Starting /dee2/code/volunteer_pipeline.sh SRR7171927 current disk space = 3088978243584 free memory = 1450077380 SRR7171927 SRAfilesize b2ce56f0546e353dcd23c14cac098b86 SRR7171927.sra SRR7171927.sra file validated SRR7171927 is paired end SRR7171927 is conventional basespace SRR7171927 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171927_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.21625 32.0 25.0 33.0 18.0 33.0 2 29.749 31.0 29.0 33.0 25.0 33.0 3 31.9845 33.0 31.0 33.0 29.0 33.0 4 32.473 33.0 33.0 33.0 31.0 34.0 5 33.004 33.0 33.0 34.0 33.0 34.0 6 36.71075 38.0 37.0 38.0 34.0 38.0 7 37.3465 38.0 38.0 38.0 37.0 38.0 8 37.42625 38.0 38.0 38.0 37.0 38.0 9 37.48325 38.0 38.0 38.0 37.0 38.0 10-14 37.576499999999996 38.0 38.0 38.0 37.6 38.0 15-19 37.544500000000006 38.0 38.0 38.0 38.0 38.0 20-24 37.51565000000001 38.0 38.0 38.0 37.4 38.0 25-29 37.4806 38.0 38.0 38.0 37.2 38.0 30-34 37.421749999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.380399999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.380700000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.2967 38.0 38.0 38.0 37.0 38.0 50-54 37.2516 38.0 38.0 38.0 36.8 38.0 55-59 37.24205 38.0 38.0 38.0 36.4 38.0 60-64 37.13325 38.0 38.0 38.0 36.0 38.0 65-69 37.0887 38.0 38.0 38.0 36.0 38.0 70-74 37.027699999999996 38.0 38.0 38.0 35.8 38.0 75-79 36.947 38.0 38.0 38.0 35.4 38.0 80-84 36.898 38.0 38.0 38.0 35.4 38.0 85-89 36.83315 38.0 38.0 38.0 35.0 38.0 90-94 36.748949999999994 38.0 38.0 38.0 34.8 38.0 95-99 36.5731 38.0 38.0 38.0 34.4 38.0 100-104 36.4837 38.0 38.0 38.0 34.0 38.0 105-109 36.220299999999995 38.0 37.4 38.0 33.6 38.0 110-114 36.17765 38.0 37.0 38.0 33.6 38.0 115-119 36.0324 38.0 37.0 38.0 33.0 38.0 120-124 35.85945 38.0 37.0 38.0 32.2 38.0 125-129 35.519000000000005 38.0 36.0 38.0 31.0 38.0 130-134 35.1666 38.0 36.0 38.0 28.2 38.0 135-139 35.011250000000004 38.0 35.6 38.0 28.2 38.0 140-144 34.5439 38.0 35.0 38.0 27.2 38.0 145-149 34.051 38.0 35.0 38.0 25.0 38.0 150-151 30.69225 36.5 30.5 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 1.0 13 0.0 14 2.0 15 3.0 16 1.0 17 0.0 18 3.0 19 2.0 20 4.0 21 6.0 22 5.0 23 3.0 24 7.0 25 10.0 26 10.0 27 17.0 28 31.0 29 32.0 30 28.0 31 50.0 32 66.0 33 109.0 34 140.0 35 321.0 36 790.0 37 2358.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.875 14.274999999999999 11.375 34.475 2 19.575 21.425 37.85 21.15 3 18.525 27.975 26.150000000000002 27.35 4 22.175 34.949999999999996 22.7 20.175 5 22.2 36.925000000000004 23.1 17.775 6 16.225 37.075 25.55 21.15 7 12.825000000000001 22.275 44.25 20.65 8 17.65 21.2 30.0 31.15 9 17.45 22.45 32.0 28.1 10-14 19.05 30.259999999999998 26.58 24.11 15-19 19.43 28.325 28.165000000000003 24.08 20-24 19.735 29.14 27.62 23.505000000000003 25-29 19.475 29.7 27.48 23.345 30-34 20.25 28.785 27.55 23.415 35-39 19.765 28.51 27.815 23.91 40-44 20.085 28.854999999999997 26.955000000000002 24.104999999999997 45-49 20.005 28.744999999999997 28.050000000000004 23.200000000000003 50-54 19.81 28.65 27.445000000000004 24.095 55-59 19.935 28.715000000000003 27.6 23.75 60-64 19.564999999999998 29.15 27.325 23.96 65-69 19.945 28.549999999999997 27.49 24.015 70-74 20.474999999999998 28.285 27.305 23.935000000000002 75-79 20.255000000000003 28.575 27.935 23.235 80-84 19.975 28.860000000000003 27.49 23.674999999999997 85-89 20.695 28.095 27.255000000000003 23.955000000000002 90-94 20.0 28.349999999999998 28.015 23.635 95-99 19.865 28.244999999999997 27.944999999999997 23.945 100-104 20.205000000000002 28.185 27.72 23.89 105-109 20.53 28.4 27.245 23.825 110-114 20.75 28.13 27.265 23.855 115-119 20.515 28.205000000000002 27.57 23.71 120-124 20.349999999999998 28.694999999999997 27.150000000000002 23.805 125-129 20.835 27.74 27.785 23.64 130-134 20.525 28.715000000000003 27.615000000000002 23.145 135-139 20.885 28.13 27.575 23.41 140-144 20.655 28.505000000000003 27.405 23.435 145-149 20.74 28.310000000000002 27.505000000000003 23.445 150-151 19.900000000000002 28.6625 27.187499999999996 24.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 2.0 24 2.0 25 0.0 26 5.0 27 7.5 28 7.0 29 14.5 30 21.5 31 19.5 32 29.0 33 42.5 34 51.5 35 65.5 36 83.5 37 120.0 38 144.0 39 164.0 40 200.5 41 223.0 42 254.5 43 275.5 44 273.5 45 272.5 46 272.0 47 260.5 48 244.0 49 212.5 50 159.0 51 130.0 52 112.5 53 88.5 54 70.0 55 46.0 56 30.0 57 26.0 58 17.5 59 13.5 60 9.0 61 5.5 62 4.5 63 3.0 64 2.0 65 1.0 66 1.5 67 2.5 68 2.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87481221832749 99.725 2 0.10015022533800699 0.2 3 0.025037556334501748 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.32499999999999996 0.0 0.0 0.0 0.0 106-107 0.3625 0.0 0.0 0.0 0.0 108-109 0.4375 0.0 0.0 0.0 0.0 110-111 0.6499999999999999 0.0 0.0 0.0 0.0 112-113 0.8 0.0 0.0 0.0 0.0 114-115 0.9125 0.0 0.0 0.0 0.0 116-117 0.975 0.0 0.0 0.0 0.0 118-119 1.0625 0.0 0.0 0.0 0.0 120-121 1.15 0.0 0.0 0.0 0.0 122-123 1.2375 0.0 0.0 0.0 0.0 124-125 1.3250000000000002 0.0 0.0 0.0 0.0 126-127 1.5 0.0 0.0 0.0 0.0 128-129 1.65 0.0 0.0 0.0 0.0 130-131 1.825 0.0 0.0 0.0 0.0 132-133 1.9625 0.0 0.0 0.0 0.0 134-135 2.0999999999999996 0.0 0.0 0.0 0.0 136-137 2.3125 0.0 0.0 0.0 0.0 138-139 2.5250000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171927 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171927_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.01475 33.0 33.0 34.0 32.0 34.0 2 33.104 34.0 33.0 34.0 33.0 34.0 3 33.128 34.0 33.0 34.0 32.0 34.0 4 33.087 34.0 33.0 34.0 33.0 34.0 5 33.091 34.0 33.0 34.0 32.0 34.0 6 37.2815 38.0 38.0 38.0 37.0 38.0 7 37.4145 38.0 38.0 38.0 37.0 38.0 8 37.2865 38.0 38.0 38.0 37.0 38.0 9 37.3685 38.0 38.0 38.0 37.0 38.0 10-14 37.2603 38.0 38.0 38.0 37.0 38.0 15-19 37.280800000000006 38.0 38.0 38.0 37.0 38.0 20-24 37.2787 38.0 38.0 38.0 37.0 38.0 25-29 37.32105 38.0 38.0 38.0 37.0 38.0 30-34 37.196099999999994 38.0 38.0 38.0 36.8 38.0 35-39 36.93945 38.0 38.0 38.0 36.0 38.0 40-44 36.91275 38.0 38.0 38.0 36.0 38.0 45-49 37.145300000000006 38.0 38.0 38.0 36.2 38.0 50-54 37.12665 38.0 38.0 38.0 36.4 38.0 55-59 37.0415 38.0 38.0 38.0 36.0 38.0 60-64 37.02695 38.0 38.0 38.0 36.0 38.0 65-69 36.9055 38.0 38.0 38.0 35.8 38.0 70-74 36.793150000000004 38.0 38.0 38.0 35.6 38.0 75-79 36.8344 38.0 38.0 38.0 35.4 38.0 80-84 36.7539 38.0 38.0 38.0 35.0 38.0 85-89 36.655 38.0 38.0 38.0 35.0 38.0 90-94 36.46755 38.0 38.0 38.0 34.0 38.0 95-99 36.2673 38.0 37.8 38.0 33.8 38.0 100-104 36.342400000000005 38.0 38.0 38.0 34.0 38.0 105-109 36.15405 38.0 37.8 38.0 33.4 38.0 110-114 36.056749999999994 38.0 37.6 38.0 33.2 38.0 115-119 35.695449999999994 38.0 37.0 38.0 31.8 38.0 120-124 35.51945 38.0 36.6 38.0 31.0 38.0 125-129 35.24735 38.0 36.0 38.0 29.8 38.0 130-134 35.071000000000005 38.0 35.8 38.0 29.2 38.0 135-139 34.78920000000001 38.0 35.4 38.0 27.8 38.0 140-144 34.3335 38.0 35.0 38.0 26.2 38.0 145-149 33.7503 38.0 35.0 38.0 22.2 38.0 150-151 30.322125 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 2.0 4 1.0 5 1.0 6 0.0 7 2.0 8 0.0 9 2.0 10 2.0 11 1.0 12 1.0 13 1.0 14 2.0 15 1.0 16 3.0 17 0.0 18 4.0 19 4.0 20 6.0 21 8.0 22 12.0 23 4.0 24 8.0 25 19.0 26 13.0 27 25.0 28 26.0 29 23.0 30 35.0 31 49.0 32 80.0 33 111.0 34 160.0 35 269.0 36 659.0 37 2464.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.975 16.7 13.950000000000001 27.375 2 24.05 24.2 34.35 17.4 3 21.375 29.175 28.999999999999996 20.45 4 25.0 34.8 22.125 18.075 5 23.925 37.675 21.3 17.1 6 19.025 37.325 23.375 20.275000000000002 7 18.425 16.85 42.125 22.6 8 20.825 23.375 28.1 27.700000000000003 9 22.325 23.849999999999998 28.075 25.75 10-14 22.605 28.315 27.200000000000003 21.88 15-19 23.24 27.67 27.810000000000002 21.279999999999998 20-24 22.96 28.13 27.295 21.615000000000002 25-29 22.595000000000002 28.655 27.705000000000002 21.044999999999998 30-34 22.586301918933817 28.368154717170196 28.207826043388945 20.83771732050704 35-39 23.432708260017094 28.399778794429643 27.127846764868536 21.039666180684733 40-44 22.984053523819107 27.843452889984405 28.14527893757231 21.027214648624177 45-49 23.515 27.77 27.384999999999998 21.33 50-54 23.189999999999998 28.51 27.73 20.57 55-59 23.54 27.99 27.91 20.560000000000002 60-64 22.919999999999998 27.750000000000004 28.63 20.7 65-69 23.585 28.345 27.779999999999998 20.29 70-74 23.995 28.005000000000003 27.55 20.45 75-79 23.355 27.775 27.965 20.905 80-84 23.18 27.865000000000002 28.505000000000003 20.45 85-89 23.78 27.87 27.495000000000005 20.855 90-94 23.24 28.515 27.950000000000003 20.294999999999998 95-99 23.72 27.55 27.810000000000002 20.919999999999998 100-104 24.265 28.375 27.205000000000002 20.155 105-109 23.724999999999998 28.365000000000002 27.255000000000003 20.655 110-114 24.19 28.12 27.779999999999998 19.91 115-119 23.47 27.889999999999997 28.23 20.41 120-124 23.87 27.794999999999998 27.845 20.49 125-129 23.674999999999997 28.044999999999998 27.47 20.810000000000002 130-134 24.05 27.500000000000004 28.395 20.055 135-139 23.91 27.74 27.915 20.435 140-144 23.825 28.08 28.035 20.06 145-149 23.62 28.065 27.435 20.880000000000003 150-151 24.2 27.8125 27.6375 20.349999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 0.5 22 1.0 23 1.5 24 1.5 25 2.5 26 3.0 27 3.0 28 4.5 29 6.0 30 7.0 31 15.0 32 19.5 33 23.5 34 40.0 35 54.0 36 70.0 37 111.5 38 137.5 39 170.0 40 214.5 41 227.5 42 250.5 43 274.5 44 291.0 45 288.0 46 268.0 47 252.0 48 252.5 49 234.5 50 185.5 51 149.0 52 113.0 53 80.5 54 62.5 55 52.0 56 39.5 57 27.0 58 19.0 59 14.0 60 10.5 61 6.5 62 2.5 63 1.5 64 2.0 65 1.5 66 2.0 67 2.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.20500000000000002 35-39 0.545 40-44 0.605 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.32499999999999996 0.0 0.0 0.0 0.0 106-107 0.3625 0.0 0.0 0.0 0.0 108-109 0.4375 0.0 0.0 0.0 0.0 110-111 0.6499999999999999 0.0 0.0 0.0 0.0 112-113 0.8 0.0 0.0 0.0 0.0 114-115 0.9125 0.0 0.0 0.0 0.0 116-117 0.975 0.0 0.0 0.0 0.0 118-119 1.0625 0.0 0.0 0.0 0.0 120-121 1.15 0.0 0.0 0.0 0.0 122-123 1.2375 0.0 0.0 0.0 0.0 124-125 1.35 0.0 0.0 0.0 0.0 126-127 1.525 0.0 0.0 0.0 0.0 128-129 1.675 0.0 0.0 0.0 0.0 130-131 1.85 0.0 0.0 0.0 0.0 132-133 2.0125 0.0 0.0 0.0 0.0 134-135 2.1500000000000004 0.0 0.0 0.0 0.0 136-137 2.3625 0.0 0.0 0.0 0.0 138-139 2.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 787772 spots for SRR7171927.sra Written 787772 spots for SRR7171927.sra Read 787772 spots for SRR7171927.sra Written 787772 spots for SRR7171927.sra Read 787772 spots for SRR7171927.sra Written 787772 spots for SRR7171927.sra Read 787772 spots for SRR7171927.sra Written 787772 spots for SRR7171927.sra Read 787772 spots for SRR7171927.sra Written 787772 spots for SRR7171927.sra Read 787772 spots for SRR7171927.sra Written 787772 spots for SRR7171927.sra Read 787772 spots for SRR7171927.sra Written 787772 spots for SRR7171927.sra Read 787772 spots for SRR7171927.sra Written 787772 spots for SRR7171927.sra Read 787772 spots for SRR7171927.sra Written 787772 spots for SRR7171927.sra Read 787772 spots for SRR7171927.sra Written 787772 spots for SRR7171927.sra Read 787772 spots for SRR7171927.sra Written 787772 spots for SRR7171927.sra Read 787772 spots for SRR7171927.sra Written 787772 spots for SRR7171927.sra Read 787772 spots for SRR7171927.sra Written 787772 spots for SRR7171927.sra Read 787772 spots for SRR7171927.sra Written 787772 spots for SRR7171927.sra Read 787772 spots for SRR7171927.sra Written 787772 spots for SRR7171927.sra Read 787772 spots for SRR7171927.sra Written 787772 spots for SRR7171927.sra Read 787772 spots for SRR7171927.sra Written 787772 spots for SRR7171927.sra Read 787780 spots for SRR7171927.sra Written 787780 spots for SRR7171927.sra Read 787772 spots for SRR7171927.sra Written 787772 spots for SRR7171927.sra Read 787772 spots for SRR7171927.sra Written 787772 spots for SRR7171927.sra SRR ids: ['SRR7171927.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w_5gzh35 SRR7171927.sra spots: 15755448 blocks: [[1, 787772], [787773, 1575544], [1575545, 2363316], [2363317, 3151088], [3151089, 3938860], [3938861, 4726632], [4726633, 5514404], [5514405, 6302176], [6302177, 7089948], [7089949, 7877720], [7877721, 8665492], [8665493, 9453264], [9453265, 10241036], [10241037, 11028808], [11028809, 11816580], [11816581, 12604352], [12604353, 13392124], [13392125, 14179896], [14179897, 14967668], [14967669, 15755448]] SRR7171927 file size 5317303 SRR7171927 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171927 SRR7171927_1.fastq SRR7171927_2.fastq Input file: SRR7171927_1.fastq Paired file: SRR7171927_2.fastq trimmed: SRR7171927-trimmed-pair1.fastq, SRR7171927-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 01:19:27 2025 >> started Fri Feb 14 01:19:44 2025 >> done (16.994s) 15755448 read pairs processed; of these: 12734 ( 0.08%) short read pairs filtered out after trimming by size control 9335 ( 0.06%) empty read pairs filtered out after trimming by size control 15733379 (99.86%) read pairs available; of these: 7001897 (44.50%) trimmed read pairs available after processing 8731482 (55.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 3 0.00% 21 5 0.00% 22 3 0.00% 23 7 0.00% 24 3 0.00% 25 8 0.00% 26 3 0.00% 27 5 0.00% 28 2 0.00% 29 8 0.00% 30 9 0.00% 31 5 0.00% 32 3 0.00% 33 3 0.00% 34 6 0.00% 35 3 0.00% 36 8 0.00% 37 5 0.00% 38 7 0.00% 39 6 0.00% 40 8 0.00% 41 7 0.00% 42 7 0.00% 43 7 0.00% 44 10 0.00% 45 9 0.00% 46 10 0.00% 47 22 0.00% 48 20 0.00% 49 12 0.00% 50 18 0.00% 51 27 0.00% 52 25 0.00% 53 27 0.00% 54 31 0.00% 55 49 0.00% 56 47 0.00% 57 43 0.00% 58 48 0.00% 59 58 0.00% 60 63 0.00% 61 88 0.00% 62 65 0.00% 63 90 0.00% 64 98 0.00% 65 111 0.00% 66 144 0.00% 67 150 0.00% 68 131 0.00% 69 187 0.00% 70 187 0.00% 71 243 0.00% 72 255 0.00% 73 336 0.00% 74 371 0.00% 75 411 0.00% 76 531 0.00% 77 511 0.00% 78 559 0.00% 79 660 0.00% 80 731 0.00% 81 878 0.01% 82 940 0.01% 83 1204 0.01% 84 1769 0.01% 85 2319 0.01% 86 2480 0.02% 87 2630 0.02% 88 2768 0.02% 89 3053 0.02% 90 3177 0.02% 91 3342 0.02% 92 3601 0.02% 93 3856 0.02% 94 4126 0.03% 95 4375 0.03% 96 4620 0.03% 97 4754 0.03% 98 5120 0.03% 99 5320 0.03% 100 5656 0.04% 101 6283 0.04% 102 6622 0.04% 103 7140 0.05% 104 7558 0.05% 105 8064 0.05% 106 8291 0.05% 107 8883 0.06% 108 9605 0.06% 109 9966 0.06% 110 10685 0.07% 111 11000 0.07% 112 11847 0.08% 113 12440 0.08% 114 13151 0.08% 115 14009 0.09% 116 14744 0.09% 117 15451 0.10% 118 17701 0.11% 119 15404 0.10% 120 17793 0.11% 121 18761 0.12% 122 19526 0.12% 123 20793 0.13% 124 21832 0.14% 125 23099 0.15% 126 24189 0.15% 127 25829 0.16% 128 27212 0.17% 129 28826 0.18% 130 30508 0.19% 131 32425 0.21% 132 34997 0.22% 133 37613 0.24% 134 40353 0.26% 135 40078 0.25% 136 43846 0.28% 137 47568 0.30% 138 52652 0.33% 139 57762 0.37% 140 63566 0.40% 141 71615 0.46% 142 82075 0.52% 143 95290 0.61% 144 112629 0.72% 145 138140 0.88% 146 180061 1.14% 147 255595 1.62% 148 406137 2.58% 149 842232 5.35% 150 3827548 24.33% 151 8731482 55.50% 15733379 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=3.29 fanout-score-rank=25 prefix-density=0.24 prefix-fanout=2.3 sequence=CACTTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.09 sequence-density-rank=23 fanout-score=142.65 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=21.8 sequence=CCACCACCATGGGCTTGGTGGGAATCATCTT criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.98 fanout-score-rank=28 prefix-density=0.25 prefix-fanout=2.9 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=65.61 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.7 sequence=GAAGGATCTGTTTAATTTGAGACAGAAAACATGAAATCCTCCTACACTTTCTTCATTCTTTTCTCACTCTTTTCGTTTGCTAACGTGATCGGTGCTAGAAAAGACACTGGAGAGTATTGGAGAGCTGTCATGAAAGATCAGCCCATGCCAGAAGCAATACA SRR7171927 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 01:20:28 Started mapping on | Feb 14 01:20:28 Finished on | Feb 14 01:22:06 Mapping speed, Million of reads per hour | 577.96 Number of input reads | 15733379 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14959175 Uniquely mapped reads % | 95.08% Average mapped length | 296.55 Number of splices: Total | 15333823 Number of splices: Annotated (sjdb) | 15086739 Number of splices: GT/AG | 15095545 Number of splices: GC/AG | 189150 Number of splices: AT/AC | 11205 Number of splices: Non-canonical | 37923 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 420890 % of reads mapped to multiple loci | 2.68% Number of reads mapped to too many loci | 39388 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.92% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 366860 366860 366860 N_multimapping 420890 420890 420890 N_noFeature 292664 14824758 356445 N_ambiguous 148065 908 76713 UnstrandedReadsAssigned:14518446 PositiveStrandReadsAssigned:133509 NegativeStrandReadsAssigned:14526017 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171927 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171927-trimmed-pair1.fastq SRR7171927-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,733,379 reads, 14,347,076 reads pseudoaligned [quant] estimated average fragment length: 271.221 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,071 rounds 52401 SRR7171927.ke.tsv 34699 SRR7171927.se.tsv 87100 total ==> SRR7171927.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1747.78 780 30.1972 Potri.005G024800.1.v4.1 1035 764.779 189 16.7219 Potri.004G059700.1.v4.1 961 690.823 13 1.27331 Potri.007G009000.2.v4.1 1416 1145.78 0 0 Potri.003G141000.2.v4.1 2943 2672.78 376 9.51882 Potri.016G087400.1.v4.1 270 67.5238 830 831.725 Potri.015G069301.1.v4.1 564 301.717 0 0 Potri.010G195200.1.v4.1 1773 1502.78 70 3.15182 Potri.012G127500.1.v4.1 977 706.804 1786 170.978 ==> SRR7171927.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 40 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 323 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 135 SRR7171927 completed mapping pipeline successfully