Starting /dee2/code/volunteer_pipeline.sh SRR7171920 current disk space = 3112696627200 free memory = 1574369860 SRR7171920 SRAfilesize b85b77099815ed2216213645ea8ff935 SRR7171920.sra SRR7171920.sra file validated SRR7171920 is paired end SRR7171920 is conventional basespace SRR7171920 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171920_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.8455 18.0 18.0 30.0 18.0 33.0 2 21.33575 18.0 18.0 25.0 18.0 32.0 3 27.63975 27.0 27.0 30.0 25.0 31.0 4 29.53225 31.0 29.0 33.0 25.0 33.0 5 32.0205 33.0 32.0 33.0 31.0 33.0 6 36.5795 38.0 37.0 38.0 34.0 38.0 7 37.087 38.0 38.0 38.0 36.0 38.0 8 37.19675 38.0 38.0 38.0 36.0 38.0 9 37.2135 38.0 38.0 38.0 36.0 38.0 10-14 37.386250000000004 38.0 38.0 38.0 36.6 38.0 15-19 37.4722 38.0 38.0 38.0 37.0 38.0 20-24 37.51495 38.0 38.0 38.0 37.0 38.0 25-29 37.4593 38.0 38.0 38.0 37.0 38.0 30-34 37.40345000000001 38.0 38.0 38.0 37.0 38.0 35-39 37.38875 38.0 38.0 38.0 37.0 38.0 40-44 37.3947 38.0 38.0 38.0 37.0 38.0 45-49 37.33925000000001 38.0 38.0 38.0 37.0 38.0 50-54 37.29615 38.0 38.0 38.0 37.0 38.0 55-59 37.20515 38.0 38.0 38.0 36.0 38.0 60-64 37.15454999999999 38.0 38.0 38.0 36.0 38.0 65-69 37.04315 38.0 38.0 38.0 36.0 38.0 70-74 37.0406 38.0 38.0 38.0 36.0 38.0 75-79 36.9619 38.0 38.0 38.0 35.8 38.0 80-84 36.90585 38.0 38.0 38.0 35.0 38.0 85-89 36.82115 38.0 38.0 38.0 34.8 38.0 90-94 36.652499999999996 38.0 38.0 38.0 34.4 38.0 95-99 36.60565 38.0 38.0 38.0 34.0 38.0 100-104 36.5635 38.0 38.0 38.0 34.0 38.0 105-109 36.285450000000004 38.0 37.2 38.0 33.8 38.0 110-114 36.278099999999995 38.0 37.0 38.0 33.8 38.0 115-119 36.043600000000005 38.0 37.0 38.0 32.8 38.0 120-124 35.7958 38.0 36.6 38.0 31.0 38.0 125-129 35.7361 38.0 36.2 38.0 31.4 38.0 130-134 35.458749999999995 38.0 36.0 38.0 30.2 38.0 135-139 35.1077 38.0 35.4 38.0 28.0 38.0 140-144 34.67335 38.0 35.0 38.0 27.2 38.0 145-149 34.1915 38.0 35.0 38.0 25.0 38.0 150-151 30.755375 36.5 30.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 1.0 16 1.0 17 3.0 18 1.0 19 4.0 20 1.0 21 0.0 22 2.0 23 4.0 24 5.0 25 9.0 26 10.0 27 20.0 28 15.0 29 28.0 30 43.0 31 61.0 32 62.0 33 119.0 34 206.0 35 348.0 36 1017.0 37 2037.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.525 20.4 11.05 35.025 2 19.10477619404851 27.131782945736433 26.006501625406354 27.7569392348087 3 18.3 27.700000000000003 26.650000000000002 27.35 4 21.475 33.775 23.724999999999998 21.025 5 21.9 35.675000000000004 22.925 19.5 6 18.375 36.65 25.1 19.875 7 13.375 23.225 43.1 20.3 8 16.3 23.75 29.799999999999997 30.15 9 17.2 23.1 31.874999999999996 27.825 10-14 20.005 29.32 26.790000000000003 23.885 15-19 20.31 27.810000000000002 28.189999999999998 23.69 20-24 19.34 28.115000000000002 28.605000000000004 23.94 25-29 20.135 29.17 27.125 23.57 30-34 20.06 28.544999999999998 27.834999999999997 23.56 35-39 20.18 28.49 27.639999999999997 23.69 40-44 19.825 28.655 27.744999999999997 23.775 45-49 20.165 28.74 26.935 24.16 50-54 20.335 28.345 27.675 23.645 55-59 19.68 28.549999999999997 27.465 24.305 60-64 20.48 27.889999999999997 27.525 24.104999999999997 65-69 20.544999999999998 27.83 27.725 23.9 70-74 20.419999999999998 28.215 27.52 23.845 75-79 20.21 27.485 27.975 24.33 80-84 20.105 27.750000000000004 27.975 24.169999999999998 85-89 20.53 28.095 28.015 23.36 90-94 20.95 28.804999999999996 26.685 23.56 95-99 20.419999999999998 27.72 27.725 24.135 100-104 20.135 28.134999999999998 27.85 23.880000000000003 105-109 20.49 27.834999999999997 27.915 23.76 110-114 20.549999999999997 27.839999999999996 27.35 24.26 115-119 20.355 28.499999999999996 27.26 23.885 120-124 20.849999999999998 28.265 26.805 24.08 125-129 20.595 28.075 27.715 23.615 130-134 20.965 28.000000000000004 27.405 23.630000000000003 135-139 20.605 28.060000000000002 27.755000000000003 23.580000000000002 140-144 20.665 28.015 27.3 24.02 145-149 21.365000000000002 27.875 27.565 23.195 150-151 21.087500000000002 27.4125 27.237499999999997 24.2625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 1.0 21 0.5 22 0.5 23 1.5 24 2.5 25 4.0 26 7.0 27 5.5 28 4.0 29 7.5 30 17.5 31 23.0 32 23.0 33 32.0 34 49.5 35 57.0 36 70.5 37 102.0 38 137.5 39 177.0 40 189.5 41 200.5 42 250.5 43 288.0 44 287.5 45 285.5 46 281.5 47 252.0 48 222.5 49 203.5 50 197.0 51 160.5 52 112.5 53 90.0 54 63.0 55 51.0 56 38.5 57 23.0 58 18.5 59 13.0 60 9.0 61 9.0 62 8.0 63 8.5 64 4.5 65 1.0 66 1.5 67 1.5 68 0.5 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.4375 0.0 0.0 0.0 0.0 110-111 0.4875 0.0 0.0 0.0 0.0 112-113 0.5 0.0 0.0 0.0 0.0 114-115 0.5625 0.0 0.0 0.0 0.0 116-117 0.7 0.0 0.0 0.0 0.0 118-119 0.825 0.0 0.0 0.0 0.0 120-121 0.8999999999999999 0.0 0.0 0.0 0.0 122-123 0.95 0.0 0.0 0.0 0.0 124-125 1.0750000000000002 0.0 0.0 0.0 0.0 126-127 1.225 0.0 0.0 0.0 0.0 128-129 1.4 0.0 0.0 0.0 0.0 130-131 1.5499999999999998 0.0 0.0 0.0 0.0 132-133 1.6124999999999998 0.0 0.0 0.0 0.0 134-135 1.8250000000000002 0.0 0.0 0.0 0.0 136-137 1.975 0.0 0.0 0.0 0.0 138-139 2.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171920 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171920_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.976 33.0 33.0 34.0 32.0 34.0 2 33.0085 34.0 33.0 34.0 32.0 34.0 3 33.0785 34.0 33.0 34.0 32.0 34.0 4 32.9865 34.0 33.0 34.0 32.0 34.0 5 33.07425 34.0 33.0 34.0 33.0 34.0 6 37.28175 38.0 38.0 38.0 37.0 38.0 7 37.2215 38.0 38.0 38.0 37.0 38.0 8 37.26175 38.0 38.0 38.0 37.0 38.0 9 37.1815 38.0 38.0 38.0 37.0 38.0 10-14 37.214150000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.189800000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.21635 38.0 38.0 38.0 37.0 38.0 25-29 37.17065 38.0 38.0 38.0 37.0 38.0 30-34 37.1395 38.0 38.0 38.0 37.0 38.0 35-39 37.100899999999996 38.0 38.0 38.0 36.8 38.0 40-44 36.8845 38.0 38.0 38.0 36.2 38.0 45-49 37.07075 38.0 38.0 38.0 36.4 38.0 50-54 37.04665 38.0 38.0 38.0 36.8 38.0 55-59 36.96725 38.0 38.0 38.0 36.0 38.0 60-64 36.91224999999999 38.0 38.0 38.0 36.0 38.0 65-69 36.904650000000004 38.0 38.0 38.0 36.0 38.0 70-74 36.846349999999994 38.0 38.0 38.0 36.0 38.0 75-79 36.785999999999994 38.0 38.0 38.0 35.8 38.0 80-84 36.70085 38.0 38.0 38.0 35.2 38.0 85-89 36.6087 38.0 38.0 38.0 35.0 38.0 90-94 36.4052 38.0 38.0 38.0 34.0 38.0 95-99 36.31215 38.0 38.0 38.0 34.0 38.0 100-104 36.1885 38.0 38.0 38.0 34.0 38.0 105-109 36.007600000000004 38.0 37.4 38.0 33.0 38.0 110-114 36.00055 38.0 37.2 38.0 33.0 38.0 115-119 35.738 38.0 37.0 38.0 31.8 38.0 120-124 35.60325 38.0 37.0 38.0 31.4 38.0 125-129 35.314499999999995 38.0 36.2 38.0 30.6 38.0 130-134 35.0121 38.0 36.0 38.0 28.2 38.0 135-139 34.719950000000004 38.0 35.2 38.0 27.6 38.0 140-144 34.26985 38.0 35.0 38.0 24.6 38.0 145-149 33.87145 38.0 35.0 38.0 21.8 38.0 150-151 29.941375 36.5 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 5.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 2.0 10 0.0 11 0.0 12 4.0 13 2.0 14 5.0 15 3.0 16 4.0 17 5.0 18 4.0 19 1.0 20 5.0 21 7.0 22 9.0 23 5.0 24 9.0 25 14.0 26 15.0 27 23.0 28 26.0 29 26.0 30 42.0 31 54.0 32 60.0 33 92.0 34 147.0 35 269.0 36 649.0 37 2504.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.475 18.5 15.225 23.799999999999997 2 25.575 23.625 32.2 18.6 3 21.7 26.700000000000003 31.874999999999996 19.725 4 23.7 34.725 22.525000000000002 19.05 5 23.425 36.05 21.575 18.95 6 19.55 37.175000000000004 23.925 19.35 7 18.9 19.025 39.050000000000004 23.025000000000002 8 19.8 24.2 27.275 28.725 9 21.45 25.124999999999996 28.599999999999998 24.825 10-14 23.025000000000002 27.994999999999997 27.089999999999996 21.89 15-19 22.689999999999998 28.134999999999998 27.345000000000002 21.83 20-24 23.025000000000002 28.235 27.08 21.66 25-29 22.975 28.59 27.495000000000005 20.94 30-34 22.43 27.794999999999998 27.834999999999997 21.94 35-39 22.716358179089543 28.459229614807402 27.133566783391693 21.690845422711355 40-44 22.901720764561283 27.532232980484622 28.074048061004365 21.491998193949733 45-49 23.46 27.915 27.584999999999997 21.04 50-54 23.015 27.905 27.495000000000005 21.584999999999997 55-59 23.18 27.93 27.38 21.51 60-64 22.795 28.28 28.005000000000003 20.919999999999998 65-69 23.75 27.845 27.63 20.775 70-74 23.455000000000002 28.050000000000004 27.54 20.955 75-79 23.549999999999997 27.67 27.805000000000003 20.974999999999998 80-84 23.76 28.249999999999996 27.305 20.685000000000002 85-89 24.04 28.34 27.13 20.49 90-94 23.35 28.03 27.375 21.245 95-99 23.925 27.715 27.625 20.735 100-104 23.945 27.865000000000002 27.265 20.925 105-109 24.035 27.175 28.03 20.76 110-114 24.015 27.48 27.12 21.385 115-119 23.849999999999998 27.994999999999997 27.334999999999997 20.82 120-124 23.97 27.87 27.205000000000002 20.955 125-129 23.435 28.205000000000002 27.18 21.18 130-134 23.925 27.235 28.060000000000002 20.78 135-139 24.025 27.235 27.92 20.82 140-144 23.974999999999998 27.705000000000002 27.445000000000004 20.875 145-149 24.044999999999998 27.845 28.065 20.044999999999998 150-151 24.474999999999998 27.525 27.287499999999998 20.7125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.5 24 3.0 25 4.0 26 2.5 27 2.5 28 2.5 29 1.5 30 4.0 31 11.0 32 17.0 33 24.0 34 44.5 35 59.5 36 71.0 37 101.0 38 123.5 39 155.0 40 185.5 41 220.0 42 266.5 43 292.5 44 294.0 45 260.5 46 265.0 47 279.0 48 238.0 49 206.5 50 197.5 51 168.5 52 139.5 53 103.0 54 62.0 55 48.5 56 35.0 57 26.5 58 23.5 59 14.5 60 10.5 61 10.0 62 7.0 63 5.0 64 2.5 65 2.5 66 2.5 67 2.5 68 1.5 69 0.0 70 0.0 71 0.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.05 40-44 0.335 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.4375 0.0 0.0 0.0 0.0 110-111 0.5 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.5875 0.0 0.0 0.0 0.0 116-117 0.725 0.0 0.0 0.0 0.0 118-119 0.85 0.0 0.0 0.0 0.0 120-121 0.925 0.0 0.0 0.0 0.0 122-123 0.9875 0.0 0.0 0.0 0.0 124-125 1.1 0.0 0.0 0.0 0.0 126-127 1.25 0.0 0.0 0.0 0.0 128-129 1.4375 0.0 0.0 0.0 0.0 130-131 1.6 0.0 0.0 0.0 0.0 132-133 1.6625 0.0 0.0 0.0 0.0 134-135 1.8875000000000002 0.0 0.0 0.0 0.0 136-137 2.05 0.0 0.0 0.0 0.0 138-139 2.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTCTAA 10 0.0068484643 144.875 6 CAACTAC 10 0.0068484643 144.875 3 CTTTCTA 10 0.0068484643 144.875 5 >>END_MODULE Read 656327 spots for SRR7171920.sra Written 656327 spots for SRR7171920.sra Read 656327 spots for SRR7171920.sra Written 656327 spots for SRR7171920.sra Read 656327 spots for SRR7171920.sra Written 656327 spots for SRR7171920.sra Read 656327 spots for SRR7171920.sra Written 656327 spots for SRR7171920.sra Read 656327 spots for SRR7171920.sra Written 656327 spots for SRR7171920.sra Read 656327 spots for SRR7171920.sra Written 656327 spots for SRR7171920.sra Read 656327 spots for SRR7171920.sra Written 656327 spots for SRR7171920.sra Read 656327 spots for SRR7171920.sra Written 656327 spots for SRR7171920.sra Read 656327 spots for SRR7171920.sra Written 656327 spots for SRR7171920.sra Read 656327 spots for SRR7171920.sra Written 656327 spots for SRR7171920.sra Read 656327 spots for SRR7171920.sra Written 656327 spots for SRR7171920.sra Read 656327 spots for SRR7171920.sra Written 656327 spots for SRR7171920.sra Read 656327 spots for SRR7171920.sra Written 656327 spots for SRR7171920.sra Read 656327 spots for SRR7171920.sra Written 656327 spots for SRR7171920.sra Read 656327 spots for SRR7171920.sra Written 656327 spots for SRR7171920.sra Read 656327 spots for SRR7171920.sra Written 656327 spots for SRR7171920.sra Read 656327 spots for SRR7171920.sra Written 656327 spots for SRR7171920.sra Read 656327 spots for SRR7171920.sra Written 656327 spots for SRR7171920.sra Read 656330 spots for SRR7171920.sra Written 656330 spots for SRR7171920.sra Read 656327 spots for SRR7171920.sra Written 656327 spots for SRR7171920.sra SRR ids: ['SRR7171920.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9nskgf00 SRR7171920.sra spots: 13126543 blocks: [[1, 656327], [656328, 1312654], [1312655, 1968981], [1968982, 2625308], [2625309, 3281635], [3281636, 3937962], [3937963, 4594289], [4594290, 5250616], [5250617, 5906943], [5906944, 6563270], [6563271, 7219597], [7219598, 7875924], [7875925, 8532251], [8532252, 9188578], [9188579, 9844905], [9844906, 10501232], [10501233, 11157559], [11157560, 11813886], [11813887, 12470213], [12470214, 13126543]] SRR7171920 file size 4426454 SRR7171920 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171920 SRR7171920_1.fastq SRR7171920_2.fastq Input file: SRR7171920_1.fastq Paired file: SRR7171920_2.fastq trimmed: SRR7171920-trimmed-pair1.fastq, SRR7171920-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 15:30:18 2025 >> started Fri Feb 14 15:30:33 2025 >> done (14.362s) 13126543 read pairs processed; of these: 16203 ( 0.12%) short read pairs filtered out after trimming by size control 11869 ( 0.09%) empty read pairs filtered out after trimming by size control 13098471 (99.79%) read pairs available; of these: 5310166 (40.54%) trimmed read pairs available after processing 7788305 (59.46%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 0 0.00% 20 4 0.00% 21 6 0.00% 22 4 0.00% 23 5 0.00% 24 1 0.00% 25 7 0.00% 26 4 0.00% 27 7 0.00% 28 7 0.00% 29 5 0.00% 30 4 0.00% 31 4 0.00% 32 4 0.00% 33 8 0.00% 34 9 0.00% 35 11 0.00% 36 6 0.00% 37 4 0.00% 38 7 0.00% 39 3 0.00% 40 11 0.00% 41 3 0.00% 42 10 0.00% 43 7 0.00% 44 6 0.00% 45 10 0.00% 46 9 0.00% 47 8 0.00% 48 7 0.00% 49 14 0.00% 50 13 0.00% 51 28 0.00% 52 23 0.00% 53 22 0.00% 54 28 0.00% 55 21 0.00% 56 37 0.00% 57 30 0.00% 58 29 0.00% 59 57 0.00% 60 43 0.00% 61 61 0.00% 62 59 0.00% 63 82 0.00% 64 76 0.00% 65 86 0.00% 66 118 0.00% 67 122 0.00% 68 120 0.00% 69 132 0.00% 70 164 0.00% 71 213 0.00% 72 236 0.00% 73 252 0.00% 74 256 0.00% 75 340 0.00% 76 420 0.00% 77 452 0.00% 78 462 0.00% 79 510 0.00% 80 608 0.00% 81 765 0.01% 82 796 0.01% 83 977 0.01% 84 1669 0.01% 85 2234 0.02% 86 2180 0.02% 87 2476 0.02% 88 2558 0.02% 89 2716 0.02% 90 2723 0.02% 91 2929 0.02% 92 2972 0.02% 93 3084 0.02% 94 3408 0.03% 95 3441 0.03% 96 3691 0.03% 97 3889 0.03% 98 3940 0.03% 99 4091 0.03% 100 4505 0.03% 101 4909 0.04% 102 5294 0.04% 103 5470 0.04% 104 5947 0.05% 105 6244 0.05% 106 6341 0.05% 107 6793 0.05% 108 7047 0.05% 109 7236 0.06% 110 7906 0.06% 111 8391 0.06% 112 8781 0.07% 113 9410 0.07% 114 10201 0.08% 115 10741 0.08% 116 11310 0.09% 117 11650 0.09% 118 12308 0.09% 119 12586 0.10% 120 13169 0.10% 121 13818 0.11% 122 14288 0.11% 123 15690 0.12% 124 16545 0.13% 125 17074 0.13% 126 18321 0.14% 127 18843 0.14% 128 20197 0.15% 129 20981 0.16% 130 22099 0.17% 131 23890 0.18% 132 25481 0.19% 133 27211 0.21% 134 29017 0.22% 135 31061 0.24% 136 34018 0.26% 137 36090 0.28% 138 39448 0.30% 139 43356 0.33% 140 47362 0.36% 141 52953 0.40% 142 60291 0.46% 143 70035 0.53% 144 83745 0.64% 145 102515 0.78% 146 133130 1.02% 147 186124 1.42% 148 296936 2.27% 149 607872 4.64% 150 2969698 22.67% 151 7788305 59.46% 13098471 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=26 prefix-density=0.37 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.12 sequence-density-rank=17 fanout-score=37.72 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=11.0 sequence=CCTTCCTTGTCCTGGATCTTGGCCTTCAC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=4.46 fanout-score-rank=15 prefix-density=0.65 prefix-fanout=3.3 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=60.96 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.8 sequence=GAAGGATCTGTTTAATTTGAGACAGAAAACATGAAATCCTCCTACACTTTCTTCATTCTTTTCTCACTCTTTTCGTTTGCTAACGTGATCGGTGCTAGAAAAGACACTGGAGAGTATTGGAGAGCTGTCATGAAAGATCAGCCCATGCCAGAAGCAATACATGGCCTTATTCGCGAAACCACATTGTCATCAGTCTCCAATGAGAAAGCCGATTGCCACACAACCGAGTCCAATGAAAAGAATAATTTTGTCAAGGATTTTGGCCCACAGCCTACTGCTACATCTTATGACAATGGTATAAAACCAGCAAAAGATAAGTCCTTTTCGAAACATTTCCACCCAAACTCTCAGTTGTTCCTTTACAATGATGGTGACGTTAAAGGAGAGAGATCCTTCGCTGAAGATGT SRR7171920 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 15:31:49 Started mapping on | Feb 14 15:31:49 Finished on | Feb 14 15:33:24 Mapping speed, Million of reads per hour | 496.36 Number of input reads | 13098471 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 12147308 Uniquely mapped reads % | 92.74% Average mapped length | 296.77 Number of splices: Total | 12344587 Number of splices: Annotated (sjdb) | 12137262 Number of splices: GT/AG | 12155556 Number of splices: GC/AG | 150988 Number of splices: AT/AC | 9543 Number of splices: Non-canonical | 28500 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.87 Insertion rate per base | 0.02% Insertion average length | 2.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 351614 % of reads mapped to multiple loci | 2.68% Number of reads mapped to too many loci | 32886 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.25% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 615316 615316 615316 N_multimapping 351614 351614 351614 N_noFeature 236925 12021730 299090 N_ambiguous 130690 744 66882 UnstrandedReadsAssigned:11779693 PositiveStrandReadsAssigned:124834 NegativeStrandReadsAssigned:11781336 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171920 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171920-trimmed-pair1.fastq SRR7171920-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,098,471 reads, 11,676,374 reads pseudoaligned [quant] estimated average fragment length: 273.058 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,224 rounds 52401 SRR7171920.ke.tsv 34699 SRR7171920.se.tsv 87100 total ==> SRR7171920.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1745.94 894 37.8706 Potri.005G024800.1.v4.1 1035 762.942 308 29.8575 Potri.004G059700.1.v4.1 961 689.003 21 2.2542 Potri.007G009000.2.v4.1 1416 1143.94 0 0 Potri.003G141000.2.v4.1 2943 2670.94 422 11.6854 Potri.016G087400.1.v4.1 270 68.189 814 882.886 Potri.015G069301.1.v4.1 564 300.289 0 0 Potri.010G195200.1.v4.1 1773 1500.94 160.816 7.92426 Potri.012G127500.1.v4.1 977 704.975 2367 248.324 ==> SRR7171920.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 41 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 296 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 120 SRR7171920 completed mapping pipeline successfully