 38.0 34.0 38.0 115-119 36.35665 38.0 38.0 38.0 34.0 38.0 120-124 36.2494 38.0 37.8 38.0 34.0 38.0 125-129 35.8063 38.0 37.0 38.0 31.8 38.0 130-134 35.73345 38.0 36.6 38.0 31.2 38.0 135-139 35.64255 38.0 36.0 38.0 31.8 38.0 140-144 35.4993 38.0 36.0 38.0 31.4 38.0 145-149 35.0191 38.0 36.0 38.0 30.4 38.0 150-151 31.858375 36.5 32.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 1.0 16 1.0 17 3.0 18 4.0 19 4.0 20 1.0 21 1.0 22 4.0 23 6.0 24 5.0 25 11.0 26 12.0 27 14.0 28 18.0 29 30.0 30 25.0 31 55.0 32 58.0 33 96.0 34 149.0 35 249.0 36 734.0 37 2515.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.39858675739335 11.332112012562156 14.446479979063072 36.82282125098142 2 20.575 17.075000000000003 37.75 24.6 3 20.05 23.849999999999998 27.0 29.099999999999998 4 22.400000000000002 32.675 22.625 22.3 5 20.8 34.65 23.724999999999998 20.825 6 18.675 34.975 26.275 20.075000000000003 7 13.325000000000001 23.525 43.0 20.150000000000002 8 17.224999999999998 22.650000000000002 31.6 28.525 9 18.675 24.075 32.324999999999996 24.925 10-14 19.46 29.470000000000002 27.325 23.745 15-19 19.685 27.965 28.565 23.785 20-24 19.495 28.044999999999998 28.610000000000003 23.849999999999998 25-29 19.564999999999998 28.67 27.939999999999998 23.825 30-34 19.39 28.26 28.485 23.865 35-39 20.23 28.475 27.229999999999997 24.065 40-44 19.814999999999998 28.175 28.625 23.385 45-49 20.565 27.51 27.935 23.990000000000002 50-54 20.19 28.060000000000002 27.61 24.14 55-59 20.415 28.360000000000003 27.694999999999997 23.53 60-64 20.294999999999998 28.48 27.525 23.7 65-69 19.869999999999997 28.395 27.785 23.95 70-74 20.119999999999997 27.67 28.249999999999996 23.96 75-79 19.689999999999998 27.900000000000002 28.23 24.18 80-84 20.18 28.444999999999997 26.945000000000004 24.43 85-89 20.27 28.470000000000002 27.694999999999997 23.565 90-94 20.375 28.675 27.3 23.65 95-99 20.375 27.38 27.57 24.675 100-104 20.015 28.12 27.860000000000003 24.005000000000003 105-109 20.52 28.015 27.6 23.865 110-114 21.065 27.655 27.765 23.515 115-119 20.285 27.92 28.215 23.580000000000002 120-124 20.74 28.410000000000004 26.700000000000003 24.15 125-129 21.035 27.98 27.08 23.905 130-134 20.3 27.689999999999998 28.044999999999998 23.965 135-139 21.075 27.815 27.900000000000002 23.21 140-144 20.345 27.655 27.875 24.125 145-149 21.240000000000002 27.689999999999998 27.355 23.715 150-151 20.6625 28.249999999999996 27.400000000000002 23.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 3.0 24 4.5 25 3.5 26 2.0 27 6.0 28 10.5 29 15.5 30 17.5 31 17.5 32 25.0 33 33.0 34 47.5 35 71.5 36 90.0 37 112.5 38 135.0 39 159.5 40 197.0 41 226.0 42 247.0 43 258.5 44 280.0 45 286.5 46 269.5 47 265.5 48 242.0 49 200.0 50 171.0 51 137.5 52 108.0 53 94.0 54 64.0 55 47.0 56 40.5 57 27.5 58 19.5 59 11.0 60 10.5 61 10.0 62 5.5 63 5.0 64 4.0 65 3.0 66 4.0 67 3.5 68 2.5 69 1.5 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.3625 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.5625 0.0 0.0 0.0 0.0 110-111 0.675 0.0 0.0 0.0 0.0 112-113 0.7375 0.0 0.0 0.0 0.0 114-115 0.775 0.0 0.0 0.0 0.0 116-117 0.875 0.0 0.0 0.0 0.0 118-119 1.0375 0.0 0.0 0.0 0.0 120-121 1.2125 0.0 0.0 0.0 0.0 122-123 1.3125 0.0 0.0 0.0 0.0 124-125 1.4625 0.0 0.0 0.0 0.0 126-127 1.5875 0.0 0.0 0.0 0.0 128-129 1.8625 0.0 0.0 0.0 0.0 130-131 2.0250000000000004 0.0 0.0 0.0 0.0 132-133 2.1625 0.0 0.0 0.0 0.0 134-135 2.5 0.0 0.0 0.0 0.0 136-137 2.7875 0.0 0.0 0.0 0.0 138-139 3.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171918 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171918_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.73775 33.0 33.0 34.0 32.0 34.0 2 32.86225 33.0 33.0 34.0 32.0 34.0 3 32.92075 34.0 33.0 34.0 32.0 34.0 4 32.86775 34.0 33.0 34.0 32.0 34.0 5 32.829 34.0 33.0 34.0 32.0 34.0 6 37.01625 38.0 38.0 38.0 37.0 38.0 7 37.01625 38.0 38.0 38.0 37.0 38.0 8 37.0355 38.0 38.0 38.0 37.0 38.0 9 37.089 38.0 38.0 38.0 37.0 38.0 10-14 36.9748 38.0 38.0 38.0 36.8 38.0 15-19 36.9125 38.0 38.0 38.0 36.8 38.0 20-24 36.81675 38.0 38.0 38.0 36.2 38.0 25-29 36.849000000000004 38.0 38.0 38.0 36.6 38.0 30-34 36.84315 38.0 38.0 38.0 36.6 38.0 35-39 36.7499 38.0 38.0 38.0 36.2 38.0 40-44 36.739999999999995 38.0 38.0 38.0 36.0 38.0 45-49 36.75435 38.0 38.0 38.0 36.0 38.0 50-54 36.71175 38.0 38.0 38.0 36.0 38.0 55-59 36.685050000000004 38.0 38.0 38.0 36.0 38.0 60-64 36.64145 38.0 38.0 38.0 35.8 38.0 65-69 36.59885 38.0 38.0 38.0 35.4 38.0 70-74 36.537150000000004 38.0 38.0 38.0 35.0 38.0 75-79 36.52195 38.0 38.0 38.0 35.0 38.0 80-84 36.509299999999996 38.0 38.0 38.0 35.0 38.0 85-89 36.334500000000006 38.0 38.0 38.0 34.2 38.0 90-94 36.1572 38.0 38.0 38.0 34.0 38.0 95-99 36.07515 38.0 38.0 38.0 34.0 38.0 100-104 35.947 38.0 38.0 38.0 33.4 38.0 105-109 35.83345 38.0 37.6 38.0 33.0 38.0 110-114 35.78315 38.0 37.2 38.0 33.0 38.0 115-119 35.64555 38.0 37.0 38.0 32.2 38.0 120-124 35.382600000000004 38.0 37.0 38.0 30.6 38.0 125-129 35.1833 38.0 36.4 38.0 29.8 38.0 130-134 34.8833 38.0 36.0 38.0 28.2 38.0 135-139 34.6423 38.0 35.4 38.0 27.2 38.0 140-144 34.21575 38.0 35.0 38.0 25.2 38.0 145-149 33.71595000000001 38.0 35.0 38.0 21.0 38.0 150-151 30.329375 36.5 29.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 10.0 4 7.0 5 2.0 6 2.0 7 5.0 8 4.0 9 1.0 10 3.0 11 1.0 12 3.0 13 3.0 14 4.0 15 4.0 16 3.0 17 2.0 18 2.0 19 5.0 20 8.0 21 5.0 22 11.0 23 7.0 24 12.0 25 12.0 26 19.0 27 15.0 28 26.0 29 27.0 30 41.0 31 52.0 32 58.0 33 99.0 34 160.0 35 231.0 36 578.0 37 2566.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.203406813627254 16.83366733466934 18.061122244488978 25.90180360721443 2 25.0 23.8988988988989 33.208208208208205 17.892892892892892 3 21.135567783891947 28.8144072036018 28.96448224112056 21.085542771385693 4 22.961480740370185 35.26763381690846 23.1615807903952 18.609304652326163 5 24.112056028014006 36.14307153576789 22.061030515257627 17.68384192096048 6 20.200000000000003 37.45 22.55 19.8 7 19.475 19.625 40.075 20.825 8 21.6 23.25 27.474999999999998 27.675 9 22.3 24.85 28.999999999999996 23.849999999999998 10-14 23.256162808140406 28.136406820341016 27.366368318415923 21.241062053102656 15-19 23.087698234028718 28.330581820001 27.755265395967783 20.826454550002502 20-24 23.446893787575153 28.45190380761523 27.299599198396795 20.801603206412825 25-29 22.927318295739347 28.37593984962406 27.333333333333332 21.36340852130326 30-34 23.435619735258726 28.52988367428801 26.950461291616527 21.084035298836742 35-39 23.339686998394864 28.16011235955056 27.457865168539325 21.04233547351525 40-44 24.128766985909845 27.984756556185125 26.986912701198417 20.899563756706613 45-49 23.118925959322713 28.754633804228035 27.086464282136056 21.039975954313196 50-54 23.73924354612768 28.01681008605163 27.481488893336003 20.76245747448469 55-59 23.935771096993648 28.197688960032014 27.177229753389025 20.689310189585314 60-64 23.76856528479272 27.389108366254938 27.799169875481322 21.04315647347102 65-69 23.287328732873288 28.32783278327833 27.13271327132713 21.252125212521253 70-74 23.985 27.985 27.05 20.979999999999997 75-79 23.544999999999998 28.189999999999998 27.515 20.75 80-84 23.119999999999997 27.92 27.42 21.54 85-89 23.7 28.275 27.26 20.765 90-94 23.185 27.900000000000002 27.744999999999997 21.17 95-99 23.625 28.255000000000003 27.08 21.04 100-104 24.104999999999997 27.97 26.945000000000004 20.979999999999997 105-109 23.79 27.79 27.860000000000003 20.560000000000002 110-114 23.830000000000002 27.425 28.035 20.71 115-119 24.04 28.04 27.295 20.625 120-124 23.855 27.884999999999998 27.400000000000002 20.86 125-129 23.91 28.035 27.63 20.424999999999997 130-134 23.915 27.505000000000003 28.185 20.395 135-139 23.655 28.095 27.750000000000004 20.5 140-144 23.810000000000002 28.18 27.87 20.14 145-149 23.875 27.88 27.74 20.505000000000003 150-151 24.962500000000002 27.35 27.425 20.2625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 2.0 24 1.0 25 1.5 26 3.5 27 5.5 28 5.0 29 7.0 30 12.5 31 16.0 32 22.5 33 33.0 34 39.0 35 47.5 36 67.5 37 94.5 38 127.5 39 155.5 40 178.5 41 219.0 42 269.0 43 285.0 44 281.0 45 282.0 46 282.5 47 260.5 48 233.0 49 207.0 50 171.0 51 153.0 52 134.0 53 99.5 54 74.5 55 53.5 56 38.0 57 35.0 58 27.0 59 17.0 60 11.0 61 9.5 62 7.0 63 7.5 64 7.0 65 4.0 66 2.0 67 1.0 68 1.0 69 1.0 70 2.0 71 1.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.1 3 0.05 4 0.05 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.055 20-24 0.2 25-29 0.25 30-34 0.27999999999999997 35-39 0.32 40-44 0.28500000000000003 45-49 0.19 50-54 0.06 55-59 0.045 60-64 0.015 65-69 0.01 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79944848332916 99.52499999999999 2 0.17548257708698922 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0250689395838556 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCAGCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.4875 0.0 0.0 0.0 0.0 108-109 0.5874999999999999 0.0 0.0 0.0 0.0 110-111 0.7 0.0 0.0 0.0 0.0 112-113 0.7625 0.0 0.0 0.0 0.0 114-115 0.8 0.0 0.0 0.0 0.0 116-117 0.8875 0.0 0.0 0.0 0.0 118-119 1.0375 0.0 0.0 0.0 0.0 120-121 1.2125 0.0 0.0 0.0 0.0 122-123 1.3125 0.0 0.0 0.0 0.0 124-125 1.4625 0.0 0.0 0.0 0.0 126-127 1.5625 0.0 0.0 0.0 0.0 128-129 1.825 0.0 0.0 0.0 0.0 130-131 1.975 0.0 0.0 0.0 0.0 132-133 2.0999999999999996 0.0 0.0 0.0 0.0 134-135 2.425 0.0 0.0 0.0 0.0 136-137 2.7125 0.0 0.0 0.0 0.0 138-139 3.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGATCA 10 0.006830828 145.0 3 GTGATGT 10 0.006830828 145.0 1 >>END_MODULE Read 789690 spots for SRR7171918.sra Written 789690 spots for SRR7171918.sra Read 789690 spots for SRR7171918.sra Written 789690 spots for SRR7171918.sra Read 789690 spots for SRR7171918.sra Written 789690 spots for SRR7171918.sra Read 789690 spots for SRR7171918.sra Written 789690 spots for SRR7171918.sra Read 789690 spots for SRR7171918.sra Written 789690 spots for SRR7171918.sra Read 789690 spots for SRR7171918.sra Written 789690 spots for SRR7171918.sra Read 789690 spots for SRR7171918.sra Written 789690 spots for SRR7171918.sra Read 789690 spots for SRR7171918.sra Written 789690 spots for SRR7171918.sra Read 789690 spots for SRR7171918.sra Written 789690 spots for SRR7171918.sra Read 789690 spots for SRR7171918.sra Written 789690 spots for SRR7171918.sra Read 789690 spots for SRR7171918.sra Written 789690 spots for SRR7171918.sra Read 789690 spots for SRR7171918.sra Written 789690 spots for SRR7171918.sra Read 789690 spots for SRR7171918.sra Written 789690 spots for SRR7171918.sra Read 789690 spots for SRR7171918.sra Written 789690 spots for SRR7171918.sra Read 789690 spots for SRR7171918.sra Written 789690 spots for SRR7171918.sra Read 789690 spots for SRR7171918.sra Written 789690 spots for SRR7171918.sra Read 789690 spots for SRR7171918.sra Written 789690 spots for SRR7171918.sra Read 789693 spots for SRR7171918.sra Written 789693 spots for SRR7171918.sra Read 789690 spots for SRR7171918.sra Written 789690 spots for SRR7171918.sra Read 789690 spots for SRR7171918.sra Written 789690 spots for SRR7171918.sra SRR ids: ['SRR7171918.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fjnstn1y SRR7171918.sra spots: 15793803 blocks: [[1, 789690], [789691, 1579380], [1579381, 2369070], [2369071, 3158760], [3158761, 3948450], [3948451, 4738140], [4738141, 5527830], [5527831, 6317520], [6317521, 7107210], [7107211, 7896900], [7896901, 8686590], [8686591, 9476280], [9476281, 10265970], [10265971, 11055660], [11055661, 11845350], [11845351, 12635040], [12635041, 13424730], [13424731, 14214420], [14214421, 15004110], [15004111, 15793803]] SRR7171918 file size 5330301 SRR7171918 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171918 SRR7171918_1.fastq SRR7171918_2.fastq Input file: SRR7171918_1.fastq Paired file: SRR7171918_2.fastq trimmed: SRR7171918-trimmed-pair1.fastq, SRR7171918-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 15:18:14 2025 >> started Fri Feb 14 15:18:31 2025 >> done (17.309s) 15793803 read pairs processed; of these: 42279 ( 0.27%) short read pairs filtered out after trimming by size control 33939 ( 0.21%) empty read pairs filtered out after trimming by size control 15717585 (99.52%) read pairs available; of these: 5501434 (35.00%) trimmed read pairs available after processing 10216151 (65.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 1 0.00% 21 4 0.00% 22 8 0.00% 23 5 0.00% 24 5 0.00% 25 8 0.00% 26 7 0.00% 27 7 0.00% 28 13 0.00% 29 6 0.00% 30 8 0.00% 31 9 0.00% 32 4 0.00% 33 5 0.00% 34 14 0.00% 35 9 0.00% 36 4 0.00% 37 8 0.00% 38 13 0.00% 39 17 0.00% 40 11 0.00% 41 16 0.00% 42 14 0.00% 43 40 0.00% 44 26 0.00% 45 24 0.00% 46 20 0.00% 47 69 0.00% 48 136 0.00% 49 27 0.00% 50 30 0.00% 51 45 0.00% 52 117 0.00% 53 107 0.00% 54 104 0.00% 55 71 0.00% 56 102 0.00% 57 96 0.00% 58 168 0.00% 59 85 0.00% 60 82 0.00% 61 108 0.00% 62 112 0.00% 63 110 0.00% 64 115 0.00% 65 134 0.00% 66 151 0.00% 67 155 0.00% 68 169 0.00% 69 215 0.00% 70 251 0.00% 71 306 0.00% 72 317 0.00% 73 338 0.00% 74 410 0.00% 75 531 0.00% 76 624 0.00% 77 715 0.00% 78 723 0.00% 79 839 0.01% 80 844 0.01% 81 1002 0.01% 82 1075 0.01% 83 1281 0.01% 84 3111 0.02% 85 4336 0.03% 86 4305 0.03% 87 4615 0.03% 88 4653 0.03% 89 4779 0.03% 90 4812 0.03% 91 5014 0.03% 92 5229 0.03% 93 5429 0.03% 94 5647 0.04% 95 5841 0.04% 96 5946 0.04% 97 6144 0.04% 98 6501 0.04% 99 6774 0.04% 100 7219 0.05% 101 7599 0.05% 102 8035 0.05% 103 8738 0.06% 104 9119 0.06% 105 9599 0.06% 106 10040 0.06% 107 10715 0.07% 108 10986 0.07% 109 11677 0.07% 110 12442 0.08% 111 13236 0.08% 112 13573 0.09% 113 14280 0.09% 114 15162 0.10% 115 16057 0.10% 116 16575 0.11% 117 17060 0.11% 118 18137 0.12% 119 19196 0.12% 120 20927 0.13% 121 20728 0.13% 122 21410 0.14% 123 22571 0.14% 124 23784 0.15% 125 24433 0.16% 126 25436 0.16% 127 26669 0.17% 128 27674 0.18% 129 28823 0.18% 130 30252 0.19% 131 31753 0.20% 132 33568 0.21% 133 35689 0.23% 134 37514 0.24% 135 39843 0.25% 136 42261 0.27% 137 45416 0.29% 138 48016 0.31% 139 51393 0.33% 140 55185 0.35% 141 60299 0.38% 142 66947 0.43% 143 75864 0.48% 144 87066 0.55% 145 102743 0.65% 146 126681 0.81% 147 170061 1.08% 148 257257 1.64% 149 514541 3.27% 150 3001976 19.10% 151 10216151 65.00% 15717585 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=3.74 fanout-score-rank=25 prefix-density=0.36 prefix-fanout=3.2 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.13 sequence-density-rank=11 fanout-score=30.03 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=10.1 sequence=ACACCAGCAATGATTGT criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=32 prefix-density=0.53 prefix-fanout=2.1 sequence=GGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=221.63 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=13.6 sequence=TTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATA SRR7171918 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 15:19:44 Started mapping on | Feb 14 15:19:45 Finished on | Feb 14 15:21:32 Mapping speed, Million of reads per hour | 528.82 Number of input reads | 15717585 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14690798 Uniquely mapped reads % | 93.47% Average mapped length | 296.46 Number of splices: Total | 14522874 Number of splices: Annotated (sjdb) | 14230170 Number of splices: GT/AG | 14288330 Number of splices: GC/AG | 183053 Number of splices: AT/AC | 11135 Number of splices: Non-canonical | 40356 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 386626 % of reads mapped to multiple loci | 2.46% Number of reads mapped to too many loci | 68148 % of reads mapped to too many loci | 0.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.55% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 677606 677606 677606 N_multimapping 386626 386626 386626 N_noFeature 398789 14532812 482051 N_ambiguous 150780 986 75510 UnstrandedReadsAssigned:14141229 PositiveStrandReadsAssigned:157000 NegativeStrandReadsAssigned:14133237 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171918 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171918-trimmed-pair1.fastq SRR7171918-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,717,585 reads, 14,047,823 reads pseudoaligned [quant] estimated average fragment length: 260.902 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,075 rounds 52401 SRR7171918.ke.tsv 34699 SRR7171918.se.tsv 87100 total ==> SRR7171918.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1758.1 1553 59.8595 Potri.005G024800.1.v4.1 1035 775.098 201 17.5729 Potri.004G059700.1.v4.1 961 701.135 27 2.60955 Potri.007G009000.2.v4.1 1416 1156.1 0 0 Potri.003G141000.2.v4.1 2943 2683.1 454.174 11.4707 Potri.016G087400.1.v4.1 270 70.3578 774 745.476 Potri.015G069301.1.v4.1 564 309.814 0 0 Potri.010G195200.1.v4.1 1773 1513.1 632 28.3044 Potri.012G127500.1.v4.1 977 717.13 14033 1326.04 ==> SRR7171918.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 55 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 527 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 479 SRR7171918 completed mapping pipeline successfully