Starting /dee2/code/volunteer_pipeline.sh SRR7171929 current disk space = 3088922832896 free memory = 1403735864 SRR7171929 SRAfilesize 77998bb19f45d5094cf5728e75f19c46 SRR7171929.sra SRR7171929.sra file validated SRR7171929 is paired end SRR7171929 is conventional basespace SRR7171929 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171929_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.4685 32.0 18.0 33.0 18.0 34.0 2 30.77025 31.0 29.0 33.0 27.0 33.0 3 31.17925 33.0 31.0 33.0 28.0 33.0 4 32.2525 33.0 33.0 33.0 31.0 34.0 5 32.62025 33.0 33.0 33.0 32.0 34.0 6 35.8745 37.0 36.0 38.0 33.0 38.0 7 37.3065 38.0 38.0 38.0 36.0 38.0 8 37.40825 38.0 38.0 38.0 37.0 38.0 9 37.474 38.0 38.0 38.0 37.0 38.0 10-14 37.50325 38.0 38.0 38.0 37.0 38.0 15-19 37.55575 38.0 38.0 38.0 37.2 38.0 20-24 37.5262 38.0 38.0 38.0 37.4 38.0 25-29 37.48545 38.0 38.0 38.0 37.2 38.0 30-34 37.4824 38.0 38.0 38.0 37.0 38.0 35-39 37.482699999999994 38.0 38.0 38.0 37.2 38.0 40-44 37.4276 38.0 38.0 38.0 37.0 38.0 45-49 37.372499999999995 38.0 38.0 38.0 37.0 38.0 50-54 37.33515 38.0 38.0 38.0 37.0 38.0 55-59 37.2182 38.0 38.0 38.0 36.2 38.0 60-64 37.1408 38.0 38.0 38.0 36.0 38.0 65-69 37.07225 38.0 38.0 38.0 36.0 38.0 70-74 37.091550000000005 38.0 38.0 38.0 36.0 38.0 75-79 37.0275 38.0 38.0 38.0 36.0 38.0 80-84 36.9301 38.0 38.0 38.0 35.6 38.0 85-89 36.897450000000006 38.0 38.0 38.0 35.2 38.0 90-94 36.712149999999994 38.0 38.0 38.0 34.6 38.0 95-99 36.5807 38.0 38.0 38.0 34.0 38.0 100-104 36.49375 38.0 38.0 38.0 34.0 38.0 105-109 36.3354 38.0 37.8 38.0 34.0 38.0 110-114 36.32090000000001 38.0 37.2 38.0 34.0 38.0 115-119 36.06005 38.0 37.0 38.0 33.0 38.0 120-124 36.019800000000004 38.0 37.0 38.0 33.2 38.0 125-129 35.80915 38.0 36.8 38.0 32.2 38.0 130-134 35.4597 38.0 36.0 38.0 30.4 38.0 135-139 35.237449999999995 38.0 36.0 38.0 30.0 38.0 140-144 34.814 38.0 35.2 38.0 28.0 38.0 145-149 34.359249999999996 38.0 35.0 38.0 26.6 38.0 150-151 31.306125 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 0.0 17 1.0 18 1.0 19 3.0 20 4.0 21 4.0 22 6.0 23 7.0 24 11.0 25 13.0 26 11.0 27 15.0 28 17.0 29 29.0 30 26.0 31 58.0 32 69.0 33 86.0 34 144.0 35 269.0 36 769.0 37 2455.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.8097024256064 15.178794698674668 10.802700675168792 35.20880220055014 2 19.6 20.549999999999997 38.425 21.425 3 19.35 25.7 27.250000000000004 27.700000000000003 4 22.95 34.2 21.875 20.974999999999998 5 22.400000000000002 35.55 23.875 18.175 6 17.925 35.625 25.374999999999996 21.075 7 13.55 20.95 46.625 18.875 8 17.599999999999998 23.75 29.475 29.175 9 18.725 22.925 31.374999999999996 26.974999999999998 10-14 19.895 29.044999999999998 27.134999999999998 23.925 15-19 20.175 28.225 28.01 23.59 20-24 20.24 28.52 27.355 23.885 25-29 20.31 28.155 28.115000000000002 23.419999999999998 30-34 20.445 28.04 27.755000000000003 23.76 35-39 19.99 28.825 27.650000000000002 23.535 40-44 20.715 28.060000000000002 28.310000000000002 22.915 45-49 20.085 27.935 28.26 23.72 50-54 20.19 27.975 28.115000000000002 23.72 55-59 19.93 28.494999999999997 28.12 23.455000000000002 60-64 20.285 28.355000000000004 27.925 23.435 65-69 20.215 27.99 27.79 24.005000000000003 70-74 20.51 27.985 27.87 23.635 75-79 20.455000000000002 27.63 28.015 23.9 80-84 20.1 28.225 27.089999999999996 24.585 85-89 20.205000000000002 27.88 28.194999999999997 23.72 90-94 20.560000000000002 28.205000000000002 27.575 23.66 95-99 20.810000000000002 27.950000000000003 27.810000000000002 23.43 100-104 20.45 28.110000000000003 28.08 23.36 105-109 20.125 28.18 27.63 24.065 110-114 20.724999999999998 27.785 28.110000000000003 23.380000000000003 115-119 20.985 28.185 27.250000000000004 23.580000000000002 120-124 20.605 28.675 27.41 23.31 125-129 20.855 27.425 27.939999999999998 23.78 130-134 21.075 28.065 27.16 23.7 135-139 20.52 28.015 27.375 24.09 140-144 21.23 27.63 27.455000000000002 23.685000000000002 145-149 21.62 27.96 27.125 23.294999999999998 150-151 20.674999999999997 26.825 27.712500000000002 24.7875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 1.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.0 23 2.0 24 1.5 25 3.0 26 4.0 27 3.5 28 7.5 29 11.0 30 16.5 31 25.0 32 32.0 33 34.5 34 50.5 35 80.0 36 94.0 37 99.0 38 131.5 39 174.0 40 199.0 41 226.5 42 235.0 43 238.5 44 265.5 45 272.0 46 267.5 47 269.5 48 232.5 49 194.0 50 183.0 51 151.0 52 116.0 53 89.5 54 66.0 55 52.5 56 42.5 57 32.5 58 22.0 59 17.5 60 13.0 61 7.5 62 7.0 63 7.0 64 5.5 65 4.5 66 3.0 67 2.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.5874999999999999 0.0 0.0 0.0 0.0 106-107 0.6 0.0 0.0 0.0 0.0 108-109 0.6375 0.0 0.0 0.0 0.0 110-111 0.7625 0.0 0.0 0.0 0.0 112-113 0.9125000000000001 0.0 0.0 0.0 0.0 114-115 1.0750000000000002 0.0 0.0 0.0 0.0 116-117 1.2125 0.0 0.0 0.0 0.0 118-119 1.375 0.0 0.0 0.0 0.0 120-121 1.575 0.0 0.0 0.0 0.0 122-123 1.8375 0.0 0.0 0.0 0.0 124-125 1.9500000000000002 0.0 0.0 0.0 0.0 126-127 2.1625 0.0 0.0 0.0 0.0 128-129 2.2625 0.0 0.0 0.0 0.0 130-131 2.5 0.0 0.0 0.0 0.0 132-133 2.7249999999999996 0.0 0.0 0.0 0.0 134-135 3.0875 0.0 0.0 0.0 0.0 136-137 3.4000000000000004 0.0 0.0 0.0 0.0 138-139 3.7125000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGAAGT 10 0.006830828 145.0 2 TAGCGTC 10 0.006830828 145.0 145 >>END_MODULE SRR7171929 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171929_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.05925 33.0 33.0 34.0 32.0 34.0 2 33.1595 34.0 33.0 34.0 33.0 34.0 3 33.2275 34.0 33.0 34.0 33.0 34.0 4 33.174 34.0 33.0 34.0 33.0 34.0 5 33.1725 34.0 33.0 34.0 33.0 34.0 6 37.35825 38.0 38.0 38.0 37.0 38.0 7 37.411 38.0 38.0 38.0 37.0 38.0 8 37.29175 38.0 38.0 38.0 37.0 38.0 9 37.25325 38.0 38.0 38.0 37.0 38.0 10-14 37.282149999999994 38.0 38.0 38.0 37.0 38.0 15-19 37.21295 38.0 38.0 38.0 37.0 38.0 20-24 37.20815 38.0 38.0 38.0 37.0 38.0 25-29 37.1705 38.0 38.0 38.0 37.0 38.0 30-34 37.1672 38.0 38.0 38.0 37.0 38.0 35-39 36.9639 38.0 38.0 38.0 36.4 38.0 40-44 36.6639 38.0 38.0 38.0 36.0 38.0 45-49 37.112 38.0 38.0 38.0 36.4 38.0 50-54 37.08115 38.0 38.0 38.0 36.6 38.0 55-59 37.03955 38.0 38.0 38.0 36.2 38.0 60-64 36.98315 38.0 38.0 38.0 36.0 38.0 65-69 36.96205 38.0 38.0 38.0 36.0 38.0 70-74 36.8301 38.0 38.0 38.0 36.0 38.0 75-79 36.8152 38.0 38.0 38.0 35.8 38.0 80-84 36.76475 38.0 38.0 38.0 35.6 38.0 85-89 36.6271 38.0 38.0 38.0 34.6 38.0 90-94 36.49045 38.0 38.0 38.0 34.4 38.0 95-99 36.416 38.0 38.0 38.0 34.0 38.0 100-104 36.2785 38.0 38.0 38.0 34.0 38.0 105-109 36.1221 38.0 37.6 38.0 33.4 38.0 110-114 35.89755 38.0 37.2 38.0 33.0 38.0 115-119 35.7784 38.0 37.0 38.0 32.0 38.0 120-124 35.67765 38.0 37.0 38.0 31.4 38.0 125-129 35.4727 38.0 36.0 38.0 31.0 38.0 130-134 35.12925 38.0 36.0 38.0 29.4 38.0 135-139 34.828950000000006 38.0 35.6 38.0 28.0 38.0 140-144 34.3921 38.0 35.0 38.0 26.2 38.0 145-149 33.78770000000001 38.0 34.8 38.0 23.0 38.0 150-151 30.596375 36.5 29.5 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 4.0 4 2.0 5 0.0 6 1.0 7 1.0 8 0.0 9 2.0 10 3.0 11 0.0 12 0.0 13 3.0 14 0.0 15 4.0 16 4.0 17 1.0 18 2.0 19 5.0 20 4.0 21 7.0 22 7.0 23 8.0 24 15.0 25 14.0 26 16.0 27 16.0 28 26.0 29 29.0 30 45.0 31 55.0 32 69.0 33 81.0 34 126.0 35 289.0 36 669.0 37 2490.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.025 16.875 14.625 26.474999999999998 2 23.525 24.85 33.475 18.15 3 21.775 27.900000000000002 29.425 20.9 4 24.75 35.125 21.2 18.925 5 23.849999999999998 38.125 20.825 17.2 6 17.974999999999998 38.475 24.0 19.55 7 18.7 18.45 40.65 22.2 8 21.475 23.25 27.575 27.700000000000003 9 22.95 24.375 27.900000000000002 24.775 10-14 23.165 28.720000000000002 26.105 22.009999999999998 15-19 23.044999999999998 28.12 27.735 21.099999999999998 20-24 23.03 28.449999999999996 26.88 21.64 25-29 22.845 28.065 27.515 21.575 30-34 23.02 28.03 27.405 21.545 35-39 23.08504752803903 27.91832218478097 27.55620379218428 21.440426494995727 40-44 22.772577789021 28.646597520870227 27.321022008601066 21.25980268150772 45-49 23.345 27.965 27.200000000000003 21.490000000000002 50-54 23.244999999999997 28.599999999999998 27.66 20.495 55-59 23.59 27.48 27.88 21.05 60-64 23.06 28.415000000000003 27.415 21.11 65-69 23.485 28.28 27.36 20.875 70-74 23.799999999999997 27.384999999999998 27.6 21.215 75-79 23.525 28.134999999999998 27.52 20.82 80-84 23.369999999999997 28.249999999999996 27.27 21.11 85-89 23.96 27.639999999999997 27.66 20.74 90-94 23.815 28.189999999999998 27.425 20.57 95-99 23.9 27.87 27.975 20.255000000000003 100-104 24.335 28.439999999999998 26.75 20.474999999999998 105-109 24.29 27.515 27.55 20.645 110-114 23.525 28.535 27.224999999999998 20.715 115-119 23.845 28.139999999999997 27.13 20.885 120-124 23.73 28.07 27.395000000000003 20.805 125-129 23.919999999999998 28.244999999999997 27.089999999999996 20.745 130-134 24.275 27.515 27.46 20.75 135-139 23.849999999999998 27.715 27.825 20.61 140-144 23.73 28.405 27.41 20.455000000000002 145-149 24.98 28.035 26.995 19.99 150-151 24.212500000000002 28.425 26.900000000000002 20.4625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.5 21 0.5 22 0.5 23 0.5 24 1.0 25 2.5 26 4.0 27 3.0 28 2.5 29 3.5 30 6.5 31 14.5 32 20.0 33 29.0 34 35.5 35 50.5 36 77.0 37 106.0 38 126.5 39 143.5 40 192.0 41 231.5 42 253.0 43 280.0 44 296.5 45 295.0 46 277.5 47 256.0 48 240.5 49 216.5 50 177.0 51 145.5 52 114.0 53 95.5 54 80.5 55 47.5 56 38.0 57 36.5 58 25.5 59 18.0 60 10.5 61 8.0 62 7.5 63 8.5 64 8.5 65 4.0 66 2.5 67 2.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.585 40-44 1.175 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67369477911646 99.275 2 0.2761044176706827 0.5499999999999999 3 0.0251004016064257 0.075 4 0.0251004016064257 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.5874999999999999 0.0 0.0 0.0 0.0 106-107 0.6 0.0 0.0 0.0 0.0 108-109 0.6375 0.0 0.0 0.0 0.0 110-111 0.7625 0.0 0.0 0.0 0.0 112-113 0.9125000000000001 0.0 0.0 0.0 0.0 114-115 1.0750000000000002 0.0 0.0 0.0 0.0 116-117 1.225 0.0 0.0 0.0 0.0 118-119 1.375 0.0 0.0 0.0 0.0 120-121 1.575 0.0 0.0 0.0 0.0 122-123 1.8375 0.0 0.0 0.0 0.0 124-125 1.9500000000000002 0.0 0.0 0.0 0.0 126-127 2.1875 0.0 0.0 0.0 0.0 128-129 2.2874999999999996 0.0 0.0 0.0 0.0 130-131 2.5250000000000004 0.0 0.0 0.0 0.0 132-133 2.75 0.0 0.0 0.0 0.0 134-135 3.1125 0.0 0.0 0.0 0.0 136-137 3.425 0.0 0.0 0.0 0.0 138-139 3.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACATCAC 10 0.00686971 144.72499 6 AGCGTCT 10 0.00686971 144.72499 145 >>END_MODULE Read 857018 spots for SRR7171929.sra Written 857018 spots for SRR7171929.sra Read 857018 spots for SRR7171929.sra Written 857018 spots for SRR7171929.sra Read 857018 spots for SRR7171929.sra Written 857018 spots for SRR7171929.sra Read 857018 spots for SRR7171929.sra Written 857018 spots for SRR7171929.sra Read 857018 spots for SRR7171929.sra Written 857018 spots for SRR7171929.sra Read 857018 spots for SRR7171929.sra Written 857018 spots for SRR7171929.sra Read 857018 spots for SRR7171929.sra Written 857018 spots for SRR7171929.sra Read 857018 spots for SRR7171929.sra Written 857018 spots for SRR7171929.sra Read 857018 spots for SRR7171929.sra Written 857018 spots for SRR7171929.sra Read 857018 spots for SRR7171929.sra Written 857018 spots for SRR7171929.sra Read 857018 spots for SRR7171929.sra Written 857018 spots for SRR7171929.sra Read 857018 spots for SRR7171929.sra Written 857018 spots for SRR7171929.sra Read 857018 spots for SRR7171929.sra Written 857018 spots for SRR7171929.sra Read 857023 spots for SRR7171929.sra Written 857023 spots for SRR7171929.sra Read 857018 spots for SRR7171929.sra Written 857018 spots for SRR7171929.sra Read 857018 spots for SRR7171929.sra Written 857018 spots for SRR7171929.sra Read 857018 spots for SRR7171929.sra Written 857018 spots for SRR7171929.sra Read 857018 spots for SRR7171929.sra Written 857018 spots for SRR7171929.sra Read 857018 spots for SRR7171929.sra Written 857018 spots for SRR7171929.sra Read 857018 spots for SRR7171929.sra Written 857018 spots for SRR7171929.sra SRR ids: ['SRR7171929.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ahdlvwv4 SRR7171929.sra spots: 17140365 blocks: [[1, 857018], [857019, 1714036], [1714037, 2571054], [2571055, 3428072], [3428073, 4285090], [4285091, 5142108], [5142109, 5999126], [5999127, 6856144], [6856145, 7713162], [7713163, 8570180], [8570181, 9427198], [9427199, 10284216], [10284217, 11141234], [11141235, 11998252], [11998253, 12855270], [12855271, 13712288], [13712289, 14569306], [14569307, 15426324], [15426325, 16283342], [16283343, 17140365]] SRR7171929 file size 5786606 SRR7171929 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171929 SRR7171929_1.fastq SRR7171929_2.fastq Input file: SRR7171929_1.fastq Paired file: SRR7171929_2.fastq trimmed: SRR7171929-trimmed-pair1.fastq, SRR7171929-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 01:31:44 2025 >> started Fri Feb 14 01:32:02 2025 >> done (18.053s) 17140365 read pairs processed; of these: 17363 ( 0.10%) short read pairs filtered out after trimming by size control 11737 ( 0.07%) empty read pairs filtered out after trimming by size control 17111265 (99.83%) read pairs available; of these: 7138798 (41.72%) trimmed read pairs available after processing 9972467 (58.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 4 0.00% 21 2 0.00% 22 2 0.00% 23 1 0.00% 24 4 0.00% 25 4 0.00% 26 4 0.00% 27 3 0.00% 28 7 0.00% 29 1 0.00% 30 1 0.00% 31 5 0.00% 32 6 0.00% 33 4 0.00% 34 1 0.00% 35 2 0.00% 36 6 0.00% 37 4 0.00% 38 2 0.00% 39 7 0.00% 40 6 0.00% 41 4 0.00% 42 10 0.00% 43 14 0.00% 44 13 0.00% 45 14 0.00% 46 12 0.00% 47 10 0.00% 48 4 0.00% 49 13 0.00% 50 20 0.00% 51 21 0.00% 52 26 0.00% 53 34 0.00% 54 42 0.00% 55 36 0.00% 56 51 0.00% 57 48 0.00% 58 60 0.00% 59 64 0.00% 60 72 0.00% 61 80 0.00% 62 89 0.00% 63 111 0.00% 64 126 0.00% 65 117 0.00% 66 159 0.00% 67 202 0.00% 68 194 0.00% 69 225 0.00% 70 256 0.00% 71 340 0.00% 72 372 0.00% 73 421 0.00% 74 518 0.00% 75 554 0.00% 76 686 0.00% 77 698 0.00% 78 801 0.00% 79 916 0.01% 80 1061 0.01% 81 1236 0.01% 82 1427 0.01% 83 1620 0.01% 84 2553 0.01% 85 3145 0.02% 86 3284 0.02% 87 3914 0.02% 88 3997 0.02% 89 4155 0.02% 90 4323 0.03% 91 4552 0.03% 92 4861 0.03% 93 5299 0.03% 94 5658 0.03% 95 6077 0.04% 96 6316 0.04% 97 6883 0.04% 98 7221 0.04% 99 7696 0.04% 100 8081 0.05% 101 8694 0.05% 102 9156 0.05% 103 9805 0.06% 104 10584 0.06% 105 11142 0.07% 106 11870 0.07% 107 12398 0.07% 108 13281 0.08% 109 13696 0.08% 110 14613 0.09% 111 15456 0.09% 112 16104 0.09% 113 16970 0.10% 114 18044 0.11% 115 18947 0.11% 116 19895 0.12% 117 20599 0.12% 118 21029 0.12% 119 22118 0.13% 120 23243 0.14% 121 24053 0.14% 122 25631 0.15% 123 26627 0.16% 124 28190 0.16% 125 29287 0.17% 126 30646 0.18% 127 32062 0.19% 128 33397 0.20% 129 34733 0.20% 130 36211 0.21% 131 38230 0.22% 132 40558 0.24% 133 42659 0.25% 134 45366 0.27% 135 48304 0.28% 136 51390 0.30% 137 54940 0.32% 138 58575 0.34% 139 63599 0.37% 140 68592 0.40% 141 75234 0.44% 142 85162 0.50% 143 96000 0.56% 144 112105 0.66% 145 135540 0.79% 146 172129 1.01% 147 237919 1.39% 148 369904 2.16% 149 762657 4.46% 150 3870584 22.62% 151 9972467 58.28% 17111265 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.95 fanout-score-rank=24 prefix-density=0.62 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.04 sequence-density-rank=33 fanout-score=21.67 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=5.3 sequence=AGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTT criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.54 fanout-score-rank=24 prefix-density=0.63 prefix-fanout=2.5 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=20.68 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.3 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTC SRR7171929 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 01:32:50 Started mapping on | Feb 14 01:32:50 Finished on | Feb 14 01:35:21 Mapping speed, Million of reads per hour | 407.95 Number of input reads | 17111265 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 15722444 Uniquely mapped reads % | 91.88% Average mapped length | 296.06 Number of splices: Total | 15986805 Number of splices: Annotated (sjdb) | 15699673 Number of splices: GT/AG | 15727094 Number of splices: GC/AG | 202861 Number of splices: AT/AC | 12968 Number of splices: Non-canonical | 43882 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 438561 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 45133 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.20% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 966325 966325 966325 N_multimapping 438561 438561 438561 N_noFeature 372798 15581746 436289 N_ambiguous 161198 994 83310 UnstrandedReadsAssigned:15188448 PositiveStrandReadsAssigned:139704 NegativeStrandReadsAssigned:15202845 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171929 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171929-trimmed-pair1.fastq SRR7171929-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,111,265 reads, 15,021,452 reads pseudoaligned [quant] estimated average fragment length: 254.387 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,068 rounds 52401 SRR7171929.ke.tsv 34699 SRR7171929.se.tsv 87100 total ==> SRR7171929.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1764.61 1089 37.5087 Potri.005G024800.1.v4.1 1035 781.613 219 17.0297 Potri.004G059700.1.v4.1 961 707.634 13 1.11658 Potri.007G009000.2.v4.1 1416 1162.61 0 0 Potri.003G141000.2.v4.1 2943 2689.61 267.167 6.03736 Potri.016G087400.1.v4.1 270 72.2785 1012.72 851.596 Potri.015G069301.1.v4.1 564 315.562 0 0 Potri.010G195200.1.v4.1 1773 1519.61 518.446 20.736 Potri.012G127500.1.v4.1 977 723.623 7386 620.37 ==> SRR7171929.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 34 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 463 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 352 SRR7171929 completed mapping pipeline successfully