Starting /dee2/code/volunteer_pipeline.sh SRR7171921 current disk space = 3112524718080 free memory = 1577601496 SRR7171921 SRAfilesize f60e77790f423f38e827df752d4955a4 SRR7171921.sra SRR7171921.sra file validated SRR7171921 is paired end SRR7171921 is conventional basespace SRR7171921 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171921_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.52575 18.0 18.0 18.0 18.0 32.0 2 28.82975 27.0 27.0 32.0 25.0 32.0 3 29.37 31.0 29.0 31.0 25.0 33.0 4 29.233 31.0 29.0 33.0 25.0 33.0 5 32.0865 33.0 32.0 33.0 31.0 33.0 6 35.742 37.0 36.0 38.0 31.0 38.0 7 36.94425 38.0 37.0 38.0 35.0 38.0 8 36.9715 38.0 38.0 38.0 35.0 38.0 9 37.26625 38.0 38.0 38.0 36.0 38.0 10-14 37.38565 38.0 38.0 38.0 36.8 38.0 15-19 37.40195 38.0 38.0 38.0 37.0 38.0 20-24 37.38605 38.0 38.0 38.0 37.0 38.0 25-29 37.3734 38.0 38.0 38.0 37.0 38.0 30-34 37.349900000000005 38.0 38.0 38.0 36.8 38.0 35-39 37.3085 38.0 38.0 38.0 37.0 38.0 40-44 37.29185 38.0 38.0 38.0 37.0 38.0 45-49 37.2265 38.0 38.0 38.0 36.6 38.0 50-54 37.168 38.0 38.0 38.0 36.0 38.0 55-59 37.10885 38.0 38.0 38.0 36.0 38.0 60-64 37.0598 38.0 38.0 38.0 36.0 38.0 65-69 36.96035 38.0 38.0 38.0 35.8 38.0 70-74 36.9489 38.0 38.0 38.0 36.0 38.0 75-79 36.84135 38.0 38.0 38.0 35.0 38.0 80-84 36.7363 38.0 38.0 38.0 34.8 38.0 85-89 36.7046 38.0 38.0 38.0 34.8 38.0 90-94 36.6273 38.0 38.0 38.0 34.2 38.0 95-99 36.48155 38.0 38.0 38.0 34.0 38.0 100-104 36.3582 38.0 37.8 38.0 33.8 38.0 105-109 36.1237 38.0 37.0 38.0 32.8 38.0 110-114 36.07015 38.0 37.0 38.0 33.0 38.0 115-119 35.8162 38.0 36.6 38.0 31.8 38.0 120-124 35.694 38.0 36.2 38.0 31.0 38.0 125-129 35.558749999999996 38.0 36.0 38.0 31.0 38.0 130-134 35.186350000000004 38.0 35.6 38.0 28.8 38.0 135-139 34.884299999999996 38.0 35.0 38.0 27.8 38.0 140-144 34.572250000000004 38.0 35.0 38.0 26.2 38.0 145-149 33.95725 38.0 35.0 38.0 24.2 38.0 150-151 30.367124999999998 36.5 28.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 3.0 10 0.0 11 2.0 12 0.0 13 0.0 14 1.0 15 0.0 16 2.0 17 2.0 18 0.0 19 2.0 20 5.0 21 5.0 22 3.0 23 5.0 24 4.0 25 12.0 26 17.0 27 23.0 28 23.0 29 34.0 30 48.0 31 55.0 32 81.0 33 108.0 34 199.0 35 353.0 36 950.0 37 2063.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.075000000000003 12.2 21.2 36.525 2 19.10477619404851 18.72968242060515 39.334833708427105 22.83070767691923 3 19.900000000000002 23.0 27.85 29.25 4 21.5 33.300000000000004 22.2 23.0 5 22.8 34.525 23.525 19.15 6 18.2 37.1 24.875 19.825 7 13.975000000000001 22.125 45.0 18.9 8 17.7 22.3 31.7 28.299999999999997 9 18.2 22.6 32.7 26.5 10-14 20.035 29.525000000000002 27.05 23.39 15-19 20.115 28.060000000000002 27.805000000000003 24.02 20-24 20.565 27.884999999999998 27.72 23.830000000000002 25-29 20.09 28.43 27.700000000000003 23.78 30-34 19.82 29.020000000000003 27.105 24.055 35-39 20.200000000000003 28.57 27.305 23.925 40-44 20.455000000000002 28.595 27.435 23.515 45-49 20.13 28.58 27.165 24.125 50-54 20.53 28.265 27.505000000000003 23.7 55-59 20.5 27.694999999999997 28.244999999999997 23.56 60-64 20.615 28.26 27.229999999999997 23.895 65-69 19.91 28.165000000000003 27.805000000000003 24.12 70-74 20.474999999999998 28.54 27.529999999999998 23.455000000000002 75-79 20.76 28.215 27.169999999999998 23.855 80-84 20.215 28.02 27.310000000000002 24.455 85-89 20.335 28.37 27.529999999999998 23.765 90-94 20.835 27.77 27.35 24.044999999999998 95-99 20.77 27.51 27.935 23.785 100-104 20.39 27.884999999999998 27.800000000000004 23.925 105-109 20.615 27.860000000000003 28.115000000000002 23.41 110-114 20.75 27.93 28.18 23.14 115-119 21.23 27.925 27.32 23.525 120-124 21.11 27.79 27.36 23.74 125-129 21.005 28.349999999999998 27.095000000000002 23.549999999999997 130-134 21.17 27.750000000000004 27.650000000000002 23.43 135-139 20.955 27.49 27.98 23.575 140-144 20.74 27.57 27.38 24.310000000000002 145-149 21.275 28.32 26.965 23.44 150-151 20.6875 28.5625 27.200000000000003 23.549999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 1.0 22 2.0 23 2.0 24 1.5 25 2.5 26 3.0 27 5.5 28 8.5 29 12.0 30 11.0 31 15.0 32 25.0 33 32.0 34 44.5 35 59.0 36 80.0 37 101.5 38 128.0 39 164.0 40 186.0 41 215.0 42 244.0 43 281.5 44 284.0 45 258.0 46 273.5 47 272.5 48 231.0 49 200.0 50 196.5 51 164.5 52 118.0 53 99.0 54 83.0 55 55.5 56 38.0 57 27.5 58 16.5 59 13.0 60 11.5 61 6.0 62 4.0 63 5.0 64 2.5 65 2.0 66 3.0 67 2.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.23750000000000002 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.525 0.0 0.0 0.0 0.0 112-113 0.6125 0.0 0.0 0.0 0.0 114-115 0.7375 0.0 0.0 0.0 0.0 116-117 0.925 0.0 0.0 0.0 0.0 118-119 1.0625 0.0 0.0 0.0 0.0 120-121 1.1875 0.0 0.0 0.0 0.0 122-123 1.2999999999999998 0.0 0.0 0.0 0.0 124-125 1.4125 0.0 0.0 0.0 0.0 126-127 1.4625 0.0 0.0 0.0 0.0 128-129 1.5875 0.0 0.0 0.0 0.0 130-131 1.6875 0.0 0.0 0.0 0.0 132-133 1.825 0.0 0.0 0.0 0.0 134-135 1.9874999999999998 0.0 0.0 0.0 0.0 136-137 2.1875 0.0 0.0 0.0 0.0 138-139 2.4749999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTACAAA 10 0.006830828 145.0 5 >>END_MODULE SRR7171921 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171921_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.98975 33.0 33.0 34.0 32.0 34.0 2 33.077 34.0 33.0 34.0 32.0 34.0 3 33.12675 34.0 33.0 34.0 33.0 34.0 4 33.10075 34.0 33.0 34.0 32.0 34.0 5 33.15325 34.0 33.0 34.0 33.0 34.0 6 37.345 38.0 38.0 38.0 37.0 38.0 7 37.215 38.0 38.0 38.0 37.0 38.0 8 37.28325 38.0 38.0 38.0 37.0 38.0 9 37.26025 38.0 38.0 38.0 37.0 38.0 10-14 37.314099999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.24435 38.0 38.0 38.0 37.0 38.0 20-24 37.26925000000001 38.0 38.0 38.0 37.0 38.0 25-29 37.27245 38.0 38.0 38.0 37.0 38.0 30-34 37.1923 38.0 38.0 38.0 37.0 38.0 35-39 37.1318 38.0 38.0 38.0 36.6 38.0 40-44 36.9716 38.0 38.0 38.0 36.2 38.0 45-49 37.1654 38.0 38.0 38.0 36.4 38.0 50-54 37.061150000000005 38.0 38.0 38.0 36.0 38.0 55-59 37.0566 38.0 38.0 38.0 36.0 38.0 60-64 36.9593 38.0 38.0 38.0 35.6 38.0 65-69 36.892399999999995 38.0 38.0 38.0 35.8 38.0 70-74 36.83845 38.0 38.0 38.0 35.6 38.0 75-79 36.834700000000005 38.0 38.0 38.0 35.2 38.0 80-84 36.720600000000005 38.0 38.0 38.0 34.8 38.0 85-89 36.638749999999995 38.0 38.0 38.0 34.4 38.0 90-94 36.4141 38.0 38.0 38.0 34.0 38.0 95-99 36.31815 38.0 38.0 38.0 34.0 38.0 100-104 36.18465 38.0 37.4 38.0 33.6 38.0 105-109 36.00335 38.0 37.0 38.0 32.6 38.0 110-114 35.895300000000006 38.0 37.0 38.0 32.4 38.0 115-119 35.7452 38.0 37.0 38.0 31.0 38.0 120-124 35.668899999999994 38.0 36.8 38.0 31.4 38.0 125-129 35.341300000000004 38.0 36.0 38.0 30.6 38.0 130-134 34.972950000000004 38.0 35.4 38.0 28.0 38.0 135-139 34.5388 38.0 35.0 38.0 26.6 38.0 140-144 34.28150000000001 38.0 35.0 38.0 24.4 38.0 145-149 33.590149999999994 38.0 34.8 38.0 20.6 38.0 150-151 29.594125 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 2.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 2.0 14 4.0 15 1.0 16 2.0 17 2.0 18 1.0 19 6.0 20 7.0 21 5.0 22 2.0 23 11.0 24 14.0 25 14.0 26 24.0 27 21.0 28 20.0 29 26.0 30 43.0 31 66.0 32 81.0 33 103.0 34 157.0 35 341.0 36 665.0 37 2375.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.375 16.6 14.524999999999999 28.499999999999996 2 22.425 25.6 33.775 18.2 3 19.125 28.825 30.599999999999998 21.45 4 23.45 34.699999999999996 22.6 19.25 5 24.099999999999998 37.225 21.325 17.349999999999998 6 18.775 39.35 22.825 19.05 7 18.725 18.7 39.975 22.6 8 20.125 23.674999999999997 27.224999999999998 28.975 9 22.125 24.8 27.55 25.525 10-14 22.49 28.02 27.015 22.475 15-19 22.495 27.975 27.29 22.24 20-24 22.09 27.794999999999998 28.139999999999997 21.975 25-29 22.225 28.22 27.735 21.82 30-34 22.515 28.050000000000004 27.105 22.33 35-39 22.12553138284571 28.06201550387597 27.73693423355839 22.07551887971993 40-44 22.102939701013344 27.58101735727902 28.27831845088793 22.037724490819706 45-49 22.575 28.04 27.400000000000002 21.985 50-54 22.975 28.355000000000004 27.139999999999997 21.529999999999998 55-59 23.135 28.185 27.165 21.515 60-64 22.985 28.349999999999998 27.6 21.065 65-69 23.005 28.139999999999997 27.884999999999998 20.97 70-74 22.5 28.57 27.415 21.515 75-79 23.150000000000002 28.095 27.175 21.58 80-84 23.415 27.900000000000002 27.36 21.325 85-89 22.994999999999997 28.455000000000002 27.384999999999998 21.165 90-94 23.919999999999998 28.084999999999997 27.134999999999998 20.86 95-99 23.47 27.715 27.744999999999997 21.07 100-104 24.015 27.62 27.089999999999996 21.275 105-109 23.965 27.845 27.27 20.919999999999998 110-114 23.035 28.13 27.675 21.16 115-119 24.085 28.044999999999998 27.02 20.849999999999998 120-124 23.705000000000002 27.67 27.800000000000004 20.825 125-129 23.715 27.575 27.845 20.865000000000002 130-134 23.794999999999998 27.810000000000002 27.395000000000003 21.0 135-139 24.060000000000002 27.565 27.439999999999998 20.935000000000002 140-144 23.575 27.61 27.97 20.845 145-149 24.075 28.375 26.889999999999997 20.66 150-151 24.05 28.012500000000003 26.55 21.3875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.0 23 0.0 24 1.0 25 1.5 26 1.5 27 2.0 28 2.0 29 4.5 30 11.5 31 17.0 32 18.0 33 23.5 34 34.5 35 53.5 36 68.5 37 86.5 38 116.0 39 156.5 40 197.5 41 248.0 42 280.0 43 274.5 44 290.5 45 294.0 46 276.0 47 259.0 48 238.5 49 217.0 50 179.0 51 145.5 52 117.5 53 92.5 54 75.5 55 56.5 56 43.0 57 39.0 58 25.5 59 9.5 60 8.5 61 7.0 62 7.0 63 6.0 64 3.0 65 4.0 66 3.0 67 0.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.025 40-44 0.33 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.23750000000000002 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.5 0.0 0.0 0.0 0.0 112-113 0.575 0.0 0.0 0.0 0.0 114-115 0.6875 0.0 0.0 0.0 0.0 116-117 0.875 0.0 0.0 0.0 0.0 118-119 1.0125 0.0 0.0 0.0 0.0 120-121 1.125 0.0 0.0 0.0 0.0 122-123 1.225 0.0 0.0 0.0 0.0 124-125 1.3375 0.0 0.0 0.0 0.0 126-127 1.3875 0.0 0.0 0.0 0.0 128-129 1.5125 0.0 0.0 0.0 0.0 130-131 1.625 0.0 0.0 0.0 0.0 132-133 1.775 0.0 0.0 0.0 0.0 134-135 1.9375 0.0 0.0 0.0 0.0 136-137 2.1625 0.0 0.0 0.0 0.0 138-139 2.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAGCAC 10 0.006830828 145.0 8 >>END_MODULE Read 761706 spots for SRR7171921.sra Written 761706 spots for SRR7171921.sra Read 761706 spots for SRR7171921.sra Written 761706 spots for SRR7171921.sra Read 761706 spots for SRR7171921.sra Written 761706 spots for SRR7171921.sra Read 761706 spots for SRR7171921.sra Written 761706 spots for SRR7171921.sra Read 761706 spots for SRR7171921.sra Written 761706 spots for SRR7171921.sra Read 761706 spots for SRR7171921.sra Written 761706 spots for SRR7171921.sra Read 761706 spots for SRR7171921.sra Written 761706 spots for SRR7171921.sra Read 761706 spots for SRR7171921.sra Written 761706 spots for SRR7171921.sra Read 761706 spots for SRR7171921.sra Written 761706 spots for SRR7171921.sra Read 761706 spots for SRR7171921.sra Written 761706 spots for SRR7171921.sra Read 761706 spots for SRR7171921.sra Written 761706 spots for SRR7171921.sra Read 761706 spots for SRR7171921.sra Written 761706 spots for SRR7171921.sra Read 761706 spots for SRR7171921.sra Written 761706 spots for SRR7171921.sra Read 761706 spots for SRR7171921.sra Written 761706 spots for SRR7171921.sra Read 761706 spots for SRR7171921.sra Written 761706 spots for SRR7171921.sra Read 761706 spots for SRR7171921.sra Written 761706 spots for SRR7171921.sra Read 761706 spots for SRR7171921.sra Written 761706 spots for SRR7171921.sra Read 761708 spots for SRR7171921.sra Written 761708 spots for SRR7171921.sra Read 761706 spots for SRR7171921.sra Written 761706 spots for SRR7171921.sra Read 761706 spots for SRR7171921.sra Written 761706 spots for SRR7171921.sra SRR ids: ['SRR7171921.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g030q2za SRR7171921.sra spots: 15234122 blocks: [[1, 761706], [761707, 1523412], [1523413, 2285118], [2285119, 3046824], [3046825, 3808530], [3808531, 4570236], [4570237, 5331942], [5331943, 6093648], [6093649, 6855354], [6855355, 7617060], [7617061, 8378766], [8378767, 9140472], [9140473, 9902178], [9902179, 10663884], [10663885, 11425590], [11425591, 12187296], [12187297, 12949002], [12949003, 13710708], [13710709, 14472414], [14472415, 15234122]] SRR7171921 file size 5140643 SRR7171921 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171921 SRR7171921_1.fastq SRR7171921_2.fastq Input file: SRR7171921_1.fastq Paired file: SRR7171921_2.fastq trimmed: SRR7171921-trimmed-pair1.fastq, SRR7171921-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 15:19:42 2025 >> started Fri Feb 14 15:19:58 2025 >> done (16.075s) 15234122 read pairs processed; of these: 8820 ( 0.06%) short read pairs filtered out after trimming by size control 6628 ( 0.04%) empty read pairs filtered out after trimming by size control 15218674 (99.90%) read pairs available; of these: 6238586 (40.99%) trimmed read pairs available after processing 8980088 (59.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 0 0.00% 21 1 0.00% 22 4 0.00% 23 3 0.00% 24 3 0.00% 25 2 0.00% 26 2 0.00% 27 2 0.00% 28 2 0.00% 29 4 0.00% 30 3 0.00% 31 4 0.00% 32 3 0.00% 33 1 0.00% 34 3 0.00% 35 4 0.00% 36 4 0.00% 37 4 0.00% 38 5 0.00% 39 6 0.00% 40 8 0.00% 41 6 0.00% 42 12 0.00% 43 13 0.00% 44 6 0.00% 45 7 0.00% 46 12 0.00% 47 13 0.00% 48 9 0.00% 49 11 0.00% 50 23 0.00% 51 21 0.00% 52 25 0.00% 53 23 0.00% 54 23 0.00% 55 31 0.00% 56 32 0.00% 57 39 0.00% 58 32 0.00% 59 42 0.00% 60 45 0.00% 61 71 0.00% 62 61 0.00% 63 75 0.00% 64 67 0.00% 65 98 0.00% 66 98 0.00% 67 115 0.00% 68 125 0.00% 69 157 0.00% 70 191 0.00% 71 178 0.00% 72 220 0.00% 73 215 0.00% 74 285 0.00% 75 331 0.00% 76 354 0.00% 77 415 0.00% 78 435 0.00% 79 523 0.00% 80 591 0.00% 81 640 0.00% 82 784 0.01% 83 984 0.01% 84 1448 0.01% 85 1936 0.01% 86 2027 0.01% 87 2256 0.01% 88 2402 0.02% 89 2544 0.02% 90 2608 0.02% 91 2766 0.02% 92 2992 0.02% 93 3163 0.02% 94 3427 0.02% 95 3524 0.02% 96 3843 0.03% 97 4015 0.03% 98 4298 0.03% 99 4535 0.03% 100 4860 0.03% 101 5263 0.03% 102 5619 0.04% 103 6153 0.04% 104 6421 0.04% 105 6852 0.05% 106 7168 0.05% 107 7687 0.05% 108 7895 0.05% 109 8605 0.06% 110 9016 0.06% 111 9486 0.06% 112 10155 0.07% 113 11041 0.07% 114 11620 0.08% 115 12585 0.08% 116 13250 0.09% 117 13719 0.09% 118 14331 0.09% 119 15131 0.10% 120 15964 0.10% 121 16736 0.11% 122 17376 0.11% 123 18379 0.12% 124 19483 0.13% 125 20474 0.13% 126 21714 0.14% 127 23158 0.15% 128 24370 0.16% 129 25845 0.17% 130 26965 0.18% 131 28914 0.19% 132 30780 0.20% 133 33149 0.22% 134 35575 0.23% 135 37716 0.25% 136 41432 0.27% 137 44501 0.29% 138 48355 0.32% 139 52613 0.35% 140 58028 0.38% 141 64314 0.42% 142 73540 0.48% 143 84403 0.55% 144 99884 0.66% 145 123280 0.81% 146 158740 1.04% 147 220710 1.45% 148 351791 2.31% 149 716926 4.71% 150 3461318 22.74% 151 8980088 59.01% 15218674 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=7.39 fanout-score-rank=21 prefix-density=0.29 prefix-fanout=4.1 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.05 sequence-density-rank=28 fanout-score=481.21 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=36.3 sequence=TCTTCTTCTTCCT criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=39 prefix-density=0.17 prefix-fanout=2.1 sequence=CCAGACCAGCAGAGG criterion=fanout-score sequence-density=0.07 sequence-density-rank=31 fanout-score=270.28 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=23.1 sequence=AGAAGAAGAGAGG SRR7171921 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 15:21:23 Started mapping on | Feb 14 15:21:23 Finished on | Feb 14 15:23:13 Mapping speed, Million of reads per hour | 498.07 Number of input reads | 15218674 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14354374 Uniquely mapped reads % | 94.32% Average mapped length | 296.89 Number of splices: Total | 14862504 Number of splices: Annotated (sjdb) | 14628641 Number of splices: GT/AG | 14634863 Number of splices: GC/AG | 183725 Number of splices: AT/AC | 10509 Number of splices: Non-canonical | 33407 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.87 Insertion rate per base | 0.02% Insertion average length | 2.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 385748 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 37758 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.85% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 488693 488693 488693 N_multimapping 385748 385748 385748 N_noFeature 267115 14224419 332247 N_ambiguous 135138 818 69811 UnstrandedReadsAssigned:13952121 PositiveStrandReadsAssigned:129137 NegativeStrandReadsAssigned:13952316 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171921 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171921-trimmed-pair1.fastq SRR7171921-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,218,674 reads, 13,823,335 reads pseudoaligned [quant] estimated average fragment length: 274.299 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,013 rounds 52401 SRR7171921.ke.tsv 34699 SRR7171921.se.tsv 87100 total ==> SRR7171921.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1744.7 817 32.81 Potri.005G024800.1.v4.1 1035 761.701 177 16.2815 Potri.004G059700.1.v4.1 961 687.79 53 5.39915 Potri.007G009000.2.v4.1 1416 1142.7 1 0.0613158 Potri.003G141000.2.v4.1 2943 2669.7 454 11.9151 Potri.016G087400.1.v4.1 270 67.0477 938 980.222 Potri.015G069301.1.v4.1 564 300.23 0 0 Potri.010G195200.1.v4.1 1773 1499.7 98 4.57854 Potri.012G127500.1.v4.1 977 703.731 2409 239.848 ==> SRR7171921.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 33 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 270 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 50 SRR7171921 completed mapping pipeline successfully