Starting /dee2/code/volunteer_pipeline.sh SRR7171926 current disk space = 3087979782144 free memory = 1579156516 SRR7171926 SRAfilesize 7cc62da17e2d25acbbcabc7ece16f8e2 SRR7171926.sra SRR7171926.sra file validated SRR7171926 is paired end SRR7171926 is conventional basespace SRR7171926 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171926_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.3045 32.0 18.0 33.0 18.0 34.0 2 30.82725 31.0 30.0 33.0 27.0 33.0 3 31.367 33.0 31.0 33.0 29.0 33.0 4 32.299 33.0 33.0 33.0 31.0 34.0 5 32.52375 33.0 33.0 33.0 32.0 34.0 6 36.62025 38.0 37.0 38.0 34.0 38.0 7 37.146 38.0 38.0 38.0 36.0 38.0 8 37.463 38.0 38.0 38.0 37.0 38.0 9 37.438 38.0 38.0 38.0 37.0 38.0 10-14 37.538599999999995 38.0 38.0 38.0 37.8 38.0 15-19 37.5604 38.0 38.0 38.0 37.8 38.0 20-24 37.496449999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.467200000000005 38.0 38.0 38.0 37.4 38.0 30-34 37.48365 38.0 38.0 38.0 37.2 38.0 35-39 37.4171 38.0 38.0 38.0 37.0 38.0 40-44 37.3568 38.0 38.0 38.0 37.0 38.0 45-49 37.362199999999994 38.0 38.0 38.0 37.0 38.0 50-54 37.303 38.0 38.0 38.0 37.0 38.0 55-59 37.17505 38.0 38.0 38.0 36.0 38.0 60-64 37.1919 38.0 38.0 38.0 36.0 38.0 65-69 37.107949999999995 38.0 38.0 38.0 36.0 38.0 70-74 37.033249999999995 38.0 38.0 38.0 36.0 38.0 75-79 36.9772 38.0 38.0 38.0 36.0 38.0 80-84 36.883300000000006 38.0 38.0 38.0 35.4 38.0 85-89 36.850550000000005 38.0 38.0 38.0 35.2 38.0 90-94 36.65875 38.0 38.0 38.0 34.2 38.0 95-99 36.71005000000001 38.0 38.0 38.0 34.8 38.0 100-104 36.4876 38.0 38.0 38.0 34.0 38.0 105-109 36.353199999999994 38.0 37.8 38.0 34.0 38.0 110-114 36.26965 38.0 37.2 38.0 33.6 38.0 115-119 36.0792 38.0 37.0 38.0 33.2 38.0 120-124 35.925850000000004 38.0 37.0 38.0 32.2 38.0 125-129 35.81885 38.0 36.8 38.0 31.6 38.0 130-134 35.503099999999996 38.0 36.0 38.0 31.0 38.0 135-139 35.176100000000005 38.0 35.6 38.0 29.6 38.0 140-144 34.6976 38.0 35.0 38.0 27.4 38.0 145-149 34.15905 38.0 35.0 38.0 25.0 38.0 150-151 30.976374999999997 36.5 31.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 2.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 2.0 17 2.0 18 1.0 19 2.0 20 2.0 21 3.0 22 5.0 23 13.0 24 12.0 25 7.0 26 12.0 27 12.0 28 16.0 29 32.0 30 28.0 31 41.0 32 68.0 33 105.0 34 155.0 35 288.0 36 770.0 37 2420.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.449999999999996 16.55 11.625 37.375 2 19.625 21.975 37.175000000000004 21.224999999999998 3 20.1 27.325 25.874999999999996 26.700000000000003 4 22.05 34.925 21.05 21.975 5 20.9 36.8 23.875 18.425 6 16.35 38.0 25.5 20.150000000000002 7 12.950000000000001 21.0 45.75 20.3 8 18.575 22.425 29.475 29.525000000000002 9 18.375 23.225 30.375000000000004 28.025 10-14 20.150000000000002 29.604999999999997 26.495 23.75 15-19 19.99 28.255000000000003 27.62 24.135 20-24 19.75 28.51 27.794999999999998 23.945 25-29 19.950000000000003 28.49 28.12 23.44 30-34 20.415 28.565 27.38 23.64 35-39 20.14 28.705000000000002 27.41 23.745 40-44 19.64 28.675 27.655 24.03 45-49 19.84 28.375 27.705000000000002 24.08 50-54 20.155 28.57 28.025 23.25 55-59 20.055 28.050000000000004 28.02 23.875 60-64 20.19 28.42 27.42 23.97 65-69 20.244999999999997 28.134999999999998 27.855 23.765 70-74 20.19 27.845 27.77 24.195 75-79 20.419999999999998 28.52 27.889999999999997 23.169999999999998 80-84 20.865000000000002 28.000000000000004 27.51 23.625 85-89 20.27 27.744999999999997 28.465 23.52 90-94 20.875 28.155 27.705000000000002 23.265 95-99 20.65 27.944999999999997 27.744999999999997 23.66 100-104 20.325 28.115000000000002 27.794999999999998 23.765 105-109 20.845 27.93 27.525 23.7 110-114 20.735 28.244999999999997 27.935 23.085 115-119 20.945 28.575 27.12 23.36 120-124 21.25 27.644999999999996 27.465 23.64 125-129 20.345 28.395 27.565 23.695 130-134 21.495 27.595 27.634999999999998 23.275000000000002 135-139 21.01 28.249999999999996 27.01 23.73 140-144 20.955 27.99 27.485 23.57 145-149 21.13 27.575 27.325 23.97 150-151 21.8875 28.075 26.8625 23.175 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 1.0 23 2.5 24 4.0 25 5.0 26 6.5 27 6.5 28 7.5 29 14.0 30 22.5 31 22.0 32 28.0 33 47.5 34 52.5 35 60.0 36 85.5 37 104.0 38 139.0 39 171.5 40 184.5 41 198.0 42 220.0 43 257.5 44 280.0 45 283.0 46 283.5 47 274.0 48 257.5 49 217.0 50 162.5 51 137.5 52 116.0 53 88.0 54 67.5 55 53.5 56 38.0 57 23.5 58 17.0 59 13.5 60 10.5 61 9.0 62 7.5 63 6.5 64 4.0 65 2.0 66 2.0 67 1.5 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.5375 0.0 0.0 0.0 0.0 106-107 0.6 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.0 0.0 110-111 0.8374999999999999 0.0 0.0 0.0 0.0 112-113 0.9874999999999999 0.0 0.0 0.0 0.0 114-115 1.075 0.0 0.0 0.0 0.0 116-117 1.2875 0.0 0.0 0.0 0.0 118-119 1.475 0.0 0.0 0.0 0.0 120-121 1.5875 0.0 0.0 0.0 0.0 122-123 1.7875 0.0 0.0 0.0 0.0 124-125 2.0375 0.0 0.0 0.0 0.0 126-127 2.3125 0.0 0.0 0.0 0.0 128-129 2.7125 0.0 0.0 0.0 0.0 130-131 2.9749999999999996 0.0 0.0 0.0 0.0 132-133 3.1125 0.0 0.0 0.0 0.0 134-135 3.4625 0.0 0.0 0.0 0.0 136-137 3.675 0.0 0.0 0.0 0.0 138-139 3.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACTGTG 10 0.006830828 145.0 5 AAAGAAA 10 0.006830828 145.0 1 >>END_MODULE SRR7171926 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171926_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.98075 33.0 33.0 34.0 32.0 34.0 2 33.057 34.0 33.0 34.0 32.0 34.0 3 33.1 34.0 33.0 34.0 32.0 34.0 4 33.09625 34.0 33.0 34.0 33.0 34.0 5 33.162 34.0 33.0 34.0 33.0 34.0 6 37.30325 38.0 38.0 38.0 37.0 38.0 7 37.35375 38.0 38.0 38.0 37.0 38.0 8 37.1565 38.0 38.0 38.0 37.0 38.0 9 37.2135 38.0 38.0 38.0 37.0 38.0 10-14 37.2395 38.0 38.0 38.0 37.0 38.0 15-19 37.18465 38.0 38.0 38.0 37.0 38.0 20-24 37.2316 38.0 38.0 38.0 37.0 38.0 25-29 37.188300000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.10695 38.0 38.0 38.0 36.2 38.0 35-39 36.91605 38.0 38.0 38.0 36.0 38.0 40-44 36.717600000000004 38.0 38.0 38.0 35.8 38.0 45-49 36.97915 38.0 38.0 38.0 36.0 38.0 50-54 37.0661 38.0 38.0 38.0 36.0 38.0 55-59 36.962300000000006 38.0 38.0 38.0 36.0 38.0 60-64 36.9392 38.0 38.0 38.0 36.0 38.0 65-69 36.84155 38.0 38.0 38.0 35.6 38.0 70-74 36.8257 38.0 38.0 38.0 35.4 38.0 75-79 36.751400000000004 38.0 38.0 38.0 35.0 38.0 80-84 36.66295 38.0 38.0 38.0 34.8 38.0 85-89 36.4872 38.0 38.0 38.0 34.2 38.0 90-94 36.34985 38.0 38.0 38.0 33.8 38.0 95-99 36.2463 38.0 37.8 38.0 33.6 38.0 100-104 36.12395 38.0 37.6 38.0 33.4 38.0 105-109 35.95 38.0 37.0 38.0 32.8 38.0 110-114 35.7112 38.0 37.0 38.0 31.0 38.0 115-119 35.5869 38.0 37.0 38.0 31.0 38.0 120-124 35.45995 38.0 36.2 38.0 31.0 38.0 125-129 35.148649999999996 38.0 36.0 38.0 28.2 38.0 130-134 34.8652 38.0 35.2 38.0 27.8 38.0 135-139 34.3538 38.0 35.0 38.0 25.6 38.0 140-144 33.84054999999999 38.0 34.8 38.0 22.6 38.0 145-149 33.1745 38.0 34.0 38.0 17.0 38.0 150-151 29.706625 36.5 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 2.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 2.0 13 1.0 14 2.0 15 1.0 16 3.0 17 5.0 18 3.0 19 5.0 20 6.0 21 8.0 22 8.0 23 8.0 24 14.0 25 19.0 26 23.0 27 27.0 28 37.0 29 28.0 30 38.0 31 57.0 32 77.0 33 105.0 34 168.0 35 309.0 36 711.0 37 2326.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.125 17.25 15.375 28.249999999999996 2 25.025 25.15 33.1 16.725 3 20.375 28.249999999999996 29.45 21.925 4 24.75 35.475 21.125 18.65 5 24.099999999999998 37.925 21.349999999999998 16.625 6 19.8 37.4 23.775 19.025 7 18.2 17.5 42.125 22.175 8 20.8 23.0 27.6 28.599999999999998 9 22.900000000000002 24.275 27.275 25.55 10-14 22.895 28.895 26.375 21.834999999999997 15-19 22.919999999999998 27.975 27.6 21.505 20-24 22.99 28.095 27.265 21.65 25-29 23.03 27.99 27.465 21.515 30-34 23.150000000000002 27.939999999999998 27.42 21.490000000000002 35-39 22.405139530214814 28.779361573981127 27.434250150572176 21.381248745231883 40-44 23.597883597883598 28.02217183169564 27.417485512723612 20.962459057697153 45-49 23.66 28.255000000000003 26.945000000000004 21.14 50-54 22.650000000000002 28.42 27.66 21.27 55-59 23.105 27.975 28.134999999999998 20.785 60-64 22.455 28.005000000000003 28.215 21.325 65-69 23.419999999999998 27.889999999999997 27.88 20.810000000000002 70-74 23.355 27.455000000000002 27.54 21.65 75-79 23.28 27.639999999999997 27.99 21.09 80-84 23.445 27.810000000000002 27.575 21.17 85-89 23.375 28.215 27.07 21.34 90-94 23.57 28.144999999999996 27.42 20.865000000000002 95-99 23.705000000000002 27.68 27.955000000000002 20.66 100-104 23.615 27.6 28.025 20.76 105-109 23.985 27.634999999999998 27.55 20.830000000000002 110-114 23.555 28.139999999999997 27.450000000000003 20.855 115-119 23.599999999999998 27.950000000000003 27.224999999999998 21.224999999999998 120-124 23.745 27.87 27.169999999999998 21.215 125-129 23.799999999999997 27.79 27.725 20.685000000000002 130-134 23.845 28.105000000000004 27.395000000000003 20.655 135-139 24.055 28.544999999999998 27.034999999999997 20.365 140-144 23.69 28.325 27.155 20.830000000000002 145-149 24.865000000000002 27.235 27.544999999999998 20.355 150-151 25.162499999999998 26.937499999999996 27.175 20.724999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 2.5 25 2.0 26 1.5 27 2.5 28 3.0 29 3.0 30 7.0 31 11.5 32 17.0 33 25.0 34 34.0 35 42.5 36 66.5 37 102.0 38 137.5 39 159.5 40 187.5 41 233.0 42 258.5 43 277.0 44 303.0 45 312.5 46 292.5 47 263.0 48 237.5 49 206.0 50 168.0 51 147.0 52 131.5 53 101.0 54 65.5 55 43.5 56 37.5 57 29.0 58 20.0 59 18.5 60 13.5 61 10.5 62 8.0 63 6.0 64 5.0 65 2.5 66 1.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.38 40-44 0.775 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.5375 0.0 0.0 0.0 0.0 106-107 0.6 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.0 0.0 110-111 0.8374999999999999 0.0 0.0 0.0 0.0 112-113 0.9874999999999999 0.0 0.0 0.0 0.0 114-115 1.075 0.0 0.0 0.0 0.0 116-117 1.2875 0.0 0.0 0.0 0.0 118-119 1.5 0.0 0.0 0.0 0.0 120-121 1.6124999999999998 0.0 0.0 0.0 0.0 122-123 1.8125 0.0 0.0 0.0 0.0 124-125 2.0625 0.0 0.0 0.0 0.0 126-127 2.3375 0.0 0.0 0.0 0.0 128-129 2.7375 0.0 0.0 0.0 0.0 130-131 2.9875 0.0 0.0 0.0 0.0 132-133 3.1125 0.0 0.0 0.0 0.0 134-135 3.4625 0.0 0.0 0.0 0.0 136-137 3.675 0.0 0.0 0.0 0.0 138-139 3.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGCAGC 10 0.006830828 145.0 6 CTTTGAT 10 0.006830828 145.0 1 >>END_MODULE Read 738949 spots for SRR7171926.sra Written 738949 spots for SRR7171926.sra Read 738949 spots for SRR7171926.sra Written 738949 spots for SRR7171926.sra Read 738949 spots for SRR7171926.sra Written 738949 spots for SRR7171926.sra Read 738949 spots for SRR7171926.sra Written 738949 spots for SRR7171926.sra Read 738949 spots for SRR7171926.sra Written 738949 spots for SRR7171926.sra Read 738949 spots for SRR7171926.sra Written 738949 spots for SRR7171926.sra Read 738949 spots for SRR7171926.sra Written 738949 spots for SRR7171926.sra Read 738949 spots for SRR7171926.sra Written 738949 spots for SRR7171926.sra Read 738949 spots for SRR7171926.sra Written 738949 spots for SRR7171926.sra Read 738949 spots for SRR7171926.sra Written 738949 spots for SRR7171926.sra Read 738949 spots for SRR7171926.sra Written 738949 spots for SRR7171926.sra Read 738949 spots for SRR7171926.sra Written 738949 spots for SRR7171926.sra Read 738959 spots for SRR7171926.sra Written 738959 spots for SRR7171926.sra Read 738949 spots for SRR7171926.sra Written 738949 spots for SRR7171926.sra Read 738949 spots for SRR7171926.sra Written 738949 spots for SRR7171926.sra Read 738949 spots for SRR7171926.sra Written 738949 spots for SRR7171926.sra Read 738949 spots for SRR7171926.sra Written 738949 spots for SRR7171926.sra Read 738949 spots for SRR7171926.sra Written 738949 spots for SRR7171926.sra Read 738949 spots for SRR7171926.sra Written 738949 spots for SRR7171926.sra Read 738949 spots for SRR7171926.sra Written 738949 spots for SRR7171926.sra SRR ids: ['SRR7171926.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wf6wyh9z SRR7171926.sra spots: 14778990 blocks: [[1, 738949], [738950, 1477898], [1477899, 2216847], [2216848, 2955796], [2955797, 3694745], [3694746, 4433694], [4433695, 5172643], [5172644, 5911592], [5911593, 6650541], [6650542, 7389490], [7389491, 8128439], [8128440, 8867388], [8867389, 9606337], [9606338, 10345286], [10345287, 11084235], [11084236, 11823184], [11823185, 12562133], [12562134, 13301082], [13301083, 14040031], [14040032, 14778990]] SRR7171926 file size 4986414 SRR7171926 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171926 SRR7171926_1.fastq SRR7171926_2.fastq Input file: SRR7171926_1.fastq Paired file: SRR7171926_2.fastq trimmed: SRR7171926-trimmed-pair1.fastq, SRR7171926-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 02:26:15 2025 >> started Fri Feb 14 02:26:31 2025 >> done (15.283s) 14778990 read pairs processed; of these: 10802 ( 0.07%) short read pairs filtered out after trimming by size control 8653 ( 0.06%) empty read pairs filtered out after trimming by size control 14759535 (99.87%) read pairs available; of these: 6203853 (42.03%) trimmed read pairs available after processing 8555682 (57.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 2 0.00% 21 2 0.00% 22 1 0.00% 23 2 0.00% 24 3 0.00% 25 3 0.00% 26 2 0.00% 27 2 0.00% 28 4 0.00% 29 1 0.00% 30 4 0.00% 31 3 0.00% 32 3 0.00% 33 4 0.00% 34 4 0.00% 35 6 0.00% 36 1 0.00% 37 0 0.00% 38 5 0.00% 39 4 0.00% 40 2 0.00% 41 6 0.00% 42 5 0.00% 43 11 0.00% 44 9 0.00% 45 9 0.00% 46 8 0.00% 47 9 0.00% 48 15 0.00% 49 15 0.00% 50 22 0.00% 51 22 0.00% 52 16 0.00% 53 22 0.00% 54 28 0.00% 55 34 0.00% 56 47 0.00% 57 40 0.00% 58 49 0.00% 59 57 0.00% 60 68 0.00% 61 84 0.00% 62 76 0.00% 63 112 0.00% 64 118 0.00% 65 117 0.00% 66 139 0.00% 67 185 0.00% 68 196 0.00% 69 226 0.00% 70 271 0.00% 71 279 0.00% 72 376 0.00% 73 425 0.00% 74 497 0.00% 75 506 0.00% 76 657 0.00% 77 691 0.00% 78 746 0.01% 79 835 0.01% 80 1021 0.01% 81 1179 0.01% 82 1350 0.01% 83 1529 0.01% 84 2187 0.01% 85 2558 0.02% 86 2853 0.02% 87 3189 0.02% 88 3439 0.02% 89 3494 0.02% 90 3854 0.03% 91 4067 0.03% 92 4231 0.03% 93 4635 0.03% 94 4946 0.03% 95 5287 0.04% 96 5616 0.04% 97 6071 0.04% 98 6466 0.04% 99 6785 0.05% 100 7271 0.05% 101 7801 0.05% 102 8633 0.06% 103 9125 0.06% 104 9458 0.06% 105 9994 0.07% 106 10561 0.07% 107 11314 0.08% 108 11562 0.08% 109 12259 0.08% 110 12831 0.09% 111 13830 0.09% 112 14348 0.10% 113 14894 0.10% 114 16159 0.11% 115 16990 0.12% 116 17552 0.12% 117 17990 0.12% 118 18537 0.13% 119 19536 0.13% 120 20701 0.14% 121 21392 0.14% 122 22298 0.15% 123 23001 0.16% 124 24339 0.16% 125 26121 0.18% 126 27043 0.18% 127 28161 0.19% 128 29172 0.20% 129 30506 0.21% 130 31993 0.22% 131 33150 0.22% 132 35833 0.24% 133 37602 0.25% 134 39939 0.27% 135 42162 0.29% 136 45641 0.31% 137 48173 0.33% 138 51225 0.35% 139 55811 0.38% 140 59652 0.40% 141 66134 0.45% 142 73995 0.50% 143 83883 0.57% 144 98178 0.67% 145 117915 0.80% 146 150630 1.02% 147 207780 1.41% 148 324925 2.20% 149 664241 4.50% 150 3339764 22.63% 151 8555682 57.97% 14759535 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.10 fanout-score-rank=26 prefix-density=0.29 prefix-fanout=2.2 sequence=CACTTGCAGCCATTCTCAGCACCAGAGTTCATCTCAGACC criterion=fanout-score sequence-density=0.10 sequence-density-rank=17 fanout-score=352.70 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=36.1 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.60 fanout-score-rank=27 prefix-density=0.29 prefix-fanout=2.5 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=235.19 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=12.5 sequence=CAGAAAGAGATATCGTGACAGAGCACCGAAGAGCATTAGACCAATACTACAATG SRR7171926 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 02:27:25 Started mapping on | Feb 14 02:27:26 Finished on | Feb 14 02:29:23 Mapping speed, Million of reads per hour | 454.14 Number of input reads | 14759535 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 13650226 Uniquely mapped reads % | 92.48% Average mapped length | 296.02 Number of splices: Total | 14247163 Number of splices: Annotated (sjdb) | 14012217 Number of splices: GT/AG | 14015708 Number of splices: GC/AG | 182515 Number of splices: AT/AC | 9441 Number of splices: Non-canonical | 39499 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 490312 % of reads mapped to multiple loci | 3.32% Number of reads mapped to too many loci | 80970 % of reads mapped to too many loci | 0.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.48% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 629795 629795 629795 N_multimapping 490312 490312 490312 N_noFeature 261657 13537177 309308 N_ambiguous 137524 644 71754 UnstrandedReadsAssigned:13251045 PositiveStrandReadsAssigned:112405 NegativeStrandReadsAssigned:13269164 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171926 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171926-trimmed-pair1.fastq SRR7171926-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,759,535 reads, 13,168,446 reads pseudoaligned [quant] estimated average fragment length: 259.342 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,072 rounds 52401 SRR7171926.ke.tsv 34699 SRR7171926.se.tsv 87100 total ==> SRR7171926.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.66 1039 39.8808 Potri.005G024800.1.v4.1 1035 776.658 179 15.5668 Potri.004G059700.1.v4.1 961 702.683 30 2.88362 Potri.007G009000.2.v4.1 1416 1157.66 0 0 Potri.003G141000.2.v4.1 2943 2684.66 353.117 8.88395 Potri.016G087400.1.v4.1 270 72.3003 1317 1230.33 Potri.015G069301.1.v4.1 564 311.831 0 0 Potri.010G195200.1.v4.1 1773 1514.66 420.607 18.7559 Potri.012G127500.1.v4.1 977 718.671 2315 217.569 ==> SRR7171926.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 18 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 229 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 314 Potri.001G452600.v4.1 108 SRR7171926 completed mapping pipeline successfully