Starting /dee2/code/volunteer_pipeline.sh SRR7171924 current disk space = 3112596271104 free memory = 1456532876 SRR7171924 SRAfilesize 4f2040ea562d2c4c4032119fae503ac8 SRR7171924.sra SRR7171924.sra file validated SRR7171924 is paired end SRR7171924 is conventional basespace SRR7171924 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171924_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.82975 32.0 18.0 33.0 18.0 33.0 2 31.94275 33.0 32.0 33.0 27.0 34.0 3 31.22425 33.0 31.0 33.0 28.0 33.0 4 31.9555 33.0 31.0 33.0 29.0 33.0 5 32.191 33.0 32.0 33.0 31.0 33.0 6 36.00025 37.0 36.0 38.0 33.0 38.0 7 36.87225 38.0 37.0 38.0 35.0 38.0 8 37.3145 38.0 38.0 38.0 36.0 38.0 9 37.466 38.0 38.0 38.0 37.0 38.0 10-14 37.55865 38.0 38.0 38.0 37.4 38.0 15-19 37.509100000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.536699999999996 38.0 38.0 38.0 37.6 38.0 25-29 37.51819999999999 38.0 38.0 38.0 37.8 38.0 30-34 37.53099999999999 38.0 38.0 38.0 37.6 38.0 35-39 37.4545 38.0 38.0 38.0 37.2 38.0 40-44 37.45 38.0 38.0 38.0 37.0 38.0 45-49 37.424699999999994 38.0 38.0 38.0 37.0 38.0 50-54 37.39335 38.0 38.0 38.0 37.0 38.0 55-59 37.310050000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.25655 38.0 38.0 38.0 36.4 38.0 65-69 37.1871 38.0 38.0 38.0 36.0 38.0 70-74 37.145300000000006 38.0 38.0 38.0 36.0 38.0 75-79 37.075149999999994 38.0 38.0 38.0 36.0 38.0 80-84 37.04684999999999 38.0 38.0 38.0 36.0 38.0 85-89 36.9011 38.0 38.0 38.0 35.4 38.0 90-94 36.83955 38.0 38.0 38.0 35.0 38.0 95-99 36.73004999999999 38.0 38.0 38.0 34.8 38.0 100-104 36.68920000000001 38.0 38.0 38.0 34.6 38.0 105-109 36.41835 38.0 38.0 38.0 34.0 38.0 110-114 36.293 38.0 37.4 38.0 33.6 38.0 115-119 36.14874999999999 38.0 37.0 38.0 33.2 38.0 120-124 35.9972 38.0 37.0 38.0 32.8 38.0 125-129 35.84955 38.0 37.0 38.0 32.4 38.0 130-134 35.58185 38.0 36.2 38.0 31.4 38.0 135-139 35.29774999999999 38.0 36.0 38.0 30.0 38.0 140-144 35.02305 38.0 35.2 38.0 28.8 38.0 145-149 34.539249999999996 38.0 35.0 38.0 28.0 38.0 150-151 31.313874999999996 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 1.0 16 0.0 17 2.0 18 2.0 19 2.0 20 2.0 21 0.0 22 2.0 23 6.0 24 2.0 25 11.0 26 15.0 27 19.0 28 19.0 29 23.0 30 39.0 31 42.0 32 73.0 33 87.0 34 143.0 35 258.0 36 741.0 37 2509.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.65 13.125 10.975 33.25 2 19.264448336252187 19.93995496622467 39.9549662246685 20.84063047285464 3 19.85 27.0 26.400000000000002 26.75 4 23.474999999999998 34.599999999999994 20.525 21.4 5 21.125 36.95 22.2 19.725 6 16.725 37.05 26.325 19.900000000000002 7 13.375 22.05 44.9 19.675 8 18.224999999999998 20.7 31.825 29.25 9 18.275 23.400000000000002 31.424999999999997 26.900000000000002 10-14 20.0 29.26 26.995 23.745 15-19 20.435 28.194999999999997 27.99 23.380000000000003 20-24 20.064999999999998 28.425 27.935 23.575 25-29 20.125 28.68 27.205000000000002 23.990000000000002 30-34 20.385 28.455000000000002 28.165000000000003 22.994999999999997 35-39 19.845 28.395 27.79 23.97 40-44 20.169999999999998 28.27 27.775 23.785 45-49 20.52 28.139999999999997 28.105000000000004 23.235 50-54 19.785 27.98 28.105000000000004 24.13 55-59 20.595 28.349999999999998 27.439999999999998 23.615 60-64 20.66 27.939999999999998 27.465 23.935000000000002 65-69 20.555 28.084999999999997 27.994999999999997 23.365 70-74 20.424999999999997 27.689999999999998 28.65 23.235 75-79 20.515 28.575 28.139999999999997 22.770000000000003 80-84 20.064999999999998 28.355000000000004 28.134999999999998 23.445 85-89 21.355 28.015 27.450000000000003 23.18 90-94 20.79 27.839999999999996 28.294999999999998 23.075000000000003 95-99 20.885 27.98 28.065 23.07 100-104 20.65 28.68 27.705000000000002 22.965 105-109 20.51 28.349999999999998 27.439999999999998 23.7 110-114 21.085 27.915 27.525 23.474999999999998 115-119 21.4 27.405 27.51 23.685000000000002 120-124 21.0 27.62 27.605 23.775 125-129 20.599999999999998 27.939999999999998 28.03 23.43 130-134 21.195 27.71 27.46 23.635 135-139 21.115000000000002 27.77 27.400000000000002 23.715 140-144 21.185000000000002 27.915 27.165 23.735 145-149 20.78 27.99 27.560000000000002 23.669999999999998 150-151 21.9375 27.8125 26.787499999999998 23.4625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 1.5 22 1.5 23 1.0 24 1.5 25 2.5 26 3.5 27 6.5 28 9.5 29 12.5 30 13.5 31 19.0 32 32.5 33 42.5 34 55.5 35 61.5 36 79.0 37 111.5 38 136.5 39 164.0 40 195.0 41 226.5 42 259.5 43 286.5 44 292.5 45 278.5 46 268.5 47 249.5 48 210.5 49 196.0 50 179.0 51 138.5 52 109.0 53 86.5 54 70.5 55 49.0 56 28.0 57 27.5 58 24.0 59 16.0 60 13.0 61 11.5 62 8.5 63 6.0 64 5.0 65 4.0 66 2.0 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.23750000000000002 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.7124999999999999 0.0 0.0 0.0 0.0 108-109 0.7625 0.0 0.0 0.0 0.0 110-111 0.8625 0.0 0.0 0.0 0.0 112-113 1.1 0.0 0.0 0.0 0.0 114-115 1.2875 0.0 0.0 0.0 0.0 116-117 1.3875000000000002 0.0 0.0 0.0 0.0 118-119 1.6125 0.0 0.0 0.0 0.0 120-121 1.7999999999999998 0.0 0.0 0.0 0.0 122-123 1.9625 0.0 0.0 0.0 0.0 124-125 2.0999999999999996 0.0 0.0 0.0 0.0 126-127 2.3625 0.0 0.0 0.0 0.0 128-129 2.6875 0.0 0.0 0.0 0.0 130-131 3.0125 0.0 0.0 0.0 0.0 132-133 3.3625 0.0 0.0 0.0 0.0 134-135 3.5875 0.0 0.0 0.0 0.0 136-137 3.875 0.0 0.0 0.0 0.0 138-139 4.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTAAAA 10 0.0068343505 144.975 7 GATTAAA 10 0.0068343505 144.975 5 AAGAGCA 30 0.0017985795 72.487495 145 >>END_MODULE SRR7171924 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171924_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0535 33.0 33.0 34.0 32.0 34.0 2 33.08875 34.0 33.0 34.0 33.0 34.0 3 33.14975 34.0 33.0 34.0 33.0 34.0 4 33.15275 34.0 33.0 34.0 33.0 34.0 5 33.1795 34.0 33.0 34.0 33.0 34.0 6 37.36975 38.0 38.0 38.0 37.0 38.0 7 37.347 38.0 38.0 38.0 37.0 38.0 8 37.341 38.0 38.0 38.0 37.0 38.0 9 37.2505 38.0 38.0 38.0 37.0 38.0 10-14 37.32195 38.0 38.0 38.0 37.0 38.0 15-19 37.30805 38.0 38.0 38.0 37.0 38.0 20-24 37.31 38.0 38.0 38.0 37.0 38.0 25-29 37.301300000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.269850000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.19525 38.0 38.0 38.0 37.0 38.0 40-44 36.977000000000004 38.0 38.0 38.0 36.2 38.0 45-49 37.22755 38.0 38.0 38.0 37.0 38.0 50-54 37.1832 38.0 38.0 38.0 36.8 38.0 55-59 37.09735 38.0 38.0 38.0 36.2 38.0 60-64 36.993199999999995 38.0 38.0 38.0 36.0 38.0 65-69 36.94885000000001 38.0 38.0 38.0 36.0 38.0 70-74 36.9159 38.0 38.0 38.0 36.0 38.0 75-79 36.869749999999996 38.0 38.0 38.0 36.0 38.0 80-84 36.79599999999999 38.0 38.0 38.0 35.4 38.0 85-89 36.67925 38.0 38.0 38.0 34.8 38.0 90-94 36.53735 38.0 38.0 38.0 34.4 38.0 95-99 36.5111 38.0 38.0 38.0 34.0 38.0 100-104 36.31165 38.0 38.0 38.0 34.0 38.0 105-109 36.1351 38.0 37.4 38.0 33.4 38.0 110-114 36.03515 38.0 37.2 38.0 33.2 38.0 115-119 35.88380000000001 38.0 37.0 38.0 32.6 38.0 120-124 35.74785 38.0 36.8 38.0 31.6 38.0 125-129 35.45415 38.0 36.2 38.0 31.0 38.0 130-134 35.08935 38.0 35.8 38.0 28.0 38.0 135-139 34.751 38.0 35.0 38.0 27.8 38.0 140-144 34.428 38.0 35.0 38.0 25.6 38.0 145-149 33.8892 38.0 35.0 38.0 22.2 38.0 150-151 30.020500000000002 36.5 27.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 2.0 4 0.0 5 3.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 1.0 14 1.0 15 4.0 16 3.0 17 3.0 18 2.0 19 1.0 20 5.0 21 4.0 22 10.0 23 8.0 24 9.0 25 14.0 26 7.0 27 21.0 28 19.0 29 24.0 30 42.0 31 55.0 32 79.0 33 106.0 34 161.0 35 265.0 36 614.0 37 2530.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.875 15.5 15.7 27.925 2 22.375 24.05 35.199999999999996 18.375 3 20.05 28.15 30.825000000000003 20.974999999999998 4 24.95 33.7 21.85 19.5 5 23.474999999999998 37.65 21.05 17.825 6 18.0 37.85 23.925 20.225 7 18.4 17.549999999999997 43.0 21.05 8 19.425 23.75 26.825 30.0 9 22.325 24.325 27.825 25.525 10-14 23.22 28.98 26.61 21.19 15-19 23.145 28.715000000000003 27.42 20.72 20-24 23.615 28.575 27.339999999999996 20.47 25-29 22.945 28.285 27.675 21.095 30-34 22.735 27.93 28.34 20.995 35-39 22.98068261435292 28.46061455309779 27.29456510859774 21.264137723951556 40-44 22.664724789071915 28.234230614704703 27.73202089192447 21.369023704298915 45-49 23.345 28.249999999999996 27.775 20.630000000000003 50-54 22.95 28.54 27.500000000000004 21.01 55-59 23.06 28.084999999999997 27.74 21.115000000000002 60-64 22.91 28.349999999999998 27.575 21.165 65-69 23.805 28.37 26.805 21.02 70-74 23.415 28.38 27.35 20.855 75-79 22.615 28.199999999999996 27.79 21.395 80-84 23.125 28.17 27.52 21.185000000000002 85-89 23.425 28.18 27.38 21.015 90-94 22.925 28.165000000000003 27.994999999999997 20.915 95-99 24.224999999999998 27.810000000000002 27.625 20.34 100-104 23.419999999999998 27.950000000000003 27.725 20.905 105-109 23.71 27.975 27.24 21.075 110-114 23.835 28.275 27.200000000000003 20.69 115-119 23.54 27.58 27.91 20.97 120-124 23.880000000000003 28.165000000000003 27.029999999999998 20.925 125-129 23.91 28.139999999999997 27.3 20.65 130-134 24.279999999999998 27.950000000000003 27.26 20.51 135-139 24.34 28.03 27.715 19.915 140-144 24.29 28.799999999999997 26.505000000000003 20.405 145-149 24.875 28.18 26.93 20.015 150-151 23.75 28.175 27.500000000000004 20.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 2.0 26 1.5 27 2.0 28 4.0 29 7.0 30 11.0 31 15.5 32 19.0 33 19.5 34 31.5 35 54.0 36 81.0 37 109.5 38 137.0 39 169.0 40 205.0 41 246.0 42 253.5 43 279.0 44 305.0 45 293.0 46 276.5 47 264.0 48 239.5 49 203.0 50 186.0 51 157.0 52 117.5 53 78.5 54 52.5 55 43.0 56 35.5 57 26.0 58 19.0 59 17.5 60 11.0 61 6.5 62 6.0 63 3.0 64 4.0 65 2.5 66 1.0 67 0.5 68 1.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.09 40-44 0.44 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.23750000000000002 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.7124999999999999 0.0 0.0 0.0 0.0 108-109 0.7625 0.0 0.0 0.0 0.0 110-111 0.8625 0.0 0.0 0.0 0.0 112-113 1.1 0.0 0.0 0.0 0.0 114-115 1.2875 0.0 0.0 0.0 0.0 116-117 1.3624999999999998 0.0 0.0 0.0 0.0 118-119 1.5875 0.0 0.0 0.0 0.0 120-121 1.75 0.0 0.0 0.0 0.0 122-123 1.9125 0.0 0.0 0.0 0.0 124-125 2.05 0.0 0.0 0.0 0.0 126-127 2.3125 0.0 0.0 0.0 0.0 128-129 2.6500000000000004 0.0 0.0 0.0 0.0 130-131 2.9875 0.0 0.0 0.0 0.0 132-133 3.3375000000000004 0.0 0.0 0.0 0.0 134-135 3.625 0.0 0.0 0.0 0.0 136-137 3.95 0.0 0.0 0.0 0.0 138-139 4.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 764378 spots for SRR7171924.sra Written 764378 spots for SRR7171924.sra Read 764378 spots for SRR7171924.sra Written 764378 spots for SRR7171924.sra Read 764378 spots for SRR7171924.sra Written 764378 spots for SRR7171924.sra Read 764378 spots for SRR7171924.sra Written 764378 spots for SRR7171924.sra Read 764378 spots for SRR7171924.sra Written 764378 spots for SRR7171924.sra Read 764378 spots for SRR7171924.sra Written 764378 spots for SRR7171924.sra Read 764378 spots for SRR7171924.sra Written 764378 spots for SRR7171924.sra Read 764378 spots for SRR7171924.sra Written 764378 spots for SRR7171924.sra Read 764378 spots for SRR7171924.sra Written 764378 spots for SRR7171924.sra Read 764378 spots for SRR7171924.sra Written 764378 spots for SRR7171924.sra Read 764378 spots for SRR7171924.sra Written 764378 spots for SRR7171924.sra Read 764378 spots for SRR7171924.sra Written 764378 spots for SRR7171924.sra Read 764378 spots for SRR7171924.sra Written 764378 spots for SRR7171924.sra Read 764378 spots for SRR7171924.sra Written 764378 spots for SRR7171924.sra Read 764378 spots for SRR7171924.sra Written 764378 spots for SRR7171924.sra Read 764397 spots for SRR7171924.sra Written 764397 spots for SRR7171924.sra Read 764378 spots for SRR7171924.sra Written 764378 spots for SRR7171924.sra Read 764378 spots for SRR7171924.sra Written 764378 spots for SRR7171924.sra Read 764378 spots for SRR7171924.sra Written 764378 spots for SRR7171924.sra Read 764378 spots for SRR7171924.sra Written 764378 spots for SRR7171924.sra SRR ids: ['SRR7171924.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jux3edha SRR7171924.sra spots: 15287579 blocks: [[1, 764378], [764379, 1528756], [1528757, 2293134], [2293135, 3057512], [3057513, 3821890], [3821891, 4586268], [4586269, 5350646], [5350647, 6115024], [6115025, 6879402], [6879403, 7643780], [7643781, 8408158], [8408159, 9172536], [9172537, 9936914], [9936915, 10701292], [10701293, 11465670], [11465671, 12230048], [12230049, 12994426], [12994427, 13758804], [13758805, 14523182], [14523183, 15287579]] SRR7171924 file size 5158758 SRR7171924 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171924 SRR7171924_1.fastq SRR7171924_2.fastq Input file: SRR7171924_1.fastq Paired file: SRR7171924_2.fastq trimmed: SRR7171924-trimmed-pair1.fastq, SRR7171924-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 15:06:29 2025 >> started Fri Feb 14 15:06:47 2025 >> done (17.683s) 15287579 read pairs processed; of these: 10035 ( 0.07%) short read pairs filtered out after trimming by size control 7378 ( 0.05%) empty read pairs filtered out after trimming by size control 15270166 (99.89%) read pairs available; of these: 6212478 (40.68%) trimmed read pairs available after processing 9057688 (59.32%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 2 0.00% 20 2 0.00% 21 3 0.00% 22 0 0.00% 23 2 0.00% 24 2 0.00% 25 5 0.00% 26 3 0.00% 27 3 0.00% 28 2 0.00% 29 2 0.00% 30 5 0.00% 31 5 0.00% 32 4 0.00% 33 4 0.00% 34 3 0.00% 35 4 0.00% 36 3 0.00% 37 1 0.00% 38 5 0.00% 39 6 0.00% 40 2 0.00% 41 7 0.00% 42 5 0.00% 43 8 0.00% 44 11 0.00% 45 12 0.00% 46 14 0.00% 47 13 0.00% 48 16 0.00% 49 23 0.00% 50 31 0.00% 51 26 0.00% 52 36 0.00% 53 41 0.00% 54 47 0.00% 55 41 0.00% 56 54 0.00% 57 49 0.00% 58 71 0.00% 59 87 0.00% 60 101 0.00% 61 120 0.00% 62 153 0.00% 63 161 0.00% 64 150 0.00% 65 209 0.00% 66 193 0.00% 67 219 0.00% 68 307 0.00% 69 274 0.00% 70 402 0.00% 71 393 0.00% 72 477 0.00% 73 533 0.00% 74 578 0.00% 75 649 0.00% 76 791 0.01% 77 876 0.01% 78 931 0.01% 79 1091 0.01% 80 1263 0.01% 81 1385 0.01% 82 1595 0.01% 83 1822 0.01% 84 2495 0.02% 85 2988 0.02% 86 3251 0.02% 87 3531 0.02% 88 3686 0.02% 89 4023 0.03% 90 4297 0.03% 91 4689 0.03% 92 4988 0.03% 93 5338 0.03% 94 5869 0.04% 95 6019 0.04% 96 6407 0.04% 97 6933 0.05% 98 7372 0.05% 99 7840 0.05% 100 8192 0.05% 101 8924 0.06% 102 9254 0.06% 103 9897 0.06% 104 10764 0.07% 105 11216 0.07% 106 11714 0.08% 107 12163 0.08% 108 12807 0.08% 109 13355 0.09% 110 14236 0.09% 111 14937 0.10% 112 15842 0.10% 113 16380 0.11% 114 17331 0.11% 115 18102 0.12% 116 19105 0.13% 117 19621 0.13% 118 20367 0.13% 119 21066 0.14% 120 22003 0.14% 121 22558 0.15% 122 23577 0.15% 123 25128 0.16% 124 25823 0.17% 125 27187 0.18% 126 28570 0.19% 127 29597 0.19% 128 30300 0.20% 129 32296 0.21% 130 33623 0.22% 131 34873 0.23% 132 36756 0.24% 133 38932 0.25% 134 41210 0.27% 135 43291 0.28% 136 46372 0.30% 137 49042 0.32% 138 52282 0.34% 139 56142 0.37% 140 61053 0.40% 141 66607 0.44% 142 73705 0.48% 143 83405 0.55% 144 96437 0.63% 145 116897 0.77% 146 146601 0.96% 147 200159 1.31% 148 316180 2.07% 149 647225 4.24% 150 3324310 21.77% 151 9057688 59.32% 15270166 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.65 fanout-score-rank=24 prefix-density=0.18 prefix-fanout=2.6 sequence=GTGGACTCCTTCTGGAT criterion=fanout-score sequence-density=0.04 sequence-density-rank=31 fanout-score=18.53 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=4.3 sequence=TTGTCAATGGTATCAGAGCTCTCCACCTCCAAGGTGATGGTCTT criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=3.79 fanout-score-rank=26 prefix-density=0.28 prefix-fanout=3.2 sequence=TGCAAGTGCGGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=152.15 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=14.0 sequence=AAGAAAAACAAAAAAGAAATGGATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGCATTAGCAGAAAATGAAGAAGACCCTGGTCTTGTTATGAACTTTTACAAGGATACATGCCCTCAAGCTGAGGACATTGTCAAAGAACAAGTTAGACTCCTTTACAAGAGACACAAAAACACTGCATTTTCTTGGCTAAGAAACATCTTCCATGACTGTGCTGTTCAGTCATGTGATGCTTCACTGCTGCTGGACTCAACAAGGAGGACCTTGTCCGAGAAGGAGACAGACAGGAGCTTTGGCCTCAGGAACTTTAGATACTTTGACGATATCAAAGAAGCTGTTGAAAGAGAGTGTCCTGGAGTCGTTTCCTGTGCTGATATTCTTGTCCTGTCTGCTAGAGATGGCATTGTTTCGCTAGGAGGACCTCATATCCCTCTCAAAACTGGAAGAAGGGATGGCAGGAAGAGCAGAGCAGATGTGATCGAGG SRR7171924 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 15:07:46 Started mapping on | Feb 14 15:07:46 Finished on | Feb 14 15:09:33 Mapping speed, Million of reads per hour | 513.76 Number of input reads | 15270166 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 14322023 Uniquely mapped reads % | 93.79% Average mapped length | 295.79 Number of splices: Total | 14477080 Number of splices: Annotated (sjdb) | 14184563 Number of splices: GT/AG | 14233878 Number of splices: GC/AG | 188159 Number of splices: AT/AC | 12012 Number of splices: Non-canonical | 43031 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.04% Deletion average length | 2.56 Insertion rate per base | 0.02% Insertion average length | 2.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 407410 % of reads mapped to multiple loci | 2.67% Number of reads mapped to too many loci | 54143 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.11% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 551479 551479 551479 N_multimapping 407410 407410 407410 N_noFeature 373331 14185773 440338 N_ambiguous 155904 1004 85993 UnstrandedReadsAssigned:13792788 PositiveStrandReadsAssigned:135246 NegativeStrandReadsAssigned:13795692 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171924 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171924-trimmed-pair1.fastq SRR7171924-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,270,166 reads, 13,656,872 reads pseudoaligned [quant] estimated average fragment length: 252.737 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,083 rounds 52401 SRR7171924.ke.tsv 34699 SRR7171924.se.tsv 87100 total ==> SRR7171924.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.26 1174 47.5161 Potri.005G024800.1.v4.1 1035 783.263 289 26.3766 Potri.004G059700.1.v4.1 961 709.277 23 2.31814 Potri.007G009000.2.v4.1 1416 1164.26 0 0 Potri.003G141000.2.v4.1 2943 2691.26 343.167 9.11545 Potri.016G087400.1.v4.1 270 73.5439 992 964.259 Potri.015G069301.1.v4.1 564 316.793 0 0 Potri.010G195200.1.v4.1 1773 1521.26 340.806 16.0151 Potri.012G127500.1.v4.1 977 725.277 10219 1007.24 ==> SRR7171924.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 37 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 354 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 154 SRR7171924 completed mapping pipeline successfully