Starting /dee2/code/volunteer_pipeline.sh SRR7171919 current disk space = 3110753239040 free memory = 1014450400 SRR7171919 SRAfilesize 26ced9db401fcb9d64b51ecffd38db06 SRR7171919.sra SRR7171919.sra file validated SRR7171919 is paired end SRR7171919 is conventional basespace SRR7171919 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171919_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.09925 33.0 32.0 33.0 32.0 33.0 2 27.702 31.0 18.0 33.0 18.0 33.0 3 30.6735 31.0 29.0 33.0 27.0 33.0 4 31.048 33.0 31.0 33.0 28.0 33.0 5 30.97175 33.0 31.0 33.0 28.0 34.0 6 35.65075 37.0 36.0 38.0 31.0 38.0 7 36.185 38.0 36.0 38.0 33.0 38.0 8 37.00275 38.0 38.0 38.0 35.0 38.0 9 37.21425 38.0 38.0 38.0 36.0 38.0 10-14 37.37555 38.0 38.0 38.0 37.0 38.0 15-19 37.4448 38.0 38.0 38.0 37.0 38.0 20-24 37.4197 38.0 38.0 38.0 37.0 38.0 25-29 37.425650000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.449 38.0 38.0 38.0 37.0 38.0 35-39 37.401300000000006 38.0 38.0 38.0 37.0 38.0 40-44 37.3904 38.0 38.0 38.0 37.0 38.0 45-49 37.3436 38.0 38.0 38.0 37.0 38.0 50-54 37.30395 38.0 38.0 38.0 36.8 38.0 55-59 37.260549999999995 38.0 38.0 38.0 37.0 38.0 60-64 37.199 38.0 38.0 38.0 36.0 38.0 65-69 37.12845 38.0 38.0 38.0 36.0 38.0 70-74 37.12285000000001 38.0 38.0 38.0 36.0 38.0 75-79 37.06060000000001 38.0 38.0 38.0 36.0 38.0 80-84 37.0701 38.0 38.0 38.0 36.0 38.0 85-89 36.93420000000001 38.0 38.0 38.0 35.6 38.0 90-94 36.83365 38.0 38.0 38.0 34.8 38.0 95-99 36.77275 38.0 38.0 38.0 35.0 38.0 100-104 36.63585 38.0 38.0 38.0 34.4 38.0 105-109 36.5642 38.0 38.0 38.0 34.0 38.0 110-114 36.364999999999995 38.0 37.4 38.0 34.0 38.0 115-119 36.276300000000006 38.0 37.0 38.0 34.0 38.0 120-124 36.174800000000005 38.0 37.0 38.0 33.4 38.0 125-129 35.99595 38.0 36.8 38.0 32.6 38.0 130-134 35.69815 38.0 36.0 38.0 31.0 38.0 135-139 35.40495 38.0 36.0 38.0 30.2 38.0 140-144 34.979800000000004 38.0 35.0 38.0 28.0 38.0 145-149 34.54405 38.0 35.0 38.0 27.6 38.0 150-151 31.465999999999998 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 2.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 2.0 20 0.0 21 3.0 22 4.0 23 5.0 24 8.0 25 9.0 26 10.0 27 15.0 28 17.0 29 40.0 30 26.0 31 49.0 32 68.0 33 99.0 34 156.0 35 275.0 36 735.0 37 2476.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.525 17.2 10.125 31.15 2 22.35 22.275 31.974999999999998 23.400000000000002 3 19.225 29.25 25.75 25.775 4 21.175 38.074999999999996 20.175 20.575 5 21.85 39.550000000000004 20.474999999999998 18.125 6 18.625 36.95 24.15 20.275000000000002 7 14.174999999999999 22.425 45.175 18.224999999999998 8 19.475 21.325 29.099999999999998 30.099999999999998 9 18.625 23.775 31.6 26.0 10-14 19.994999999999997 29.310000000000002 26.97 23.724999999999998 15-19 20.11 28.110000000000003 28.444999999999997 23.335 20-24 20.015 28.04 28.675 23.27 25-29 20.405 28.575 27.66 23.36 30-34 20.035 28.794999999999998 27.505000000000003 23.665 35-39 20.39 29.195 27.615000000000002 22.8 40-44 20.13 29.465000000000003 27.375 23.03 45-49 20.105 29.29 27.58 23.025000000000002 50-54 20.185 29.134999999999998 27.625 23.055 55-59 19.725 28.395 28.349999999999998 23.53 60-64 20.13 28.585 27.725 23.56 65-69 20.325 29.285 27.275 23.115 70-74 19.705000000000002 28.77 28.065 23.46 75-79 20.175 28.345 28.07 23.41 80-84 19.79 28.405 28.275 23.53 85-89 20.23 28.505000000000003 27.72 23.544999999999998 90-94 20.345 28.02 27.694999999999997 23.94 95-99 19.835 28.975 27.87 23.32 100-104 20.19 28.925 27.74 23.145 105-109 20.605 28.82 27.810000000000002 22.765 110-114 20.97 28.000000000000004 27.994999999999997 23.035 115-119 20.385 28.285 28.28 23.05 120-124 19.96 27.77 28.28 23.990000000000002 125-129 20.74 28.375 27.935 22.95 130-134 21.255 28.225 27.42 23.1 135-139 20.755000000000003 28.34 27.575 23.330000000000002 140-144 21.015 28.04 27.735 23.21 145-149 20.4 28.360000000000003 27.560000000000002 23.68 150-151 20.3125 28.499999999999996 27.725 23.4625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 0.5 20 0.0 21 1.0 22 2.5 23 1.5 24 0.5 25 1.0 26 2.5 27 6.0 28 9.5 29 14.5 30 16.0 31 18.0 32 33.0 33 40.5 34 53.0 35 72.5 36 90.5 37 116.0 38 140.5 39 178.5 40 223.5 41 245.5 42 259.0 43 282.0 44 298.0 45 290.0 46 267.0 47 243.5 48 209.5 49 175.5 50 147.0 51 136.0 52 117.5 53 83.5 54 65.0 55 48.5 56 30.0 57 16.0 58 14.0 59 13.5 60 8.5 61 5.0 62 3.0 63 5.0 64 6.5 65 3.5 66 1.0 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8246492985972 99.625 2 0.15030060120240482 0.3 3 0.0250501002004008 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.30000000000000004 0.0 0.0 0.0 0.0 106-107 0.325 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.425 0.0 0.0 0.0 0.0 112-113 0.5 0.0 0.0 0.0 0.0 114-115 0.5874999999999999 0.0 0.0 0.0 0.0 116-117 0.675 0.0 0.0 0.0 0.0 118-119 0.7625 0.0 0.0 0.0 0.0 120-121 0.875 0.0 0.0 0.0 0.0 122-123 1.1125 0.0 0.0 0.0 0.0 124-125 1.25 0.0 0.0 0.0 0.0 126-127 1.4249999999999998 0.0 0.0 0.0 0.0 128-129 1.675 0.0 0.0 0.0 0.0 130-131 1.85 0.0 0.0 0.0 0.0 132-133 2.0250000000000004 0.0 0.0 0.0 0.0 134-135 2.225 0.0 0.0 0.0 0.0 136-137 2.425 0.0 0.0 0.0 0.0 138-139 2.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAAACA 10 0.006830828 145.0 3 CACATCC 10 0.006830828 145.0 3 CAAACAA 10 0.006830828 145.0 4 ACAACGT 10 0.006830828 145.0 4 TCCCCTA 10 0.006830828 145.0 7 >>END_MODULE SRR7171919 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171919_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.735 33.0 33.0 34.0 32.0 34.0 2 32.80825 33.0 33.0 34.0 32.0 34.0 3 32.86675 33.0 33.0 34.0 32.0 34.0 4 32.8095 33.0 33.0 34.0 32.0 34.0 5 32.77475 33.0 33.0 34.0 32.0 34.0 6 36.991 38.0 38.0 38.0 36.0 38.0 7 36.977 38.0 38.0 38.0 36.0 38.0 8 37.0325 38.0 38.0 38.0 36.0 38.0 9 36.98925 38.0 38.0 38.0 36.0 38.0 10-14 36.8922 38.0 38.0 38.0 35.8 38.0 15-19 36.8768 38.0 38.0 38.0 36.0 38.0 20-24 36.865750000000006 38.0 38.0 38.0 36.0 38.0 25-29 36.7901 38.0 38.0 38.0 35.6 38.0 30-34 36.750550000000004 38.0 38.0 38.0 35.6 38.0 35-39 36.54695 38.0 38.0 38.0 35.0 38.0 40-44 36.288149999999995 38.0 38.0 38.0 34.2 38.0 45-49 36.558499999999995 38.0 38.0 38.0 34.4 38.0 50-54 36.64315 38.0 38.0 38.0 35.0 38.0 55-59 36.6392 38.0 38.0 38.0 34.8 38.0 60-64 36.54115 38.0 38.0 38.0 34.4 38.0 65-69 36.42594999999999 38.0 38.0 38.0 34.0 38.0 70-74 36.353 38.0 38.0 38.0 34.0 38.0 75-79 36.35705 38.0 38.0 38.0 34.0 38.0 80-84 36.33335 38.0 38.0 38.0 34.0 38.0 85-89 36.075900000000004 38.0 37.2 38.0 33.4 38.0 90-94 35.9974 38.0 37.0 38.0 33.0 38.0 95-99 35.90385 38.0 37.0 38.0 33.0 38.0 100-104 35.7568 38.0 37.0 38.0 31.4 38.0 105-109 35.584199999999996 38.0 37.0 38.0 31.0 38.0 110-114 35.39854999999999 38.0 36.6 38.0 29.4 38.0 115-119 35.29135000000001 38.0 36.0 38.0 29.0 38.0 120-124 35.046549999999996 38.0 35.8 38.0 28.4 38.0 125-129 34.6038 38.0 35.0 38.0 26.4 38.0 130-134 34.200100000000006 38.0 35.0 38.0 23.6 38.0 135-139 33.961 38.0 34.6 38.0 22.4 38.0 140-144 33.61895 38.0 34.4 38.0 20.6 38.0 145-149 32.7673 38.0 33.8 38.0 14.2 38.0 150-151 29.148125 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 6.0 4 1.0 5 2.0 6 0.0 7 1.0 8 1.0 9 2.0 10 0.0 11 1.0 12 0.0 13 3.0 14 3.0 15 6.0 16 4.0 17 1.0 18 9.0 19 5.0 20 5.0 21 7.0 22 15.0 23 11.0 24 24.0 25 24.0 26 27.0 27 32.0 28 30.0 29 52.0 30 46.0 31 56.0 32 100.0 33 122.0 34 198.0 35 313.0 36 825.0 37 2063.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.400000000000006 19.3 15.75 24.55 2 27.075 23.474999999999998 32.025 17.424999999999997 3 21.3 28.15 31.324999999999996 19.225 4 23.75 36.7 20.3 19.25 5 23.65 38.9 19.8 17.65 6 19.525000000000002 38.574999999999996 22.5 19.400000000000002 7 18.7 17.125 42.8 21.375 8 20.775 22.55 27.875 28.799999999999997 9 21.95 24.375 29.5 24.175 10-14 22.564999999999998 29.215000000000003 27.055 21.165 15-19 22.27 28.310000000000002 28.015 21.404999999999998 20-24 22.59 28.155 28.155 21.099999999999998 25-29 22.73 28.655 27.565 21.05 30-34 22.200550137534382 28.60715178794699 28.052013003250813 21.14028507126782 35-39 22.572705811442063 28.158119443467776 28.544879200361645 20.724295544728516 40-44 22.814110987566966 28.666734054381887 27.6357020115233 20.883452946527846 45-49 22.895 28.449999999999996 28.175 20.48 50-54 22.655 28.515 28.275 20.555 55-59 23.380000000000003 28.205000000000002 27.634999999999998 20.78 60-64 22.495 28.64 28.110000000000003 20.755000000000003 65-69 23.45 28.405 27.99 20.155 70-74 23.07 27.950000000000003 28.49 20.49 75-79 22.955000000000002 28.189999999999998 28.405 20.45 80-84 23.655 28.544999999999998 27.395000000000003 20.405 85-89 23.29 28.485 27.915 20.31 90-94 23.05 28.749999999999996 27.92 20.28 95-99 23.57 28.065 28.199999999999996 20.165 100-104 23.77 28.505000000000003 27.415 20.31 105-109 23.330000000000002 28.63 27.565 20.474999999999998 110-114 23.294999999999998 27.794999999999998 27.905 21.005 115-119 23.119999999999997 27.805000000000003 28.425 20.65 120-124 23.18 27.395000000000003 28.465 20.96 125-129 23.305 28.095 27.955000000000002 20.645 130-134 23.05 28.67 27.74 20.54 135-139 23.62 27.935 28.050000000000004 20.395 140-144 23.87 27.74 27.52 20.87 145-149 23.849999999999998 27.665 28.095 20.39 150-151 24.1125 28.050000000000004 27.825 20.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 1.5 23 2.0 24 1.0 25 2.0 26 4.5 27 4.5 28 6.5 29 9.0 30 12.0 31 17.5 32 24.5 33 36.0 34 50.0 35 64.5 36 85.0 37 117.0 38 145.0 39 184.0 40 222.5 41 241.5 42 267.0 43 284.0 44 290.5 45 296.5 46 280.5 47 255.0 48 228.0 49 195.5 50 158.0 51 122.0 52 104.5 53 79.5 54 48.0 55 37.0 56 28.5 57 22.5 58 24.5 59 20.5 60 10.0 61 2.0 62 3.0 63 4.5 64 2.5 65 0.5 66 0.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.025 35-39 0.455 40-44 1.0699999999999998 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.7743795437453 99.5 2 0.17548257708698922 0.35000000000000003 3 0.0501378791677112 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.30000000000000004 0.0 0.0 0.0 0.0 106-107 0.325 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.425 0.0 0.0 0.0 0.0 112-113 0.5 0.0 0.0 0.0 0.0 114-115 0.5874999999999999 0.0 0.0 0.0 0.0 116-117 0.675 0.0 0.0 0.0 0.0 118-119 0.7375 0.0 0.0 0.0 0.0 120-121 0.8500000000000001 0.0 0.0 0.0 0.0 122-123 1.0875 0.0 0.0 0.0 0.0 124-125 1.225 0.0 0.0 0.0 0.0 126-127 1.4 0.0 0.0 0.0 0.0 128-129 1.65 0.0 0.0 0.0 0.0 130-131 1.825 0.0 0.0 0.0 0.0 132-133 2.0 0.0 0.0 0.0 0.0 134-135 2.2 0.0 0.0 0.0 0.0 136-137 2.4 0.0 0.0 0.0 0.0 138-139 2.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGAGC 10 0.006867937 144.7375 6 >>END_MODULE Read 678917 spots for SRR7171919.sra Written 678917 spots for SRR7171919.sra Read 678917 spots for SRR7171919.sra Written 678917 spots for SRR7171919.sra Read 678917 spots for SRR7171919.sra Written 678917 spots for SRR7171919.sra Read 678917 spots for SRR7171919.sra Written 678917 spots for SRR7171919.sra Read 678917 spots for SRR7171919.sra Written 678917 spots for SRR7171919.sra Read 678917 spots for SRR7171919.sra Written 678917 spots for SRR7171919.sra Read 678917 spots for SRR7171919.sra Written 678917 spots for SRR7171919.sra Read 678917 spots for SRR7171919.sra Written 678917 spots for SRR7171919.sra Read 678917 spots for SRR7171919.sra Written 678917 spots for SRR7171919.sra Read 678917 spots for SRR7171919.sra Written 678917 spots for SRR7171919.sra Read 678917 spots for SRR7171919.sra Written 678917 spots for SRR7171919.sra Read 678917 spots for SRR7171919.sra Written 678917 spots for SRR7171919.sra Read 678917 spots for SRR7171919.sra Written 678917 spots for SRR7171919.sra Read 678917 spots for SRR7171919.sra Written 678917 spots for SRR7171919.sra Read 678917 spots for SRR7171919.sra Written 678917 spots for SRR7171919.sra Read 678917 spots for SRR7171919.sra Written 678917 spots for SRR7171919.sra Read 678917 spots for SRR7171919.sra Written 678917 spots for SRR7171919.sra Read 678917 spots for SRR7171919.sra Written 678917 spots for SRR7171919.sra Read 678917 spots for SRR7171919.sra Written 678917 spots for SRR7171919.sra Read 678919 spots for SRR7171919.sra Written 678919 spots for SRR7171919.sra SRR ids: ['SRR7171919.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xx9x622s SRR7171919.sra spots: 13578342 blocks: [[1, 678917], [678918, 1357834], [1357835, 2036751], [2036752, 2715668], [2715669, 3394585], [3394586, 4073502], [4073503, 4752419], [4752420, 5431336], [5431337, 6110253], [6110254, 6789170], [6789171, 7468087], [7468088, 8147004], [8147005, 8825921], [8825922, 9504838], [9504839, 10183755], [10183756, 10862672], [10862673, 11541589], [11541590, 12220506], [12220507, 12899423], [12899424, 13578342]] SRR7171919 file size 4579554 SRR7171919 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171919 SRR7171919_1.fastq SRR7171919_2.fastq Input file: SRR7171919_1.fastq Paired file: SRR7171919_2.fastq trimmed: SRR7171919-trimmed-pair1.fastq, SRR7171919-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 14:11:05 2025 >> started Fri Feb 14 14:11:41 2025 >> done (36.140s) 13578342 read pairs processed; of these: 11729 ( 0.09%) short read pairs filtered out after trimming by size control 9412 ( 0.07%) empty read pairs filtered out after trimming by size control 13557201 (99.84%) read pairs available; of these: 5458696 (40.26%) trimmed read pairs available after processing 8098505 (59.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 4 0.00% 21 3 0.00% 22 4 0.00% 23 3 0.00% 24 2 0.00% 25 1 0.00% 26 3 0.00% 27 5 0.00% 28 2 0.00% 29 1 0.00% 30 7 0.00% 31 2 0.00% 32 3 0.00% 33 4 0.00% 34 7 0.00% 35 4 0.00% 36 2 0.00% 37 2 0.00% 38 5 0.00% 39 5 0.00% 40 2 0.00% 41 9 0.00% 42 6 0.00% 43 8 0.00% 44 8 0.00% 45 8 0.00% 46 13 0.00% 47 15 0.00% 48 15 0.00% 49 12 0.00% 50 17 0.00% 51 19 0.00% 52 18 0.00% 53 21 0.00% 54 23 0.00% 55 33 0.00% 56 49 0.00% 57 56 0.00% 58 40 0.00% 59 60 0.00% 60 47 0.00% 61 72 0.00% 62 71 0.00% 63 104 0.00% 64 87 0.00% 65 112 0.00% 66 113 0.00% 67 132 0.00% 68 155 0.00% 69 193 0.00% 70 194 0.00% 71 244 0.00% 72 281 0.00% 73 357 0.00% 74 369 0.00% 75 420 0.00% 76 457 0.00% 77 528 0.00% 78 608 0.00% 79 652 0.00% 80 705 0.01% 81 804 0.01% 82 952 0.01% 83 1141 0.01% 84 1735 0.01% 85 2211 0.02% 86 2339 0.02% 87 2745 0.02% 88 2792 0.02% 89 2710 0.02% 90 2926 0.02% 91 3052 0.02% 92 3277 0.02% 93 3490 0.03% 94 3752 0.03% 95 3734 0.03% 96 4099 0.03% 97 4299 0.03% 98 4454 0.03% 99 4729 0.03% 100 4851 0.04% 101 5306 0.04% 102 5545 0.04% 103 6062 0.04% 104 6480 0.05% 105 6821 0.05% 106 7014 0.05% 107 7432 0.05% 108 7714 0.06% 109 8213 0.06% 110 8765 0.06% 111 9573 0.07% 112 9784 0.07% 113 10370 0.08% 114 10915 0.08% 115 11567 0.09% 116 12045 0.09% 117 12829 0.09% 118 13084 0.10% 119 13495 0.10% 120 14268 0.11% 121 15237 0.11% 122 16094 0.12% 123 16822 0.12% 124 17781 0.13% 125 18783 0.14% 126 19723 0.15% 127 20585 0.15% 128 21513 0.16% 129 22876 0.17% 130 24339 0.18% 131 25730 0.19% 132 27280 0.20% 133 29720 0.22% 134 32311 0.24% 135 34368 0.25% 136 37414 0.28% 137 40207 0.30% 138 43182 0.32% 139 47665 0.35% 140 52046 0.38% 141 58395 0.43% 142 65959 0.49% 143 76972 0.57% 144 90929 0.67% 145 111291 0.82% 146 141839 1.05% 147 196504 1.45% 148 305649 2.25% 149 615730 4.54% 150 2977972 21.97% 151 8098505 59.74% 13557201 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=4.30 fanout-score-rank=15 prefix-density=0.20 prefix-fanout=3.3 sequence=AAGGATCTCTCTCCTTTAACG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=76.75 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=8.5 sequence=CAACAAGAGGAGCGGGCCTAACCAGGCTAAAAACAGGGCAGTTAAACCAACATTAATACCACAACTATCTTAATTGCCACTGACTAGCAATAACAACACCCATTTCTAAAGAAAATATCTTATTCTGCAAATCTCAGACTCTTCTCCCTCGTTGTAAACAAGGAAGAGAAGTACTTGAGTTTGACATGTAGCAAATCAAAGTTTCTAGTGGTGCTTGTTTGCAACAGTGCACTGCTTTCTGATCTCACCCTTGGTACCGGTGAGTGGGTTGTTCTCAGAAAGAATGGTGATAGCCCTAGAAAACTCCTTAAAGAAGTAATCCTGACTCTTGGCCATTTTCTTCACGTAAGGCTT criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=29 prefix-density=0.27 prefix-fanout=2.1 sequence=GGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=85.81 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=11.3 sequence=AGTGAAGAAAAACAAAAAAGAAATGGATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGC SRR7171919 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 14:12:32 Started mapping on | Feb 14 14:12:32 Finished on | Feb 14 14:14:04 Mapping speed, Million of reads per hour | 530.50 Number of input reads | 13557201 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 12831641 Uniquely mapped reads % | 94.65% Average mapped length | 296.71 Number of splices: Total | 12506272 Number of splices: Annotated (sjdb) | 12268527 Number of splices: GT/AG | 12301975 Number of splices: GC/AG | 161531 Number of splices: AT/AC | 9806 Number of splices: Non-canonical | 32960 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 300010 % of reads mapped to multiple loci | 2.21% Number of reads mapped to too many loci | 32688 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.84% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 438457 438457 438457 N_multimapping 300010 300010 300010 N_noFeature 393943 12699027 458320 N_ambiguous 137027 876 68272 UnstrandedReadsAssigned:12300671 PositiveStrandReadsAssigned:131738 NegativeStrandReadsAssigned:12305049 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171919 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171919-trimmed-pair1.fastq SRR7171919-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,557,201 reads, 12,207,731 reads pseudoaligned [quant] estimated average fragment length: 275.677 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,084 rounds 52401 SRR7171919.ke.tsv 34699 SRR7171919.se.tsv 87100 total ==> SRR7171919.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1743.32 859 41.5815 Potri.005G024800.1.v4.1 1035 760.323 167 18.5355 Potri.004G059700.1.v4.1 961 686.427 33 4.057 Potri.007G009000.2.v4.1 1416 1141.32 0 0 Potri.003G141000.2.v4.1 2943 2668.32 504 15.9396 Potri.016G087400.1.v4.1 270 67.681 716 892.753 Potri.015G069301.1.v4.1 564 297.74 0 0 Potri.010G195200.1.v4.1 1773 1498.32 192 10.8139 Potri.012G127500.1.v4.1 977 702.39 4959 595.801 ==> SRR7171919.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 422 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 352 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 230 SRR7171919 completed mapping pipeline successfully