Starting /dee2/code/volunteer_pipeline.sh SRR7171923 current disk space = 3112603570176 free memory = 1574308360 SRR7171923 SRAfilesize 7629f50a960ff2c6297fd50959f228b5 SRR7171923.sra SRR7171923.sra file validated SRR7171923 is paired end SRR7171923 is conventional basespace SRR7171923 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171923_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.48475 33.0 33.0 34.0 31.0 34.0 2 32.629 34.0 33.0 34.0 31.0 34.0 3 32.49625 33.0 33.0 34.0 30.0 34.0 4 33.01225 33.0 33.0 34.0 32.0 34.0 5 32.66925 33.0 33.0 34.0 32.0 34.0 6 36.517 38.0 37.0 38.0 34.0 38.0 7 36.6715 38.0 37.0 38.0 34.0 38.0 8 37.0075 38.0 38.0 38.0 35.0 38.0 9 37.276 38.0 38.0 38.0 36.0 38.0 10-14 37.4082 38.0 38.0 38.0 37.0 38.0 15-19 37.4623 38.0 38.0 38.0 37.0 38.0 20-24 37.4053 38.0 38.0 38.0 37.0 38.0 25-29 37.4298 38.0 38.0 38.0 37.0 38.0 30-34 37.40025 38.0 38.0 38.0 37.0 38.0 35-39 37.3845 38.0 38.0 38.0 37.0 38.0 40-44 37.36865 38.0 38.0 38.0 37.0 38.0 45-49 37.3337 38.0 38.0 38.0 37.0 38.0 50-54 37.343 38.0 38.0 38.0 37.0 38.0 55-59 37.20740000000001 38.0 38.0 38.0 36.6 38.0 60-64 37.221050000000005 38.0 38.0 38.0 36.6 38.0 65-69 37.1989 38.0 38.0 38.0 36.2 38.0 70-74 37.13675 38.0 38.0 38.0 36.0 38.0 75-79 37.031150000000004 38.0 38.0 38.0 36.0 38.0 80-84 37.01235 38.0 38.0 38.0 36.0 38.0 85-89 37.02625 38.0 38.0 38.0 36.0 38.0 90-94 36.8642 38.0 38.0 38.0 35.4 38.0 95-99 36.78995 38.0 38.0 38.0 35.0 38.0 100-104 36.771249999999995 38.0 38.0 38.0 35.0 38.0 105-109 36.631299999999996 38.0 38.0 38.0 34.4 38.0 110-114 36.4605 38.0 38.0 38.0 34.0 38.0 115-119 36.44995 38.0 38.0 38.0 34.0 38.0 120-124 36.266850000000005 38.0 38.0 38.0 33.8 38.0 125-129 36.01545 38.0 37.0 38.0 32.4 38.0 130-134 35.8519 38.0 36.4 38.0 32.4 38.0 135-139 35.8335 38.0 36.2 38.0 32.6 38.0 140-144 35.50095 38.0 36.0 38.0 31.0 38.0 145-149 35.1171 38.0 36.0 38.0 31.0 38.0 150-151 32.330625 36.5 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 0.0 18 0.0 19 2.0 20 5.0 21 3.0 22 4.0 23 3.0 24 6.0 25 12.0 26 15.0 27 15.0 28 21.0 29 25.0 30 35.0 31 44.0 32 62.0 33 101.0 34 118.0 35 196.0 36 554.0 37 2776.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.406461698801458 17.561229807191246 10.838978634705576 41.19332985930172 2 17.775 25.5 29.475 27.250000000000004 3 19.7 26.075 26.6 27.625 4 21.825 33.675 23.05 21.45 5 21.45 36.4 21.875 20.275000000000002 6 19.0 36.1 24.575 20.325 7 13.875000000000002 21.65 45.25 19.225 8 17.224999999999998 21.925 30.975 29.875 9 17.65 23.125 32.725 26.5 10-14 19.950000000000003 29.425 26.56 24.065 15-19 19.509999999999998 28.37 28.27 23.849999999999998 20-24 19.715 27.925 27.965 24.395 25-29 19.41 28.575 27.994999999999997 24.02 30-34 19.91 28.89 27.22 23.98 35-39 20.27 28.035 28.005000000000003 23.69 40-44 19.689999999999998 28.815 27.634999999999998 23.86 45-49 19.57 28.185 27.85 24.395 50-54 20.560000000000002 27.339999999999996 28.16 23.94 55-59 19.7 28.34 28.015 23.945 60-64 20.369999999999997 28.044999999999998 27.689999999999998 23.895 65-69 19.62 28.4 27.205000000000002 24.775 70-74 20.169999999999998 28.275 27.41 24.145 75-79 20.51 28.33 27.584999999999997 23.575 80-84 20.455000000000002 27.99 27.215 24.34 85-89 20.515 28.07 27.325 24.09 90-94 20.865000000000002 27.63 27.384999999999998 24.12 95-99 20.415 27.644999999999996 27.939999999999998 24.0 100-104 19.96 28.7 27.58 23.76 105-109 20.93 27.595 27.544999999999998 23.93 110-114 20.32 28.110000000000003 27.685 23.885 115-119 20.31 28.175 28.005000000000003 23.51 120-124 20.805 27.49 27.67 24.035 125-129 20.150000000000002 27.665 28.525 23.66 130-134 21.055 27.83 27.395000000000003 23.72 135-139 20.369999999999997 28.235 27.339999999999996 24.055 140-144 21.11 27.92 27.474999999999998 23.494999999999997 145-149 20.82 28.08 27.265 23.835 150-151 21.325 27.1375 27.762500000000003 23.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 1.0 22 2.0 23 2.5 24 2.5 25 2.0 26 2.5 27 3.5 28 5.0 29 7.0 30 16.0 31 20.5 32 27.5 33 44.0 34 55.0 35 64.5 36 87.0 37 116.0 38 132.0 39 150.5 40 188.0 41 221.5 42 239.0 43 260.0 44 274.0 45 287.5 46 299.5 47 261.5 48 218.0 49 188.0 50 159.0 51 145.0 52 121.5 53 92.5 54 68.0 55 51.5 56 36.0 57 26.5 58 26.5 59 21.0 60 16.0 61 16.5 62 11.5 63 9.0 64 8.0 65 4.0 66 1.5 67 0.5 68 1.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.025 0.0 0.0 0.0 82-83 0.0 0.025 0.0 0.0 0.0 84-85 0.0 0.025 0.0 0.0 0.0 86-87 0.0 0.025 0.0 0.0 0.0 88-89 0.0 0.025 0.0 0.0 0.0 90-91 0.0 0.025 0.0 0.0 0.0 92-93 0.025 0.025 0.0 0.0 0.0 94-95 0.025 0.025 0.0 0.0 0.0 96-97 0.075 0.025 0.0 0.0 0.0 98-99 0.075 0.025 0.0 0.0 0.0 100-101 0.1125 0.025 0.0 0.0 0.0 102-103 0.16249999999999998 0.025 0.0 0.0 0.0 104-105 0.1875 0.025 0.0 0.0 0.0 106-107 0.225 0.025 0.0 0.0 0.0 108-109 0.25 0.025 0.0 0.0 0.0 110-111 0.30000000000000004 0.025 0.0 0.0 0.0 112-113 0.35 0.025 0.0 0.0 0.0 114-115 0.4375 0.025 0.0 0.0 0.0 116-117 0.55 0.025 0.0 0.0 0.0 118-119 0.725 0.025 0.0 0.0 0.0 120-121 0.75 0.025 0.0 0.0 0.0 122-123 0.925 0.025 0.0 0.0 0.0 124-125 1.025 0.025 0.0 0.0 0.0 126-127 1.1749999999999998 0.025 0.0 0.0 0.0 128-129 1.2999999999999998 0.025 0.0 0.0 0.0 130-131 1.475 0.025 0.0 0.0 0.0 132-133 1.6 0.025 0.0 0.0 0.0 134-135 1.7625000000000002 0.025 0.0 0.0 0.0 136-137 1.975 0.025 0.0 0.0 0.0 138-139 2.1875 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171923 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171923_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7125 33.0 33.0 34.0 32.0 34.0 2 32.78875 34.0 33.0 34.0 32.0 34.0 3 32.81775 34.0 33.0 34.0 32.0 34.0 4 32.727 34.0 33.0 34.0 32.0 34.0 5 32.733 34.0 33.0 34.0 32.0 34.0 6 36.83825 38.0 38.0 38.0 36.0 38.0 7 36.7795 38.0 38.0 38.0 36.0 38.0 8 36.731 38.0 38.0 38.0 36.0 38.0 9 36.90375 38.0 38.0 38.0 37.0 38.0 10-14 36.8012 38.0 38.0 38.0 36.0 38.0 15-19 36.70225000000001 38.0 38.0 38.0 36.0 38.0 20-24 36.63155 38.0 38.0 38.0 36.0 38.0 25-29 36.5805 38.0 38.0 38.0 36.0 38.0 30-34 36.5927 38.0 38.0 38.0 35.8 38.0 35-39 36.5028 38.0 38.0 38.0 35.4 38.0 40-44 36.506949999999996 38.0 38.0 38.0 35.6 38.0 45-49 36.63055000000001 38.0 38.0 38.0 35.8 38.0 50-54 36.52374999999999 38.0 38.0 38.0 35.4 38.0 55-59 36.489 38.0 38.0 38.0 35.0 38.0 60-64 36.48515000000001 38.0 38.0 38.0 35.0 38.0 65-69 36.374649999999995 38.0 38.0 38.0 34.4 38.0 70-74 36.35765 38.0 38.0 38.0 34.4 38.0 75-79 36.238150000000005 38.0 38.0 38.0 34.0 38.0 80-84 36.22795000000001 38.0 38.0 38.0 34.2 38.0 85-89 36.09565 38.0 38.0 38.0 33.8 38.0 90-94 35.9225 38.0 38.0 38.0 33.4 38.0 95-99 35.958600000000004 38.0 38.0 38.0 33.4 38.0 100-104 35.69945 38.0 37.2 38.0 31.8 38.0 105-109 35.64135 38.0 37.0 38.0 31.6 38.0 110-114 35.60025 38.0 37.0 38.0 31.4 38.0 115-119 35.3891 38.0 37.0 38.0 30.8 38.0 120-124 35.23375 38.0 36.4 38.0 29.4 38.0 125-129 35.0474 38.0 36.0 38.0 29.0 38.0 130-134 34.71475 38.0 35.8 38.0 27.2 38.0 135-139 34.42485 38.0 35.2 38.0 25.4 38.0 140-144 33.9867 38.0 35.0 38.0 22.2 38.0 145-149 33.481449999999995 38.0 35.0 38.0 18.8 38.0 150-151 30.004375000000003 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 10.0 4 3.0 5 5.0 6 4.0 7 2.0 8 1.0 9 4.0 10 1.0 11 5.0 12 1.0 13 2.0 14 5.0 15 4.0 16 3.0 17 7.0 18 5.0 19 4.0 20 11.0 21 2.0 22 7.0 23 8.0 24 12.0 25 20.0 26 30.0 27 34.0 28 30.0 29 37.0 30 42.0 31 53.0 32 66.0 33 101.0 34 147.0 35 250.0 36 559.0 37 2506.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.19774718397998 17.672090112640802 17.647058823529413 26.48310387984981 2 25.812906453226613 23.936968484242122 32.61630815407704 17.63381690845423 3 21.875 26.775 30.0 21.349999999999998 4 24.349999999999998 33.525 22.8 19.325 5 23.674999999999997 36.15 21.675 18.5 6 18.675 36.575 24.25 20.5 7 18.7 18.375 40.849999999999994 22.075 8 21.25 24.15 26.575 28.025 9 22.025 25.35 27.975 24.65 10-14 22.955000000000002 27.985 27.08 21.98 15-19 22.2655663915979 28.322080520130033 27.9869967491873 21.42535633908477 20-24 22.692442530174787 28.772474583062053 27.139780638052784 21.395302248710372 25-29 23.23075380914194 28.583600641539697 27.21531676022454 20.970328789093827 30-34 23.03951062976334 27.94324107501003 27.702567188126753 21.31468110709988 35-39 22.802969502407706 28.270465489566615 27.668539325842694 21.258025682182986 40-44 22.99323138631236 27.73627475557784 27.87666081724743 21.393833040862372 45-49 22.912912912912915 28.233233233233236 27.45245245245245 21.4014014014014 50-54 23.30349552432865 27.594139120868128 28.149222383357504 20.95314297144572 55-59 23.504700940188037 27.355471094218842 28.190638127625522 20.949189837967594 60-64 23.251162558127906 28.081404070203508 27.91639581979099 20.751037551877594 65-69 23.765 27.905 27.29 21.04 70-74 23.82 28.355000000000004 27.08 20.745 75-79 23.39 27.595 27.985 21.029999999999998 80-84 24.12 27.395000000000003 27.315 21.17 85-89 24.15 27.675 27.275 20.9 90-94 23.775 28.599999999999998 27.310000000000002 20.315 95-99 24.36 27.215 28.000000000000004 20.424999999999997 100-104 24.275 28.449999999999996 26.995 20.28 105-109 24.075 27.860000000000003 27.49 20.575 110-114 24.025 27.939999999999998 27.205000000000002 20.830000000000002 115-119 24.044999999999998 28.215 27.0 20.74 120-124 24.065 27.534999999999997 28.08 20.32 125-129 23.630000000000003 28.13 27.13 21.11 130-134 23.65 27.46 28.345 20.544999999999998 135-139 24.04 27.694999999999997 28.345 19.919999999999998 140-144 24.42 27.950000000000003 27.655 19.975 145-149 24.605 28.235 27.560000000000002 19.6 150-151 24.4125 28.575 27.1625 19.85 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 2.0 20 2.5 21 1.0 22 1.0 23 0.5 24 0.5 25 3.0 26 5.0 27 4.5 28 5.0 29 7.0 30 11.0 31 16.0 32 14.0 33 23.5 34 38.0 35 50.0 36 73.5 37 95.0 38 126.5 39 172.5 40 192.5 41 217.5 42 272.5 43 290.0 44 269.0 45 260.0 46 253.5 47 249.5 48 243.5 49 218.0 50 193.0 51 158.0 52 127.0 53 97.0 54 68.5 55 55.5 56 39.5 57 35.5 58 29.5 59 17.5 60 17.0 61 14.5 62 8.5 63 5.5 64 2.5 65 1.0 66 1.5 67 1.5 68 1.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.025 20-24 0.165 25-29 0.24 30-34 0.27999999999999997 35-39 0.32 40-44 0.27499999999999997 45-49 0.1 50-54 0.015 55-59 0.02 60-64 0.005 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.32499999999999996 0.0 0.0 0.0 0.0 112-113 0.38749999999999996 0.0 0.0 0.0 0.0 114-115 0.48750000000000004 0.0 0.0 0.0 0.0 116-117 0.6 0.0 0.0 0.0 0.0 118-119 0.775 0.0 0.0 0.0 0.0 120-121 0.8 0.0 0.0 0.0 0.0 122-123 1.0 0.0 0.0 0.0 0.0 124-125 1.1 0.0 0.0 0.0 0.0 126-127 1.25 0.0 0.0 0.0 0.0 128-129 1.375 0.0 0.0 0.0 0.0 130-131 1.5499999999999998 0.0 0.0 0.0 0.0 132-133 1.6875 0.0 0.0 0.0 0.0 134-135 1.8375 0.0 0.0 0.0 0.0 136-137 2.0374999999999996 0.0 0.0 0.0 0.0 138-139 2.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATACT 10 0.006843168 144.91249 4 >>END_MODULE Read 815662 spots for SRR7171923.sra Written 815662 spots for SRR7171923.sra Read 815662 spots for SRR7171923.sra Written 815662 spots for SRR7171923.sra Read 815662 spots for SRR7171923.sra Written 815662 spots for SRR7171923.sra Read 815662 spots for SRR7171923.sra Written 815662 spots for SRR7171923.sra Read 815662 spots for SRR7171923.sra Written 815662 spots for SRR7171923.sra Read 815662 spots for SRR7171923.sra Written 815662 spots for SRR7171923.sra Read 815662 spots for SRR7171923.sra Written 815662 spots for SRR7171923.sra Read 815662 spots for SRR7171923.sra Written 815662 spots for SRR7171923.sra Read 815662 spots for SRR7171923.sra Written 815662 spots for SRR7171923.sra Read 815662 spots for SRR7171923.sra Written 815662 spots for SRR7171923.sra Read 815662 spots for SRR7171923.sra Written 815662 spots for SRR7171923.sra Read 815662 spots for SRR7171923.sra Written 815662 spots for SRR7171923.sra Read 815662 spots for SRR7171923.sra Written 815662 spots for SRR7171923.sra Read 815662 spots for SRR7171923.sra Written 815662 spots for SRR7171923.sra Read 815680 spots for SRR7171923.sra Written 815680 spots for SRR7171923.sra Read 815662 spots for SRR7171923.sra Written 815662 spots for SRR7171923.sra Read 815662 spots for SRR7171923.sra Written 815662 spots for SRR7171923.sra Read 815662 spots for SRR7171923.sra Written 815662 spots for SRR7171923.sra Read 815662 spots for SRR7171923.sra Written 815662 spots for SRR7171923.sra Read 815662 spots for SRR7171923.sra Written 815662 spots for SRR7171923.sra SRR ids: ['SRR7171923.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_v3ovm_l3 SRR7171923.sra spots: 16313258 blocks: [[1, 815662], [815663, 1631324], [1631325, 2446986], [2446987, 3262648], [3262649, 4078310], [4078311, 4893972], [4893973, 5709634], [5709635, 6525296], [6525297, 7340958], [7340959, 8156620], [8156621, 8972282], [8972283, 9787944], [9787945, 10603606], [10603607, 11419268], [11419269, 12234930], [12234931, 13050592], [13050593, 13866254], [13866255, 14681916], [14681917, 15497578], [15497579, 16313258]] SRR7171923 file size 5506327 SRR7171923 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171923 SRR7171923_1.fastq SRR7171923_2.fastq Input file: SRR7171923_1.fastq Paired file: SRR7171923_2.fastq trimmed: SRR7171923-trimmed-pair1.fastq, SRR7171923-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 15:49:40 2025 >> started Fri Feb 14 15:49:58 2025 >> done (18.424s) 16313258 read pairs processed; of these: 39363 ( 0.24%) short read pairs filtered out after trimming by size control 29222 ( 0.18%) empty read pairs filtered out after trimming by size control 16244673 (99.58%) read pairs available; of these: 5518983 (33.97%) trimmed read pairs available after processing 10725690 (66.03%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 2 0.00% 21 6 0.00% 22 3 0.00% 23 2 0.00% 24 3 0.00% 25 4 0.00% 26 7 0.00% 27 6 0.00% 28 6 0.00% 29 6 0.00% 30 2 0.00% 31 6 0.00% 32 5 0.00% 33 9 0.00% 34 8 0.00% 35 8 0.00% 36 7 0.00% 37 10 0.00% 38 14 0.00% 39 10 0.00% 40 10 0.00% 41 11 0.00% 42 13 0.00% 43 38 0.00% 44 24 0.00% 45 26 0.00% 46 27 0.00% 47 79 0.00% 48 123 0.00% 49 34 0.00% 50 31 0.00% 51 37 0.00% 52 127 0.00% 53 111 0.00% 54 110 0.00% 55 43 0.00% 56 69 0.00% 57 89 0.00% 58 115 0.00% 59 63 0.00% 60 64 0.00% 61 85 0.00% 62 83 0.00% 63 87 0.00% 64 90 0.00% 65 116 0.00% 66 116 0.00% 67 120 0.00% 68 145 0.00% 69 157 0.00% 70 186 0.00% 71 213 0.00% 72 231 0.00% 73 245 0.00% 74 352 0.00% 75 386 0.00% 76 560 0.00% 77 571 0.00% 78 533 0.00% 79 618 0.00% 80 605 0.00% 81 731 0.00% 82 898 0.01% 83 1003 0.01% 84 2663 0.02% 85 3925 0.02% 86 4044 0.02% 87 4218 0.03% 88 4134 0.03% 89 4158 0.03% 90 4166 0.03% 91 4280 0.03% 92 4373 0.03% 93 4489 0.03% 94 4668 0.03% 95 4848 0.03% 96 4980 0.03% 97 5114 0.03% 98 5304 0.03% 99 5682 0.03% 100 5968 0.04% 101 6443 0.04% 102 6688 0.04% 103 7214 0.04% 104 7594 0.05% 105 8062 0.05% 106 8344 0.05% 107 8816 0.05% 108 9577 0.06% 109 9995 0.06% 110 10645 0.07% 111 11339 0.07% 112 11649 0.07% 113 12428 0.08% 114 13051 0.08% 115 13892 0.09% 116 14592 0.09% 117 15426 0.09% 118 15801 0.10% 119 17031 0.10% 120 18549 0.11% 121 18526 0.11% 122 19072 0.12% 123 20251 0.12% 124 20940 0.13% 125 21887 0.13% 126 22782 0.14% 127 24328 0.15% 128 24758 0.15% 129 26333 0.16% 130 28141 0.17% 131 29305 0.18% 132 30962 0.19% 133 33391 0.21% 134 35598 0.22% 135 37324 0.23% 136 40021 0.25% 137 42955 0.26% 138 46331 0.29% 139 49498 0.30% 140 53497 0.33% 141 58851 0.36% 142 65334 0.40% 143 73648 0.45% 144 85928 0.53% 145 101567 0.63% 146 125668 0.77% 147 169962 1.05% 148 258022 1.59% 149 521766 3.21% 150 3118683 19.20% 151 10725690 66.03% 16244673 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=5.46 fanout-score-rank=12 prefix-density=0.82 prefix-fanout=3.1 sequence=TTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=44.47 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=6.5 sequence=AACTCCAGCAGGTTGATAGAAAGTACTTTACAGGGCGAGCACAGTTCATGGTCTTCACTCTTCAAGGTAAAGTATAAGCTCCACACTTGTAGCCCACAGGACGATCAGCAATGTTGCATCGTTTGGGAATGGTCATTGCAATTTCTGGCTTGATTCCAGAGCTCTTAGCAGTGTTGGAAAGCATAACAGCACAAAGGCACGCTGGGTTCTGTCCAATTTTCTTCACCCGAGCGCAGCACTGGCTCGAAACTGAAGAATTCTCATCCTGTGCTGCTGATGCACAAGGAGCCATCTTGAAAGCCTCCATGTCAGGAGTGGTGTTTTTCCCACATTCACCAGCCCCGTCAACTTGATTGA criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=3.23 fanout-score-rank=32 prefix-density=0.59 prefix-fanout=2.8 sequence=TGCAAGTGCGGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=223.34 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=10.2 sequence=AAAAATGGCGACTCCAATGAAGTACATTTGCTTGTTTATGTTTCTTGCAATTCTCAGCATTGCTGGGCTCAATCAAGTTGACGGGGCTGGTGAATGTGGGAAAAACACCACTCCTGACATGGAGGCTTTCAAGATGGCTCCTTGTGCATCAGCAGCACAGGATGAGAATTCTTCAGTTTCGAGCCAGTGCTGCGCTCGGGTGAAGAAAATTGGACAGAACCCAGCGTGCCTTTGTGCTGTTATGCTTTCCAACACTGCTAAGAGCTCTGGAATCAAGCCAGAAATTGCAATGACCATTCCCAAACGATGCAACATTGCTGATCGTCCTGTGGGCTACAAGTGTGGAG SRR7171923 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 15:51:13 Started mapping on | Feb 14 15:51:13 Finished on | Feb 14 15:54:48 Mapping speed, Million of reads per hour | 272.00 Number of input reads | 16244673 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14486803 Uniquely mapped reads % | 89.18% Average mapped length | 297.15 Number of splices: Total | 14547586 Number of splices: Annotated (sjdb) | 14274097 Number of splices: GT/AG | 14313506 Number of splices: GC/AG | 186866 Number of splices: AT/AC | 11966 Number of splices: Non-canonical | 35248 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 365990 % of reads mapped to multiple loci | 2.25% Number of reads mapped to too many loci | 32912 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.30% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1425119 1425119 1425119 N_multimapping 365990 365990 365990 N_noFeature 362465 14349179 427856 N_ambiguous 163382 910 90503 UnstrandedReadsAssigned:13960956 PositiveStrandReadsAssigned:136714 NegativeStrandReadsAssigned:13968444 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171923 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171923-trimmed-pair1.fastq SRR7171923-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,244,673 reads, 13,875,538 reads pseudoaligned [quant] estimated average fragment length: 263.465 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,100 rounds 52401 SRR7171923.ke.tsv 34699 SRR7171923.se.tsv 87100 total ==> SRR7171923.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1755.54 1272 49.121 Potri.005G024800.1.v4.1 1035 772.535 182 15.9714 Potri.004G059700.1.v4.1 961 698.591 25 2.42609 Potri.007G009000.2.v4.1 1416 1153.54 0 0 Potri.003G141000.2.v4.1 2943 2680.54 504 12.7467 Potri.016G087400.1.v4.1 270 66.8341 881 893.65 Potri.015G069301.1.v4.1 564 306.399 0 0 Potri.010G195200.1.v4.1 1773 1510.54 385 17.279 Potri.012G127500.1.v4.1 977 714.552 13809 1310.14 ==> SRR7171923.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 26 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 306 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 629 SRR7171923 completed mapping pipeline successfully