Starting /dee2/code/volunteer_pipeline.sh SRR7171925 current disk space = 3112286781440 free memory = 1396307928 SRR7171925 SRAfilesize 358229474b1cfbe9d58e81f9e9b18480 SRR7171925.sra SRR7171925.sra file validated SRR7171925 is paired end SRR7171925 is conventional basespace SRR7171925 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171925_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.75225 28.0 18.0 32.0 18.0 33.0 2 28.16525 29.0 27.0 31.0 18.0 33.0 3 30.43825 31.0 29.0 33.0 27.0 33.0 4 32.25025 33.0 33.0 33.0 31.0 33.0 5 32.7605 33.0 33.0 33.0 32.0 34.0 6 37.02275 38.0 37.0 38.0 36.0 38.0 7 37.34575 38.0 38.0 38.0 37.0 38.0 8 37.51125 38.0 38.0 38.0 37.0 38.0 9 37.5425 38.0 38.0 38.0 38.0 38.0 10-14 37.5895 38.0 38.0 38.0 38.0 38.0 15-19 37.5839 38.0 38.0 38.0 38.0 38.0 20-24 37.518150000000006 38.0 38.0 38.0 37.8 38.0 25-29 37.4774 38.0 38.0 38.0 37.4 38.0 30-34 37.4602 38.0 38.0 38.0 37.0 38.0 35-39 37.44395 38.0 38.0 38.0 37.0 38.0 40-44 37.42515 38.0 38.0 38.0 37.0 38.0 45-49 37.3686 38.0 38.0 38.0 37.0 38.0 50-54 37.2762 38.0 38.0 38.0 36.8 38.0 55-59 37.307900000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.1485 38.0 38.0 38.0 36.0 38.0 65-69 37.16035 38.0 38.0 38.0 36.0 38.0 70-74 37.01675 38.0 38.0 38.0 36.0 38.0 75-79 36.9681 38.0 38.0 38.0 36.0 38.0 80-84 36.8839 38.0 38.0 38.0 35.4 38.0 85-89 36.8976 38.0 38.0 38.0 35.8 38.0 90-94 36.802400000000006 38.0 38.0 38.0 35.0 38.0 95-99 36.6588 38.0 38.0 38.0 34.4 38.0 100-104 36.50295000000001 38.0 38.0 38.0 34.0 38.0 105-109 36.3352 38.0 37.8 38.0 34.0 38.0 110-114 36.22275 38.0 37.2 38.0 33.8 38.0 115-119 36.0236 38.0 37.0 38.0 33.0 38.0 120-124 35.9234 38.0 37.0 38.0 32.8 38.0 125-129 35.67065 38.0 36.4 38.0 31.6 38.0 130-134 35.2643 38.0 36.0 38.0 29.8 38.0 135-139 35.0859 38.0 36.0 38.0 28.2 38.0 140-144 34.6583 38.0 35.0 38.0 27.8 38.0 145-149 34.116099999999996 38.0 35.0 38.0 25.2 38.0 150-151 30.965625000000003 36.5 31.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 3.0 12 0.0 13 1.0 14 1.0 15 0.0 16 2.0 17 2.0 18 6.0 19 2.0 20 3.0 21 7.0 22 6.0 23 2.0 24 8.0 25 13.0 26 18.0 27 14.0 28 17.0 29 22.0 30 38.0 31 46.0 32 59.0 33 82.0 34 146.0 35 293.0 36 818.0 37 2391.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.325 14.6 13.25 35.825 2 19.900000000000002 20.3 37.475 22.325 3 18.875 25.35 26.724999999999998 29.049999999999997 4 21.7 33.675 23.025000000000002 21.6 5 20.549999999999997 37.3 24.15 18.0 6 17.775 35.05 27.175 20.0 7 14.325 20.724999999999998 45.125 19.825 8 17.424999999999997 21.25 32.125 29.2 9 18.325 23.225 31.1 27.35 10-14 19.945 29.365000000000002 27.08 23.61 15-19 19.6 28.194999999999997 28.060000000000002 24.145 20-24 19.495 28.249999999999996 28.28 23.974999999999998 25-29 19.435 28.815 27.935 23.815 30-34 20.215 28.845 27.525 23.415 35-39 19.41 29.189999999999998 27.779999999999998 23.62 40-44 19.685 28.43 28.49 23.395 45-49 19.895 28.1 27.875 24.13 50-54 20.205000000000002 28.77 28.050000000000004 22.975 55-59 19.939999999999998 28.694999999999997 27.700000000000003 23.665 60-64 20.244999999999997 28.34 27.939999999999998 23.474999999999998 65-69 20.4 28.395 27.485 23.72 70-74 20.255000000000003 27.965 28.04 23.74 75-79 20.415 28.945 26.63 24.01 80-84 20.349999999999998 28.7 27.37 23.580000000000002 85-89 20.385 28.16 28.03 23.425 90-94 19.900000000000002 28.33 27.85 23.919999999999998 95-99 20.369999999999997 27.994999999999997 27.985 23.65 100-104 20.005 27.815 28.815 23.365 105-109 20.169999999999998 28.46 27.73 23.64 110-114 19.785 27.96 28.439999999999998 23.815 115-119 20.155 28.565 27.49 23.79 120-124 20.285 28.265 27.71 23.74 125-129 20.69 28.13 27.400000000000002 23.78 130-134 20.495 27.855 27.76 23.89 135-139 20.62 27.665 27.915 23.799999999999997 140-144 20.49 27.55 27.825 24.135 145-149 20.990000000000002 27.985 27.395000000000003 23.630000000000003 150-151 21.25 28.0875 26.900000000000002 23.7625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 1.0 25 2.5 26 4.5 27 9.0 28 12.5 29 14.0 30 16.0 31 18.5 32 27.5 33 35.5 34 51.0 35 69.5 36 95.0 37 118.5 38 132.5 39 162.0 40 202.0 41 231.5 42 262.5 43 288.5 44 292.0 45 279.0 46 256.0 47 237.0 48 220.5 49 208.0 50 176.0 51 140.5 52 120.5 53 89.5 54 63.5 55 47.5 56 33.5 57 23.5 58 16.0 59 13.5 60 10.0 61 5.0 62 3.5 63 2.5 64 0.0 65 1.0 66 1.0 67 0.0 68 0.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.6375 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.95 0.0 0.0 0.0 0.0 110-111 1.0625 0.0 0.0 0.0 0.0 112-113 1.1749999999999998 0.0 0.0 0.0 0.0 114-115 1.3125 0.0 0.0 0.0 0.0 116-117 1.4625 0.0 0.0 0.0 0.0 118-119 1.625 0.0 0.0 0.0 0.0 120-121 1.8 0.0 0.0 0.0 0.0 122-123 2.0125 0.0 0.0 0.0 0.0 124-125 2.2249999999999996 0.0 0.0 0.0 0.0 126-127 2.4875 0.0 0.0 0.0 0.0 128-129 2.75 0.0 0.0 0.0 0.0 130-131 2.9875 0.0 0.0 0.0 0.0 132-133 3.2875 0.0 0.0 0.0 0.0 134-135 3.6125 0.0 0.0 0.0 0.0 136-137 3.9749999999999996 0.0 0.0 0.0 0.0 138-139 4.237500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATGTTT 10 0.006830828 145.0 3 >>END_MODULE SRR7171925 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171925_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.059 33.0 33.0 34.0 32.0 34.0 2 33.1295 34.0 33.0 34.0 33.0 34.0 3 33.1615 34.0 33.0 34.0 33.0 34.0 4 33.126 34.0 33.0 34.0 33.0 34.0 5 33.119 34.0 33.0 34.0 33.0 34.0 6 37.3355 38.0 38.0 38.0 37.0 38.0 7 37.42725 38.0 38.0 38.0 38.0 38.0 8 37.343 38.0 38.0 38.0 37.0 38.0 9 37.3445 38.0 38.0 38.0 38.0 38.0 10-14 37.3555 38.0 38.0 38.0 37.4 38.0 15-19 37.3388 38.0 38.0 38.0 37.2 38.0 20-24 37.282149999999994 38.0 38.0 38.0 37.0 38.0 25-29 37.30839999999999 38.0 38.0 38.0 37.0 38.0 30-34 37.169399999999996 38.0 38.0 38.0 36.8 38.0 35-39 36.9468 38.0 38.0 38.0 37.0 38.0 40-44 36.88995 38.0 38.0 38.0 36.8 38.0 45-49 37.1809 38.0 38.0 38.0 37.0 38.0 50-54 37.168400000000005 38.0 38.0 38.0 37.0 38.0 55-59 37.164699999999996 38.0 38.0 38.0 36.8 38.0 60-64 37.1314 38.0 38.0 38.0 36.6 38.0 65-69 37.037 38.0 38.0 38.0 36.0 38.0 70-74 37.003550000000004 38.0 38.0 38.0 36.0 38.0 75-79 37.00895 38.0 38.0 38.0 36.0 38.0 80-84 36.888999999999996 38.0 38.0 38.0 36.0 38.0 85-89 36.75915 38.0 38.0 38.0 35.0 38.0 90-94 36.670100000000005 38.0 38.0 38.0 35.0 38.0 95-99 36.4824 38.0 38.0 38.0 34.4 38.0 100-104 36.5244 38.0 38.0 38.0 34.2 38.0 105-109 36.324650000000005 38.0 38.0 38.0 34.0 38.0 110-114 36.267849999999996 38.0 38.0 38.0 34.0 38.0 115-119 35.935500000000005 38.0 37.2 38.0 33.0 38.0 120-124 35.8116 38.0 37.0 38.0 32.2 38.0 125-129 35.545500000000004 38.0 36.6 38.0 31.0 38.0 130-134 35.409000000000006 38.0 36.2 38.0 30.4 38.0 135-139 34.993199999999995 38.0 35.8 38.0 28.2 38.0 140-144 34.60705 38.0 35.2 38.0 27.4 38.0 145-149 34.171049999999994 38.0 35.0 38.0 25.4 38.0 150-151 30.778124999999996 36.5 30.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 4.0 4 2.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 2.0 15 0.0 16 2.0 17 2.0 18 2.0 19 4.0 20 4.0 21 7.0 22 8.0 23 15.0 24 15.0 25 15.0 26 12.0 27 17.0 28 14.0 29 31.0 30 30.0 31 47.0 32 62.0 33 84.0 34 137.0 35 271.0 36 568.0 37 2639.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.25 14.475 15.425 29.849999999999998 2 22.625 24.349999999999998 35.15 17.875 3 22.275 26.674999999999997 29.425 21.625 4 24.4 36.175000000000004 20.0 19.425 5 23.7 37.724999999999994 20.875 17.7 6 18.175 38.4 23.05 20.375 7 18.575 16.875 41.625 22.925 8 21.65 21.825 28.299999999999997 28.225 9 21.825 24.325 27.975 25.874999999999996 10-14 22.725 28.64 26.889999999999997 21.745 15-19 23.599999999999998 27.775 27.605 21.02 20-24 23.075000000000003 28.075 27.58 21.27 25-29 22.6 28.985 27.02 21.395 30-34 23.499047809962914 27.854064348000403 27.503257492232137 21.14363034980455 35-39 22.7842367507172 28.08898283758619 28.00845538275706 21.118325028939555 40-44 23.3462642954305 27.53791122978488 28.22308428636203 20.89274018842259 45-49 23.005 28.32 27.705000000000002 20.97 50-54 23.244999999999997 28.365000000000002 27.515 20.875 55-59 23.54 28.225 27.935 20.3 60-64 23.32 28.21 28.04 20.43 65-69 23.165 28.455000000000002 27.689999999999998 20.69 70-74 23.505000000000003 28.185 27.565 20.745 75-79 24.005000000000003 27.655 27.54 20.8 80-84 23.74 27.67 27.615000000000002 20.974999999999998 85-89 23.56 27.950000000000003 27.950000000000003 20.54 90-94 23.695 28.449999999999996 27.3 20.555 95-99 23.845 27.82 27.634999999999998 20.7 100-104 24.175 27.584999999999997 27.785 20.455000000000002 105-109 23.794999999999998 28.134999999999998 27.92 20.150000000000002 110-114 23.990000000000002 27.77 27.965 20.275000000000002 115-119 23.875 28.125 27.639999999999997 20.36 120-124 24.21 28.38 27.655 19.755 125-129 24.654999999999998 27.900000000000002 27.13 20.315 130-134 23.875 28.349999999999998 27.88 19.895 135-139 24.635 27.894999999999996 27.365000000000002 20.105 140-144 24.895 28.384999999999998 26.87 19.85 145-149 24.27 27.655 27.950000000000003 20.125 150-151 25.1 27.900000000000002 27.224999999999998 19.775000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 1.0 24 1.0 25 1.0 26 2.5 27 5.0 28 5.5 29 9.0 30 10.5 31 13.0 32 19.0 33 26.0 34 36.0 35 48.5 36 68.0 37 95.5 38 138.5 39 178.5 40 198.5 41 210.0 42 230.0 43 256.5 44 289.5 45 302.5 46 296.0 47 282.5 48 261.5 49 232.5 50 188.5 51 152.5 52 117.5 53 85.0 54 60.5 55 48.0 56 39.0 57 24.5 58 17.5 59 12.5 60 8.5 61 8.0 62 5.5 63 4.0 64 2.5 65 1.0 66 1.5 67 1.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.22999999999999998 35-39 0.655 40-44 0.755 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.4875 0.0 0.0 0.0 0.0 104-105 0.6375 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.95 0.0 0.0 0.0 0.0 110-111 1.0625 0.0 0.0 0.0 0.0 112-113 1.1749999999999998 0.0 0.0 0.0 0.0 114-115 1.3125 0.0 0.0 0.0 0.0 116-117 1.4625 0.0 0.0 0.0 0.0 118-119 1.625 0.0 0.0 0.0 0.0 120-121 1.8 0.0 0.0 0.0 0.0 122-123 2.0125 0.0 0.0 0.0 0.0 124-125 2.2375 0.0 0.0 0.0 0.0 126-127 2.5 0.0 0.0 0.0 0.0 128-129 2.75 0.0 0.0 0.0 0.0 130-131 2.9875 0.0 0.0 0.0 0.0 132-133 3.3 0.0 0.0 0.0 0.0 134-135 3.6625 0.0 0.0 0.0 0.0 136-137 4.012499999999999 0.0 0.0 0.0 0.0 138-139 4.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 888962 spots for SRR7171925.sra Written 888962 spots for SRR7171925.sra Read 888962 spots for SRR7171925.sra Written 888962 spots for SRR7171925.sra Read 888962 spots for SRR7171925.sra Written 888962 spots for SRR7171925.sra Read 888962 spots for SRR7171925.sra Written 888962 spots for SRR7171925.sra Read 888962 spots for SRR7171925.sra Written 888962 spots for SRR7171925.sra Read 888962 spots for SRR7171925.sra Written 888962 spots for SRR7171925.sra Read 888962 spots for SRR7171925.sra Written 888962 spots for SRR7171925.sra Read 888962 spots for SRR7171925.sra Written 888962 spots for SRR7171925.sra Read 888962 spots for SRR7171925.sra Written 888962 spots for SRR7171925.sra Read 888962 spots for SRR7171925.sra Written 888962 spots for SRR7171925.sra Read 888962 spots for SRR7171925.sra Written 888962 spots for SRR7171925.sra Read 888962 spots for SRR7171925.sra Written 888962 spots for SRR7171925.sra Read 888962 spots for SRR7171925.sra Written 888962 spots for SRR7171925.sra Read 888962 spots for SRR7171925.sra Written 888962 spots for SRR7171925.sra Read 888962 spots for SRR7171925.sra Written 888962 spots for SRR7171925.sra Read 888962 spots for SRR7171925.sra Written 888962 spots for SRR7171925.sra Read 888976 spots for SRR7171925.sra Written 888976 spots for SRR7171925.sra Read 888962 spots for SRR7171925.sra Written 888962 spots for SRR7171925.sra Read 888962 spots for SRR7171925.sra Written 888962 spots for SRR7171925.sra Read 888962 spots for SRR7171925.sra Written 888962 spots for SRR7171925.sra SRR ids: ['SRR7171925.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_htf1_peu SRR7171925.sra spots: 17779254 blocks: [[1, 888962], [888963, 1777924], [1777925, 2666886], [2666887, 3555848], [3555849, 4444810], [4444811, 5333772], [5333773, 6222734], [6222735, 7111696], [7111697, 8000658], [8000659, 8889620], [8889621, 9778582], [9778583, 10667544], [10667545, 11556506], [11556507, 12445468], [12445469, 13334430], [13334431, 14223392], [14223393, 15112354], [15112355, 16001316], [16001317, 16890278], [16890279, 17779254]] SRR7171925 file size 6003105 SRR7171925 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171925 SRR7171925_1.fastq SRR7171925_2.fastq Input file: SRR7171925_1.fastq Paired file: SRR7171925_2.fastq trimmed: SRR7171925-trimmed-pair1.fastq, SRR7171925-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 14:45:20 2025 >> started Fri Feb 14 14:46:19 2025 >> done (59.193s) 17779254 read pairs processed; of these: 12847 ( 0.07%) short read pairs filtered out after trimming by size control 8900 ( 0.05%) empty read pairs filtered out after trimming by size control 17757507 (99.88%) read pairs available; of these: 7779583 (43.81%) trimmed read pairs available after processing 9977924 (56.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 2 0.00% 21 4 0.00% 22 5 0.00% 23 1 0.00% 24 3 0.00% 25 4 0.00% 26 6 0.00% 27 4 0.00% 28 6 0.00% 29 4 0.00% 30 4 0.00% 31 3 0.00% 32 5 0.00% 33 5 0.00% 34 7 0.00% 35 1 0.00% 36 4 0.00% 37 1 0.00% 38 5 0.00% 39 5 0.00% 40 2 0.00% 41 11 0.00% 42 6 0.00% 43 4 0.00% 44 9 0.00% 45 7 0.00% 46 8 0.00% 47 14 0.00% 48 17 0.00% 49 13 0.00% 50 17 0.00% 51 21 0.00% 52 32 0.00% 53 39 0.00% 54 25 0.00% 55 37 0.00% 56 53 0.00% 57 45 0.00% 58 65 0.00% 59 70 0.00% 60 66 0.00% 61 75 0.00% 62 79 0.00% 63 101 0.00% 64 132 0.00% 65 157 0.00% 66 147 0.00% 67 180 0.00% 68 185 0.00% 69 235 0.00% 70 287 0.00% 71 350 0.00% 72 385 0.00% 73 404 0.00% 74 484 0.00% 75 555 0.00% 76 652 0.00% 77 714 0.00% 78 791 0.00% 79 894 0.01% 80 999 0.01% 81 1163 0.01% 82 1317 0.01% 83 1585 0.01% 84 2344 0.01% 85 2752 0.02% 86 3110 0.02% 87 3369 0.02% 88 3634 0.02% 89 3842 0.02% 90 3984 0.02% 91 4398 0.02% 92 4737 0.03% 93 4884 0.03% 94 5597 0.03% 95 5899 0.03% 96 6347 0.04% 97 6605 0.04% 98 7113 0.04% 99 7463 0.04% 100 8101 0.05% 101 8683 0.05% 102 9382 0.05% 103 9985 0.06% 104 10607 0.06% 105 11360 0.06% 106 11881 0.07% 107 12673 0.07% 108 13227 0.07% 109 14064 0.08% 110 14941 0.08% 111 15664 0.09% 112 16591 0.09% 113 17419 0.10% 114 18331 0.10% 115 19809 0.11% 116 20159 0.11% 117 21154 0.12% 118 24256 0.14% 119 20582 0.12% 120 23922 0.13% 121 25371 0.14% 122 26254 0.15% 123 27813 0.16% 124 29156 0.16% 125 30692 0.17% 126 31983 0.18% 127 33553 0.19% 128 35322 0.20% 129 36699 0.21% 130 38941 0.22% 131 40672 0.23% 132 42728 0.24% 133 45961 0.26% 134 48859 0.28% 135 49173 0.28% 136 52671 0.30% 137 56977 0.32% 138 61645 0.35% 139 67516 0.38% 140 72610 0.41% 141 80755 0.45% 142 90875 0.51% 143 104413 0.59% 144 123042 0.69% 145 147412 0.83% 146 190861 1.07% 147 268552 1.51% 148 422262 2.38% 149 883013 4.97% 150 4202418 23.67% 151 9977924 56.19% 17757507 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=32 prefix-density=0.31 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.07 sequence-density-rank=33 fanout-score=370.15 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=33.2 sequence=TCTTCTTCTTCCT criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=27 prefix-density=0.42 prefix-fanout=2.2 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=21 fanout-score=120.43 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=22.5 sequence=GAAGAAGAGAGG SRR7171925 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 14:47:45 Started mapping on | Feb 14 14:47:45 Finished on | Feb 14 14:49:51 Mapping speed, Million of reads per hour | 507.36 Number of input reads | 17757507 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 16649152 Uniquely mapped reads % | 93.76% Average mapped length | 296.02 Number of splices: Total | 17528635 Number of splices: Annotated (sjdb) | 17235232 Number of splices: GT/AG | 17251255 Number of splices: GC/AG | 221074 Number of splices: AT/AC | 13055 Number of splices: Non-canonical | 43251 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.49 Insertion rate per base | 0.02% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 457330 % of reads mapped to multiple loci | 2.58% Number of reads mapped to too many loci | 48793 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.30% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 664719 664719 664719 N_multimapping 457330 457330 457330 N_noFeature 360582 16504274 419122 N_ambiguous 166621 737 79978 UnstrandedReadsAssigned:16121949 PositiveStrandReadsAssigned:144141 NegativeStrandReadsAssigned:16150052 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171925 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171925-trimmed-pair1.fastq SRR7171925-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,757,507 reads, 15,950,252 reads pseudoaligned [quant] estimated average fragment length: 255.803 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,065 rounds 52401 SRR7171925.ke.tsv 34699 SRR7171925.se.tsv 87100 total ==> SRR7171925.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.2 805 26.2394 Potri.005G024800.1.v4.1 1035 780.197 172 12.6702 Potri.004G059700.1.v4.1 961 706.202 23 1.87179 Potri.007G009000.2.v4.1 1416 1161.2 0 0 Potri.003G141000.2.v4.1 2943 2688.2 455.109 9.73002 Potri.016G087400.1.v4.1 270 71.8903 1351 1080.05 Potri.015G069301.1.v4.1 564 314.509 0 0 Potri.010G195200.1.v4.1 1773 1518.2 345.671 13.0856 Potri.012G127500.1.v4.1 977 722.197 3904 310.68 ==> SRR7171925.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 33 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 567 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 107 SRR7171925 completed mapping pipeline successfully