Starting /dee2/code/volunteer_pipeline.sh SRR7171928 current disk space = 3088955052032 free memory = 1446112796 SRR7171928 SRAfilesize ee47f59e5ad31ea407c966d62828680d SRR7171928.sra SRR7171928.sra file validated SRR7171928 is paired end SRR7171928 is conventional basespace SRR7171928 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171928_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.327 25.0 18.0 32.0 18.0 33.0 2 28.943 29.0 27.0 33.0 25.0 33.0 3 31.551 33.0 31.0 33.0 29.0 33.0 4 32.25725 33.0 33.0 33.0 31.0 33.0 5 32.71175 33.0 33.0 33.0 32.0 34.0 6 36.829 38.0 37.0 38.0 35.0 38.0 7 37.30575 38.0 38.0 38.0 36.0 38.0 8 37.38275 38.0 38.0 38.0 37.0 38.0 9 37.4885 38.0 38.0 38.0 37.0 38.0 10-14 37.5152 38.0 38.0 38.0 37.0 38.0 15-19 37.533 38.0 38.0 38.0 37.6 38.0 20-24 37.4978 38.0 38.0 38.0 37.2 38.0 25-29 37.451649999999994 38.0 38.0 38.0 37.0 38.0 30-34 37.39319999999999 38.0 38.0 38.0 37.0 38.0 35-39 37.37375 38.0 38.0 38.0 37.0 38.0 40-44 37.3356 38.0 38.0 38.0 37.0 38.0 45-49 37.29335 38.0 38.0 38.0 37.0 38.0 50-54 37.19965 38.0 38.0 38.0 36.4 38.0 55-59 37.189049999999995 38.0 38.0 38.0 36.0 38.0 60-64 37.08545 38.0 38.0 38.0 36.0 38.0 65-69 37.0621 38.0 38.0 38.0 36.0 38.0 70-74 37.015550000000005 38.0 38.0 38.0 36.0 38.0 75-79 36.92059999999999 38.0 38.0 38.0 35.0 38.0 80-84 36.79105 38.0 38.0 38.0 35.0 38.0 85-89 36.7632 38.0 38.0 38.0 34.8 38.0 90-94 36.63865 38.0 38.0 38.0 34.2 38.0 95-99 36.479850000000006 38.0 38.0 38.0 34.0 38.0 100-104 36.3952 38.0 37.6 38.0 34.0 38.0 105-109 36.10945 38.0 37.0 38.0 33.2 38.0 110-114 35.969950000000004 38.0 37.0 38.0 33.0 38.0 115-119 35.93895 38.0 37.0 38.0 32.6 38.0 120-124 35.7676 38.0 37.0 38.0 31.2 38.0 125-129 35.465349999999994 38.0 36.2 38.0 30.8 38.0 130-134 35.0573 38.0 35.8 38.0 28.2 38.0 135-139 34.88065 38.0 35.2 38.0 28.0 38.0 140-144 34.46315 38.0 35.0 38.0 26.4 38.0 145-149 33.8713 38.0 35.0 38.0 22.6 38.0 150-151 30.526 36.5 29.5 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 2.0 15 0.0 16 3.0 17 3.0 18 3.0 19 8.0 20 5.0 21 2.0 22 7.0 23 2.0 24 6.0 25 16.0 26 13.0 27 14.0 28 21.0 29 33.0 30 33.0 31 47.0 32 74.0 33 110.0 34 173.0 35 335.0 36 857.0 37 2232.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.85 16.475 10.35 31.324999999999996 2 19.15 21.45 37.425000000000004 21.975 3 17.9 28.425 27.925 25.75 4 21.875 35.099999999999994 23.1 19.925 5 22.225 36.5 24.0 17.275 6 17.675 37.025000000000006 24.5 20.8 7 12.675 20.65 45.775 20.9 8 17.75 23.225 29.049999999999997 29.975 9 17.625 23.625 31.525 27.224999999999998 10-14 20.11 29.49 26.52 23.880000000000003 15-19 19.505 29.4 27.900000000000002 23.195 20-24 19.825 28.299999999999997 28.02 23.855 25-29 19.305 29.565 27.500000000000004 23.630000000000003 30-34 19.715 28.494999999999997 28.17 23.62 35-39 19.56 29.21 27.61 23.62 40-44 20.01 29.025000000000002 27.49 23.474999999999998 45-49 19.765 28.975 27.99 23.27 50-54 19.365 28.76 27.77 24.104999999999997 55-59 19.935 28.945 27.37 23.75 60-64 19.91 28.665000000000003 27.52 23.905 65-69 19.99 28.785 27.76 23.465 70-74 19.455 28.970000000000002 27.815 23.76 75-79 20.349999999999998 29.165000000000003 27.195000000000004 23.29 80-84 19.6 28.860000000000003 27.6 23.94 85-89 20.375 28.49 27.685 23.45 90-94 20.115 28.485 28.175 23.225 95-99 20.535 28.395 27.884999999999998 23.185 100-104 20.419999999999998 29.145 27.894999999999996 22.54 105-109 20.74 28.685 27.785 22.79 110-114 20.21 28.910000000000004 27.439999999999998 23.44 115-119 20.599999999999998 28.46 28.095 22.845 120-124 20.32 29.195 27.310000000000002 23.175 125-129 20.549999999999997 27.985 28.04 23.425 130-134 19.91 28.935 27.985 23.169999999999998 135-139 20.78 28.694999999999997 27.35 23.175 140-144 20.705000000000002 28.475 27.54 23.28 145-149 20.73 28.32 27.275 23.674999999999997 150-151 20.3875 28.512500000000003 27.775 23.325000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 2.0 25 4.5 26 6.5 27 7.0 28 10.0 29 15.5 30 20.5 31 26.0 32 35.0 33 52.0 34 60.5 35 78.0 36 103.5 37 119.5 38 147.0 39 170.0 40 191.0 41 237.5 42 267.0 43 272.0 44 273.5 45 265.5 46 276.0 47 261.0 48 217.0 49 183.5 50 161.0 51 135.5 52 98.0 53 78.5 54 61.0 55 40.0 56 27.5 57 25.0 58 18.5 59 12.5 60 13.0 61 7.0 62 5.0 63 5.5 64 4.0 65 2.0 66 1.0 67 1.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.6375 0.0 0.0 0.0 0.0 108-109 0.7749999999999999 0.0 0.0 0.0 0.0 110-111 0.925 0.0 0.0 0.0 0.0 112-113 1.0125 0.0 0.0 0.0 0.0 114-115 1.1375000000000002 0.0 0.0 0.0 0.0 116-117 1.2375 0.0 0.0 0.0 0.0 118-119 1.35 0.0 0.0 0.0 0.0 120-121 1.475 0.0 0.0 0.0 0.0 122-123 1.6625 0.0 0.0 0.0 0.0 124-125 1.7625000000000002 0.0 0.0 0.0 0.0 126-127 1.975 0.0 0.0 0.0 0.0 128-129 2.1625 0.0 0.0 0.0 0.0 130-131 2.275 0.0 0.0 0.0 0.0 132-133 2.4 0.0 0.0 0.0 0.0 134-135 2.5625 0.0 0.0 0.0 0.0 136-137 2.875 0.0 0.0 0.0 0.0 138-139 3.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171928 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171928_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0925 33.0 33.0 34.0 32.0 34.0 2 33.151 34.0 33.0 34.0 33.0 34.0 3 33.2 34.0 33.0 34.0 33.0 34.0 4 33.22925 34.0 33.0 34.0 33.0 34.0 5 33.1925 34.0 33.0 34.0 33.0 34.0 6 37.32725 38.0 38.0 38.0 37.0 38.0 7 37.38875 38.0 38.0 38.0 37.0 38.0 8 37.347 38.0 38.0 38.0 37.0 38.0 9 37.4745 38.0 38.0 38.0 38.0 38.0 10-14 37.40495 38.0 38.0 38.0 37.6 38.0 15-19 37.3734 38.0 38.0 38.0 37.2 38.0 20-24 37.33945 38.0 38.0 38.0 37.0 38.0 25-29 37.3651 38.0 38.0 38.0 37.0 38.0 30-34 37.240899999999996 38.0 38.0 38.0 37.4 38.0 35-39 36.92320000000001 38.0 38.0 38.0 36.8 38.0 40-44 36.8114 38.0 38.0 38.0 36.6 38.0 45-49 37.21695 38.0 38.0 38.0 37.0 38.0 50-54 37.21545 38.0 38.0 38.0 37.0 38.0 55-59 37.18985 38.0 38.0 38.0 37.0 38.0 60-64 37.1504 38.0 38.0 38.0 36.8 38.0 65-69 37.0938 38.0 38.0 38.0 36.2 38.0 70-74 37.0258 38.0 38.0 38.0 36.0 38.0 75-79 37.024300000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.9174 38.0 38.0 38.0 36.0 38.0 85-89 36.79025 38.0 38.0 38.0 35.2 38.0 90-94 36.74575 38.0 38.0 38.0 35.0 38.0 95-99 36.56145 38.0 38.0 38.0 34.8 38.0 100-104 36.51175 38.0 38.0 38.0 34.0 38.0 105-109 36.379999999999995 38.0 38.0 38.0 34.0 38.0 110-114 36.3187 38.0 38.0 38.0 34.0 38.0 115-119 36.08325 38.0 37.4 38.0 33.2 38.0 120-124 35.95475 38.0 37.0 38.0 33.0 38.0 125-129 35.69115 38.0 36.8 38.0 31.4 38.0 130-134 35.46355 38.0 36.0 38.0 30.4 38.0 135-139 35.171749999999996 38.0 36.0 38.0 28.8 38.0 140-144 34.7931 38.0 35.2 38.0 28.2 38.0 145-149 34.236000000000004 38.0 35.0 38.0 26.0 38.0 150-151 30.585124999999998 36.5 29.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 1.0 5 1.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 2.0 12 0.0 13 2.0 14 2.0 15 1.0 16 1.0 17 0.0 18 5.0 19 8.0 20 3.0 21 1.0 22 5.0 23 6.0 24 7.0 25 13.0 26 12.0 27 20.0 28 27.0 29 23.0 30 33.0 31 39.0 32 79.0 33 99.0 34 131.0 35 238.0 36 640.0 37 2596.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.25 17.45 12.225 24.075 2 22.85 25.650000000000002 34.675 16.825000000000003 3 19.8 27.025 32.5 20.674999999999997 4 23.925 35.949999999999996 21.725 18.4 5 23.200000000000003 36.199999999999996 22.05 18.55 6 17.525 37.4 26.025 19.05 7 17.849999999999998 17.325 42.55 22.275 8 20.225 22.425 28.725 28.625 9 21.975 24.675 28.525 24.825 10-14 22.73 28.165000000000003 26.924999999999997 22.18 15-19 22.175 27.515 29.04 21.27 20-24 23.195 27.474999999999998 27.97 21.36 25-29 22.81 27.96 28.294999999999998 20.935000000000002 30-34 22.592778335005015 27.763289869608826 28.480441323971917 21.163490471414242 35-39 22.947347185797863 28.40427678031067 27.60238047205971 21.045995561831752 40-44 22.759177902338028 27.995758218451748 28.63202545068929 20.61303842852093 45-49 23.09 28.084999999999997 27.96 20.865000000000002 50-54 22.33 28.075 28.715000000000003 20.880000000000003 55-59 22.650000000000002 28.77 27.905 20.674999999999997 60-64 22.96 28.215 28.07 20.755000000000003 65-69 22.675 28.005000000000003 28.625 20.695 70-74 23.07 28.105000000000004 28.285 20.54 75-79 23.13 27.845 28.705000000000002 20.32 80-84 22.52 28.18 28.189999999999998 21.11 85-89 23.415 27.98 28.165000000000003 20.44 90-94 23.16 27.55 28.605000000000004 20.685000000000002 95-99 23.025000000000002 28.134999999999998 27.62 21.22 100-104 23.555 28.144999999999996 27.975 20.325 105-109 23.794999999999998 27.58 28.475 20.150000000000002 110-114 23.645 28.29 27.950000000000003 20.115 115-119 23.775 27.775 28.395 20.055 120-124 23.799999999999997 28.050000000000004 27.689999999999998 20.46 125-129 23.565 28.365000000000002 28.16 19.91 130-134 23.615 28.12 28.155 20.11 135-139 23.84 28.105000000000004 28.285 19.77 140-144 23.76 28.4 28.299999999999997 19.54 145-149 24.04 28.285 27.79 19.885 150-151 23.7 28.0625 28.537499999999998 19.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 0.5 24 1.5 25 2.0 26 3.5 27 6.5 28 7.0 29 7.5 30 9.0 31 11.5 32 19.0 33 31.5 34 43.0 35 59.0 36 94.5 37 122.0 38 147.5 39 185.0 40 226.0 41 253.0 42 255.5 43 272.0 44 280.5 45 280.0 46 291.5 47 273.5 48 235.0 49 198.0 50 158.0 51 126.0 52 103.5 53 80.5 54 59.0 55 42.5 56 36.0 57 28.5 58 12.5 59 6.5 60 6.5 61 6.0 62 4.5 63 3.5 64 3.5 65 2.0 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.3 35-39 0.86 40-44 0.985 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64841788046208 99.2 2 0.25113008538422904 0.5 3 0.10045203415369162 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.6499999999999999 0.0 0.0 0.0 0.0 108-109 0.8125 0.0 0.0 0.0 0.0 110-111 0.9875 0.0 0.0 0.0 0.0 112-113 1.0875 0.0 0.0 0.0 0.0 114-115 1.2000000000000002 0.0 0.0 0.0 0.0 116-117 1.2875 0.0 0.0 0.0 0.0 118-119 1.4 0.0 0.0 0.0 0.0 120-121 1.5375 0.0 0.0 0.0 0.0 122-123 1.7375 0.0 0.0 0.0 0.0 124-125 1.8375 0.0 0.0 0.0 0.0 126-127 2.05 0.0 0.0 0.0 0.0 128-129 2.2625 0.0 0.0 0.0 0.0 130-131 2.3875 0.0 0.0 0.0 0.0 132-133 2.5 0.0 0.0 0.0 0.0 134-135 2.6625 0.0 0.0 0.0 0.0 136-137 2.9749999999999996 0.0 0.0 0.0 0.0 138-139 3.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATTCAA 10 0.006830828 145.0 5 >>END_MODULE Read 980151 spots for SRR7171928.sra Written 980151 spots for SRR7171928.sra Read 980151 spots for SRR7171928.sra Written 980151 spots for SRR7171928.sra Read 980151 spots for SRR7171928.sra Written 980151 spots for SRR7171928.sra Read 980151 spots for SRR7171928.sra Written 980151 spots for SRR7171928.sra Read 980151 spots for SRR7171928.sra Written 980151 spots for SRR7171928.sra Read 980151 spots for SRR7171928.sra Written 980151 spots for SRR7171928.sra Read 980151 spots for SRR7171928.sra Written 980151 spots for SRR7171928.sra Read 980151 spots for SRR7171928.sra Written 980151 spots for SRR7171928.sra Read 980151 spots for SRR7171928.sra Written 980151 spots for SRR7171928.sra Read 980151 spots for SRR7171928.sra Written 980151 spots for SRR7171928.sra Read 980151 spots for SRR7171928.sra Written 980151 spots for SRR7171928.sra Read 980151 spots for SRR7171928.sra Written 980151 spots for SRR7171928.sra Read 980151 spots for SRR7171928.sra Written 980151 spots for SRR7171928.sra Read 980151 spots for SRR7171928.sra Written 980151 spots for SRR7171928.sra Read 980169 spots for SRR7171928.sra Written 980169 spots for SRR7171928.sra Read 980151 spots for SRR7171928.sra Written 980151 spots for SRR7171928.sra Read 980151 spots for SRR7171928.sra Written 980151 spots for SRR7171928.sra Read 980151 spots for SRR7171928.sra Written 980151 spots for SRR7171928.sra Read 980151 spots for SRR7171928.sra Written 980151 spots for SRR7171928.sra Read 980151 spots for SRR7171928.sra Written 980151 spots for SRR7171928.sra SRR ids: ['SRR7171928.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q4zb5hqx SRR7171928.sra spots: 19603038 blocks: [[1, 980151], [980152, 1960302], [1960303, 2940453], [2940454, 3920604], [3920605, 4900755], [4900756, 5880906], [5880907, 6861057], [6861058, 7841208], [7841209, 8821359], [8821360, 9801510], [9801511, 10781661], [10781662, 11761812], [11761813, 12741963], [12741964, 13722114], [13722115, 14702265], [14702266, 15682416], [15682417, 16662567], [16662568, 17642718], [17642719, 18622869], [18622870, 19603038]] SRR7171928 file size 6621125 SRR7171928 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171928 SRR7171928_1.fastq SRR7171928_2.fastq Input file: SRR7171928_1.fastq Paired file: SRR7171928_2.fastq trimmed: SRR7171928-trimmed-pair1.fastq, SRR7171928-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 01:29:56 2025 >> started Fri Feb 14 01:30:28 2025 >> done (32.232s) 19603038 read pairs processed; of these: 15884 ( 0.08%) short read pairs filtered out after trimming by size control 10020 ( 0.05%) empty read pairs filtered out after trimming by size control 19577134 (99.87%) read pairs available; of these: 8563237 (43.74%) trimmed read pairs available after processing 11013897 (56.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 5 0.00% 20 5 0.00% 21 5 0.00% 22 3 0.00% 23 3 0.00% 24 7 0.00% 25 2 0.00% 26 1 0.00% 27 7 0.00% 28 4 0.00% 29 2 0.00% 30 5 0.00% 31 2 0.00% 32 7 0.00% 33 7 0.00% 34 8 0.00% 35 6 0.00% 36 8 0.00% 37 5 0.00% 38 4 0.00% 39 6 0.00% 40 5 0.00% 41 4 0.00% 42 5 0.00% 43 10 0.00% 44 10 0.00% 45 5 0.00% 46 11 0.00% 47 17 0.00% 48 21 0.00% 49 18 0.00% 50 22 0.00% 51 31 0.00% 52 21 0.00% 53 34 0.00% 54 36 0.00% 55 38 0.00% 56 49 0.00% 57 58 0.00% 58 49 0.00% 59 55 0.00% 60 79 0.00% 61 78 0.00% 62 89 0.00% 63 112 0.00% 64 130 0.00% 65 138 0.00% 66 173 0.00% 67 172 0.00% 68 186 0.00% 69 236 0.00% 70 295 0.00% 71 320 0.00% 72 353 0.00% 73 419 0.00% 74 478 0.00% 75 553 0.00% 76 646 0.00% 77 734 0.00% 78 774 0.00% 79 886 0.00% 80 1008 0.01% 81 1167 0.01% 82 1307 0.01% 83 1570 0.01% 84 2334 0.01% 85 2997 0.02% 86 3073 0.02% 87 3511 0.02% 88 3656 0.02% 89 3931 0.02% 90 4093 0.02% 91 4424 0.02% 92 4692 0.02% 93 4919 0.03% 94 5368 0.03% 95 5689 0.03% 96 6075 0.03% 97 6475 0.03% 98 6730 0.03% 99 7247 0.04% 100 7809 0.04% 101 8351 0.04% 102 8727 0.04% 103 9525 0.05% 104 10035 0.05% 105 10697 0.05% 106 11381 0.06% 107 11788 0.06% 108 12581 0.06% 109 12923 0.07% 110 13906 0.07% 111 14587 0.07% 112 15705 0.08% 113 16452 0.08% 114 17085 0.09% 115 18419 0.09% 116 19033 0.10% 117 20088 0.10% 118 22833 0.12% 119 20116 0.10% 120 22817 0.12% 121 24034 0.12% 122 25279 0.13% 123 26166 0.13% 124 28035 0.14% 125 29050 0.15% 126 30787 0.16% 127 32327 0.17% 128 33627 0.17% 129 35585 0.18% 130 37499 0.19% 131 39924 0.20% 132 42591 0.22% 133 45270 0.23% 134 48873 0.25% 135 49238 0.25% 136 53324 0.27% 137 58348 0.30% 138 63381 0.32% 139 69244 0.35% 140 76300 0.39% 141 85286 0.44% 142 97191 0.50% 143 112487 0.57% 144 133749 0.68% 145 164594 0.84% 146 214585 1.10% 147 304791 1.56% 148 485373 2.48% 149 1008195 5.15% 150 4715527 24.09% 151 11013897 56.26% 19577134 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=3.67 fanout-score-rank=20 prefix-density=0.39 prefix-fanout=3.2 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.04 sequence-density-rank=36 fanout-score=18.86 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=4.2 sequence=TTGTCAATGGTATCAGAGCTCTCCACCTCCAAGGTGATGGTCTT criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=31 prefix-density=0.67 prefix-fanout=2.3 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=93.76 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=11.5 sequence=AAGAAAAACAAAAAAGAAATGGATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGCATTAGCAGAAAATGAAGAAGACCCTGGTCTTGTTATGAACTTTTACAAGGATACATGCCCTCAAGCTGAGGACATTGTCAAAGAACAAGTTAGACTCCTTTACAAGAGACACAAAAACACTGCATTTTCTTGGCTAAGAAACATCTTCCATGACTGTGCTGTTCAGTCATGTGATGCTTCACTGCTGCTGGACTCAACAAGGAGGACCTTGTCCGAGAAGGAGACAGACAGGAGCTTTGGCCTCAGGAACTTTAGATACTTTGACGATATCAAAGAAGCTGTTGAAAGAGAGTGTCCTGGAGTCGTTTCCTGTGCTGATATTCTTGTCCTGTCTGCTAGAGATGGCATTGTTTCGCTAGGAGGACCTCATATCCCTCTCAAAACTGGAAGAAGGGATGGCAGGAAGAGCAGAGCAGATGTGATCGAGG SRR7171928 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 01:31:14 Started mapping on | Feb 14 01:31:14 Finished on | Feb 14 01:33:44 Mapping speed, Million of reads per hour | 469.85 Number of input reads | 19577134 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 18204158 Uniquely mapped reads % | 92.99% Average mapped length | 296.39 Number of splices: Total | 17928948 Number of splices: Annotated (sjdb) | 17552890 Number of splices: GT/AG | 17628837 Number of splices: GC/AG | 235807 Number of splices: AT/AC | 14754 Number of splices: Non-canonical | 49550 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 439868 % of reads mapped to multiple loci | 2.25% Number of reads mapped to too many loci | 36373 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.50% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 949599 949599 949599 N_multimapping 439868 439868 439868 N_noFeature 591624 18010237 672864 N_ambiguous 217867 979 104593 UnstrandedReadsAssigned:17394667 PositiveStrandReadsAssigned:192942 NegativeStrandReadsAssigned:17426701 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171928 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171928-trimmed-pair1.fastq SRR7171928-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,577,134 reads, 17,244,201 reads pseudoaligned [quant] estimated average fragment length: 266.201 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,128 rounds 52401 SRR7171928.ke.tsv 34699 SRR7171928.se.tsv 87100 total ==> SRR7171928.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1752.8 1483 47.7081 Potri.005G024800.1.v4.1 1035 769.799 251 18.3857 Potri.004G059700.1.v4.1 961 695.836 24 1.94486 Potri.007G009000.2.v4.1 1416 1150.8 0 0 Potri.003G141000.2.v4.1 2943 2677.8 812.212 17.1031 Potri.016G087400.1.v4.1 270 69.7733 912.601 737.522 Potri.015G069301.1.v4.1 564 305.987 0 0 Potri.010G195200.1.v4.1 1773 1507.8 600 22.4384 Potri.012G127500.1.v4.1 977 711.809 8674 687.13 ==> SRR7171928.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 169 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 746 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 395 SRR7171928 completed mapping pipeline successfully