Starting /dee2/code/volunteer_pipeline.sh SRR7171922 current disk space = 3110830559232 free memory = 1307883980 SRR7171922 SRAfilesize ff56f5b859c6484a66e411ae73726c56 SRR7171922.sra SRR7171922.sra file validated SRR7171922 is paired end SRR7171922 is conventional basespace SRR7171922 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171922_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.0955 32.0 18.0 33.0 18.0 33.0 2 29.64425 31.0 29.0 33.0 25.0 34.0 3 31.55925 32.0 32.0 33.0 27.0 33.0 4 29.769 32.0 30.0 33.0 25.0 33.0 5 32.22225 33.0 32.0 33.0 32.0 33.0 6 36.01625 37.0 36.0 38.0 33.0 38.0 7 36.416 38.0 36.0 38.0 34.0 38.0 8 37.18875 38.0 38.0 38.0 36.0 38.0 9 37.4215 38.0 38.0 38.0 37.0 38.0 10-14 37.5048 38.0 38.0 38.0 37.0 38.0 15-19 37.51305000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.51205 38.0 38.0 38.0 37.2 38.0 25-29 37.50995 38.0 38.0 38.0 37.2 38.0 30-34 37.499900000000004 38.0 38.0 38.0 37.2 38.0 35-39 37.4485 38.0 38.0 38.0 37.0 38.0 40-44 37.44095 38.0 38.0 38.0 37.0 38.0 45-49 37.40475 38.0 38.0 38.0 37.0 38.0 50-54 37.3494 38.0 38.0 38.0 37.0 38.0 55-59 37.2829 38.0 38.0 38.0 36.8 38.0 60-64 37.28960000000001 38.0 38.0 38.0 36.6 38.0 65-69 37.146049999999995 38.0 38.0 38.0 36.0 38.0 70-74 37.0947 38.0 38.0 38.0 36.0 38.0 75-79 37.08655 38.0 38.0 38.0 36.0 38.0 80-84 37.029450000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.92595 38.0 38.0 38.0 35.4 38.0 90-94 36.824149999999996 38.0 38.0 38.0 35.0 38.0 95-99 36.80935 38.0 38.0 38.0 34.6 38.0 100-104 36.6074 38.0 38.0 38.0 34.2 38.0 105-109 36.56705 38.0 38.0 38.0 34.0 38.0 110-114 36.41495 38.0 38.0 38.0 34.0 38.0 115-119 36.2054 38.0 37.0 38.0 33.6 38.0 120-124 36.0935 38.0 37.0 38.0 33.4 38.0 125-129 35.8257 38.0 36.4 38.0 32.0 38.0 130-134 35.56655 38.0 36.0 38.0 31.0 38.0 135-139 35.39175 38.0 36.0 38.0 30.6 38.0 140-144 35.15915 38.0 35.6 38.0 30.0 38.0 145-149 34.56245 38.0 35.0 38.0 28.0 38.0 150-151 31.5465 36.5 31.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 2.0 14 1.0 15 0.0 16 1.0 17 1.0 18 2.0 19 1.0 20 2.0 21 2.0 22 5.0 23 2.0 24 7.0 25 13.0 26 12.0 27 4.0 28 20.0 29 26.0 30 34.0 31 39.0 32 49.0 33 99.0 34 147.0 35 305.0 36 815.0 37 2410.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.35 13.8 12.0 31.85 2 21.73043260815204 18.30457614403601 36.809202300575144 23.15578894723681 3 20.150000000000002 25.7 28.15 26.0 4 23.775 31.15 22.8 22.275 5 22.825 34.699999999999996 22.95 19.525000000000002 6 18.85 36.199999999999996 24.2 20.75 7 12.325 23.225 44.45 20.0 8 18.425 23.25 29.4 28.925 9 18.35 23.625 31.775 26.25 10-14 20.345 29.435 26.939999999999998 23.28 15-19 20.74 28.265 27.045 23.95 20-24 20.599999999999998 28.425 27.705000000000002 23.27 25-29 20.73 28.439999999999998 27.634999999999998 23.195 30-34 20.46 28.34 27.345000000000002 23.855 35-39 20.94 28.470000000000002 27.325 23.265 40-44 19.925 28.585 27.839999999999996 23.65 45-49 20.73 27.750000000000004 27.785 23.735 50-54 20.345 28.49 28.055000000000003 23.11 55-59 20.3 28.505000000000003 27.994999999999997 23.200000000000003 60-64 20.305 27.435 28.199999999999996 24.060000000000002 65-69 20.665 27.93 27.805000000000003 23.599999999999998 70-74 20.880000000000003 27.965 27.339999999999996 23.815 75-79 20.810000000000002 28.125 27.425 23.64 80-84 21.224999999999998 28.110000000000003 27.1 23.565 85-89 20.735 27.939999999999998 27.505000000000003 23.82 90-94 20.78 28.060000000000002 27.51 23.65 95-99 20.560000000000002 27.765 27.87 23.805 100-104 20.735 28.199999999999996 27.495000000000005 23.57 105-109 21.025 27.865000000000002 27.48 23.630000000000003 110-114 21.02 27.685 28.205000000000002 23.09 115-119 21.02 27.88 27.939999999999998 23.16 120-124 21.005 27.115000000000002 27.755000000000003 24.125 125-129 21.175 27.694999999999997 27.63 23.5 130-134 20.945 28.000000000000004 27.63 23.425 135-139 21.099999999999998 27.93 27.46 23.51 140-144 20.830000000000002 27.125 27.955000000000002 24.09 145-149 20.985 28.115000000000002 26.985 23.915 150-151 20.175 27.950000000000003 28.1 23.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.5 23 2.5 24 4.0 25 4.5 26 4.0 27 6.5 28 10.5 29 16.0 30 17.0 31 18.0 32 23.5 33 34.0 34 45.5 35 57.5 36 79.5 37 102.0 38 113.5 39 146.5 40 183.5 41 214.5 42 247.5 43 257.5 44 265.5 45 280.0 46 281.0 47 260.5 48 241.5 49 222.5 50 188.5 51 154.5 52 128.5 53 99.0 54 77.0 55 61.5 56 44.5 57 30.0 58 20.5 59 17.5 60 10.5 61 8.0 62 6.5 63 2.0 64 3.0 65 3.0 66 1.5 67 1.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79944848332916 99.52499999999999 2 0.1504136375031336 0.3 3 0.0250689395838556 0.075 4 0.0250689395838556 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.575 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.775 0.0 0.0 0.0 0.0 112-113 0.9 0.0 0.0 0.0 0.0 114-115 0.95 0.0 0.0 0.0 0.0 116-117 1.0499999999999998 0.0 0.0 0.0 0.0 118-119 1.15 0.0 0.0 0.0 0.0 120-121 1.3375 0.0 0.0 0.0 0.0 122-123 1.5875 0.0 0.0 0.0 0.0 124-125 1.8125 0.0 0.0 0.0 0.0 126-127 1.9249999999999998 0.0 0.0 0.0 0.0 128-129 2.0625 0.0 0.0 0.0 0.0 130-131 2.375 0.0 0.0 0.0 0.0 132-133 2.5999999999999996 0.0 0.0 0.0 0.0 134-135 2.8499999999999996 0.0 0.0 0.0 0.0 136-137 3.175 0.0 0.0 0.0 0.0 138-139 3.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTCCTC 10 0.006830828 145.0 9 AATACCA 10 0.006830828 145.0 7 >>END_MODULE SRR7171922 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171922_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.075 33.0 33.0 34.0 32.0 34.0 2 33.15325 34.0 33.0 34.0 32.0 34.0 3 33.231 34.0 33.0 34.0 33.0 34.0 4 33.17625 34.0 33.0 34.0 33.0 34.0 5 33.0685 34.0 33.0 34.0 33.0 34.0 6 37.23725 38.0 38.0 38.0 37.0 38.0 7 37.19625 38.0 38.0 38.0 37.0 38.0 8 37.181 38.0 38.0 38.0 37.0 38.0 9 37.23925 38.0 38.0 38.0 37.0 38.0 10-14 37.18285 38.0 38.0 38.0 37.0 38.0 15-19 37.13205000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.16305 38.0 38.0 38.0 36.8 38.0 25-29 37.201750000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.1201 38.0 38.0 38.0 36.8 38.0 35-39 36.94530000000001 38.0 38.0 38.0 36.2 38.0 40-44 36.8466 38.0 38.0 38.0 36.0 38.0 45-49 36.97905 38.0 38.0 38.0 36.0 38.0 50-54 36.9119 38.0 38.0 38.0 36.0 38.0 55-59 36.942899999999995 38.0 38.0 38.0 36.0 38.0 60-64 36.88125 38.0 38.0 38.0 36.0 38.0 65-69 36.81075 38.0 38.0 38.0 36.0 38.0 70-74 36.762350000000005 38.0 38.0 38.0 35.4 38.0 75-79 36.7423 38.0 38.0 38.0 35.6 38.0 80-84 36.640699999999995 38.0 38.0 38.0 34.8 38.0 85-89 36.46645 38.0 38.0 38.0 34.2 38.0 90-94 36.430499999999995 38.0 38.0 38.0 34.0 38.0 95-99 36.3338 38.0 38.0 38.0 34.0 38.0 100-104 36.13165 38.0 37.6 38.0 33.6 38.0 105-109 35.9995 38.0 37.0 38.0 33.2 38.0 110-114 35.95345 38.0 37.2 38.0 33.0 38.0 115-119 35.652750000000005 38.0 36.8 38.0 31.8 38.0 120-124 35.5457 38.0 36.6 38.0 31.0 38.0 125-129 35.19420000000001 38.0 36.0 38.0 28.8 38.0 130-134 34.9591 38.0 35.6 38.0 28.0 38.0 135-139 34.69805 38.0 35.2 38.0 27.4 38.0 140-144 34.21185 38.0 35.0 38.0 24.6 38.0 145-149 33.72205 38.0 34.6 38.0 23.0 38.0 150-151 29.989375000000003 36.5 28.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 2.0 4 0.0 5 2.0 6 1.0 7 2.0 8 2.0 9 2.0 10 2.0 11 2.0 12 3.0 13 2.0 14 1.0 15 5.0 16 2.0 17 3.0 18 4.0 19 3.0 20 6.0 21 4.0 22 7.0 23 14.0 24 12.0 25 13.0 26 12.0 27 12.0 28 23.0 29 33.0 30 32.0 31 59.0 32 70.0 33 79.0 34 155.0 35 314.0 36 713.0 37 2397.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.6 18.5 16.7 25.2 2 24.8 25.2 32.225 17.775 3 21.5 28.4 29.049999999999997 21.05 4 25.3 32.775 23.150000000000002 18.775 5 23.425 37.2 20.925 18.45 6 20.599999999999998 36.125 23.625 19.650000000000002 7 18.3 17.625 41.675000000000004 22.400000000000002 8 19.85 24.425 26.650000000000002 29.075 9 21.85 25.174999999999997 27.55 25.424999999999997 10-14 22.98 28.24 26.82 21.959999999999997 15-19 23.0 28.299999999999997 27.1 21.6 20-24 22.825 28.185 27.575 21.415 25-29 22.705000000000002 28.38 27.065 21.85 30-34 23.48465889183643 28.044446669002454 27.513889584063268 20.957004855097853 35-39 22.658367633771707 28.370645517518323 27.226182110229896 21.744804738480074 40-44 23.031308105934972 28.307955173626816 27.428513995678173 21.23222272476004 45-49 22.61 28.144999999999996 27.68 21.565 50-54 23.064999999999998 28.255000000000003 27.625 21.055 55-59 23.285 28.000000000000004 27.169999999999998 21.545 60-64 23.01 27.47 28.065 21.455 65-69 23.53 28.035 27.325 21.11 70-74 23.52 27.77 27.685 21.025 75-79 23.62 27.735 27.534999999999997 21.11 80-84 23.799999999999997 28.01 27.0 21.19 85-89 23.845 28.000000000000004 27.79 20.365 90-94 23.855 27.51 27.450000000000003 21.185000000000002 95-99 23.405 27.794999999999998 27.38 21.42 100-104 24.215 27.735 27.095000000000002 20.955 105-109 23.94 27.365000000000002 28.325 20.369999999999997 110-114 23.84 27.49 27.72 20.95 115-119 23.775 27.750000000000004 27.455000000000002 21.02 120-124 23.62 27.77 27.825 20.785 125-129 23.815 27.79 27.045 21.349999999999998 130-134 24.01 28.050000000000004 26.99 20.95 135-139 23.855 28.29 27.744999999999997 20.11 140-144 24.375 27.48 27.525 20.62 145-149 23.98 27.800000000000004 27.195000000000004 21.025 150-151 24.2375 27.900000000000002 27.975 19.8875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 0.5 25 0.0 26 3.0 27 4.0 28 4.5 29 7.0 30 8.5 31 11.5 32 18.5 33 25.0 34 36.0 35 51.5 36 69.5 37 92.0 38 117.0 39 157.5 40 200.0 41 221.0 42 238.0 43 262.5 44 294.5 45 313.0 46 284.0 47 260.5 48 243.5 49 213.5 50 195.0 51 161.0 52 118.0 53 92.5 54 79.0 55 61.5 56 40.0 57 27.5 58 19.5 59 16.5 60 14.5 61 9.5 62 7.5 63 6.5 64 4.5 65 2.0 66 1.5 67 0.5 68 1.0 69 1.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.105 35-39 0.38999999999999996 40-44 0.505 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.11249999999999999 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.425 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.525 0.0 0.0 0.0 0.0 106-107 0.6 0.0 0.0 0.0 0.0 108-109 0.7 0.0 0.0 0.0 0.0 110-111 0.8 0.0 0.0 0.0 0.0 112-113 0.9375 0.0 0.0 0.0 0.0 114-115 1.0 0.0 0.0 0.0 0.0 116-117 1.1124999999999998 0.0 0.0 0.0 0.0 118-119 1.25 0.0 0.0 0.0 0.0 120-121 1.4375 0.0 0.0 0.0 0.0 122-123 1.6875 0.0 0.0 0.0 0.0 124-125 1.8875000000000002 0.0 0.0 0.0 0.0 126-127 2.0375 0.0 0.0 0.0 0.0 128-129 2.1875 0.0 0.0 0.0 0.0 130-131 2.4749999999999996 0.0 0.0 0.0 0.0 132-133 2.7125 0.0 0.0 0.0 0.0 134-135 2.9749999999999996 0.0 0.0 0.0 0.0 136-137 3.3125 0.0 0.0 0.0 0.0 138-139 3.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 807982 spots for SRR7171922.sra Written 807982 spots for SRR7171922.sra Read 807982 spots for SRR7171922.sra Written 807982 spots for SRR7171922.sra Read 807982 spots for SRR7171922.sra Written 807982 spots for SRR7171922.sra Read 807982 spots for SRR7171922.sra Written 807982 spots for SRR7171922.sra Read 807982 spots for SRR7171922.sra Written 807982 spots for SRR7171922.sra Read 807982 spots for SRR7171922.sra Written 807982 spots for SRR7171922.sra Read 807982 spots for SRR7171922.sra Written 807982 spots for SRR7171922.sra Read 807982 spots for SRR7171922.sra Written 807982 spots for SRR7171922.sra Read 807982 spots for SRR7171922.sra Written 807982 spots for SRR7171922.sra Read 807982 spots for SRR7171922.sra Written 807982 spots for SRR7171922.sra Read 807982 spots for SRR7171922.sra Written 807982 spots for SRR7171922.sra Read 807982 spots for SRR7171922.sra Written 807982 spots for SRR7171922.sra Read 807982 spots for SRR7171922.sra Written 807982 spots for SRR7171922.sra Read 807982 spots for SRR7171922.sra Written 807982 spots for SRR7171922.sra Read 807982 spots for SRR7171922.sra Written 807982 spots for SRR7171922.sra Read 807982 spots for SRR7171922.sra Written 807982 spots for SRR7171922.sra Read 807982 spots for SRR7171922.sra Written 807982 spots for SRR7171922.sra Read 807982 spots for SRR7171922.sra Written 807982 spots for SRR7171922.sra Read 807982 spots for SRR7171922.sra Written 807982 spots for SRR7171922.sra Read 807987 spots for SRR7171922.sra Written 807987 spots for SRR7171922.sra SRR ids: ['SRR7171922.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4bxzidz6 SRR7171922.sra spots: 16159645 blocks: [[1, 807982], [807983, 1615964], [1615965, 2423946], [2423947, 3231928], [3231929, 4039910], [4039911, 4847892], [4847893, 5655874], [5655875, 6463856], [6463857, 7271838], [7271839, 8079820], [8079821, 8887802], [8887803, 9695784], [9695785, 10503766], [10503767, 11311748], [11311749, 12119730], [12119731, 12927712], [12927713, 13735694], [13735695, 14543676], [14543677, 15351658], [15351659, 16159645]] SRR7171922 file size 5454273 SRR7171922 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171922 SRR7171922_1.fastq SRR7171922_2.fastq Input file: SRR7171922_1.fastq Paired file: SRR7171922_2.fastq trimmed: SRR7171922-trimmed-pair1.fastq, SRR7171922-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 14:06:53 2025 >> started Fri Feb 14 14:07:20 2025 >> done (27.158s) 16159645 read pairs processed; of these: 21003 ( 0.13%) short read pairs filtered out after trimming by size control 16687 ( 0.10%) empty read pairs filtered out after trimming by size control 16121955 (99.77%) read pairs available; of these: 7000710 (43.42%) trimmed read pairs available after processing 9121245 (56.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 6 0.00% 21 2 0.00% 22 6 0.00% 23 2 0.00% 24 8 0.00% 25 7 0.00% 26 4 0.00% 27 6 0.00% 28 6 0.00% 29 3 0.00% 30 5 0.00% 31 8 0.00% 32 7 0.00% 33 6 0.00% 34 10 0.00% 35 7 0.00% 36 5 0.00% 37 11 0.00% 38 4 0.00% 39 7 0.00% 40 13 0.00% 41 14 0.00% 42 9 0.00% 43 12 0.00% 44 9 0.00% 45 9 0.00% 46 18 0.00% 47 19 0.00% 48 14 0.00% 49 18 0.00% 50 32 0.00% 51 31 0.00% 52 38 0.00% 53 46 0.00% 54 44 0.00% 55 42 0.00% 56 55 0.00% 57 60 0.00% 58 69 0.00% 59 62 0.00% 60 80 0.00% 61 96 0.00% 62 94 0.00% 63 110 0.00% 64 122 0.00% 65 132 0.00% 66 143 0.00% 67 189 0.00% 68 185 0.00% 69 230 0.00% 70 254 0.00% 71 299 0.00% 72 353 0.00% 73 389 0.00% 74 438 0.00% 75 467 0.00% 76 676 0.00% 77 684 0.00% 78 638 0.00% 79 769 0.00% 80 897 0.01% 81 1010 0.01% 82 1064 0.01% 83 1364 0.01% 84 2309 0.01% 85 2997 0.02% 86 3133 0.02% 87 3441 0.02% 88 3651 0.02% 89 3656 0.02% 90 3878 0.02% 91 4113 0.03% 92 4310 0.03% 93 4553 0.03% 94 4866 0.03% 95 5080 0.03% 96 5554 0.03% 97 5624 0.03% 98 5845 0.04% 99 6435 0.04% 100 6809 0.04% 101 7249 0.04% 102 7843 0.05% 103 8216 0.05% 104 8919 0.06% 105 9272 0.06% 106 9985 0.06% 107 10539 0.07% 108 10972 0.07% 109 11406 0.07% 110 12101 0.08% 111 12735 0.08% 112 13488 0.08% 113 14419 0.09% 114 14984 0.09% 115 15734 0.10% 116 16476 0.10% 117 17396 0.11% 118 17979 0.11% 119 18676 0.12% 120 19457 0.12% 121 20471 0.13% 122 21676 0.13% 123 22607 0.14% 124 23820 0.15% 125 24995 0.16% 126 26057 0.16% 127 27252 0.17% 128 27989 0.17% 129 29846 0.19% 130 31154 0.19% 131 33206 0.21% 132 35152 0.22% 133 37313 0.23% 134 39824 0.25% 135 42398 0.26% 136 45822 0.28% 137 48902 0.30% 138 52304 0.32% 139 56901 0.35% 140 62412 0.39% 141 69526 0.43% 142 78378 0.49% 143 89729 0.56% 144 107183 0.66% 145 132203 0.82% 146 171392 1.06% 147 242898 1.51% 148 387010 2.40% 149 810196 5.03% 150 3856569 23.92% 151 9121245 56.58% 16121955 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.98 fanout-score-rank=28 prefix-density=0.73 prefix-fanout=2.1 sequence=CATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCA criterion=fanout-score sequence-density=0.10 sequence-density-rank=32 fanout-score=39.68 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=11.3 sequence=CTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTT criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=3.30 fanout-score-rank=21 prefix-density=0.71 prefix-fanout=2.4 sequence=GGTTTCTCAGAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=96.60 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=5.5 sequence=AGAAGGATCTGTTTAATTTGAGACAGAAAACATGAAATCCTCCTACACTTTCTTCATTCTTTTCTCACTCTTTTCGTTTGCTAACGTGATCGGTGCTAGAAAAGACACTGGAGAGTATTGGAGAGCTGTCATGAAAGATCAGCCCATGCCAGAAGCAATACATGGCCTTATTCGCGAAACCACATTGTCATCAGTCTCCAATGAGAAAGCCGATTGCCACACAACCGAGTCCAATGAAAAGAATAATTTTGTCAAGGATTTTG SRR7171922 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 14:08:05 Started mapping on | Feb 14 14:08:05 Finished on | Feb 14 14:10:10 Mapping speed, Million of reads per hour | 464.31 Number of input reads | 16121955 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14966452 Uniquely mapped reads % | 92.83% Average mapped length | 296.40 Number of splices: Total | 15286127 Number of splices: Annotated (sjdb) | 15027485 Number of splices: GT/AG | 15053590 Number of splices: GC/AG | 185126 Number of splices: AT/AC | 11968 Number of splices: Non-canonical | 35443 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 399586 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 26602 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.47% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 776009 776009 776009 N_multimapping 399586 399586 399586 N_noFeature 313799 14806070 396263 N_ambiguous 160354 1012 81817 UnstrandedReadsAssigned:14492299 PositiveStrandReadsAssigned:159370 NegativeStrandReadsAssigned:14488372 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171922 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171922-trimmed-pair1.fastq SRR7171922-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,121,955 reads, 14,326,945 reads pseudoaligned [quant] estimated average fragment length: 266.635 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,094 rounds 52401 SRR7171922.ke.tsv 34699 SRR7171922.se.tsv 87100 total ==> SRR7171922.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1752.37 1028 34.0538 Potri.005G024800.1.v4.1 1035 769.365 237 17.8819 Potri.004G059700.1.v4.1 961 695.396 22 1.83649 Potri.007G009000.2.v4.1 1416 1150.37 0 0 Potri.003G141000.2.v4.1 2943 2677.37 621.181 13.4681 Potri.016G087400.1.v4.1 270 68.307 1244 1057.19 Potri.015G069301.1.v4.1 564 303.64 0 0 Potri.010G195200.1.v4.1 1773 1507.37 237 9.12698 Potri.012G127500.1.v4.1 977 711.376 3913 319.307 ==> SRR7171922.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 48 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 398 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 105 SRR7171922 completed mapping pipeline successfully