Starting /dee2/code/volunteer_pipeline.sh SRR7171930 current disk space = 3088094879744 free memory = 1580207392 SRR7171930 SRAfilesize 1d3a5ea7745f536a6690976325519a2c SRR7171930.sra SRR7171930.sra file validated SRR7171930 is paired end SRR7171930 is conventional basespace SRR7171930 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171930_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.0485 25.0 18.0 33.0 18.0 33.0 2 26.7485 27.0 25.0 31.0 18.0 33.0 3 29.22575 30.0 27.0 31.0 25.0 33.0 4 26.77975 29.0 25.0 31.0 15.0 33.0 5 30.083 32.0 30.0 33.0 25.0 33.0 6 35.7005 37.0 35.0 38.0 31.0 38.0 7 37.126 38.0 37.0 38.0 36.0 38.0 8 37.41975 38.0 38.0 38.0 37.0 38.0 9 37.41575 38.0 38.0 38.0 37.0 38.0 10-14 37.47495 38.0 38.0 38.0 37.0 38.0 15-19 37.51585 38.0 38.0 38.0 37.2 38.0 20-24 37.52720000000001 38.0 38.0 38.0 37.0 38.0 25-29 37.479299999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.447199999999995 38.0 38.0 38.0 37.0 38.0 35-39 37.43300000000001 38.0 38.0 38.0 37.0 38.0 40-44 37.368950000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.33275 38.0 38.0 38.0 37.0 38.0 50-54 37.2941 38.0 38.0 38.0 36.6 38.0 55-59 37.215799999999994 38.0 38.0 38.0 36.2 38.0 60-64 37.16515 38.0 38.0 38.0 36.0 38.0 65-69 37.121300000000005 38.0 38.0 38.0 36.0 38.0 70-74 37.03150000000001 38.0 38.0 38.0 36.0 38.0 75-79 36.96205 38.0 38.0 38.0 36.0 38.0 80-84 36.91775 38.0 38.0 38.0 35.4 38.0 85-89 36.85744999999999 38.0 38.0 38.0 35.4 38.0 90-94 36.7116 38.0 38.0 38.0 34.8 38.0 95-99 36.6849 38.0 38.0 38.0 34.4 38.0 100-104 36.4349 38.0 37.8 38.0 34.0 38.0 105-109 36.43315 38.0 37.8 38.0 34.0 38.0 110-114 36.2836 38.0 37.4 38.0 33.8 38.0 115-119 36.16275 38.0 37.0 38.0 33.6 38.0 120-124 35.9381 38.0 37.0 38.0 32.6 38.0 125-129 35.7605 38.0 36.8 38.0 31.8 38.0 130-134 35.44755 38.0 36.0 38.0 31.0 38.0 135-139 35.12445 38.0 35.8 38.0 28.8 38.0 140-144 34.71345 38.0 35.0 38.0 27.4 38.0 145-149 34.189800000000005 38.0 35.0 38.0 25.2 38.0 150-151 31.18 36.5 31.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 2.0 16 1.0 17 2.0 18 1.0 19 4.0 20 6.0 21 1.0 22 6.0 23 5.0 24 8.0 25 10.0 26 7.0 27 14.0 28 19.0 29 32.0 30 32.0 31 38.0 32 73.0 33 95.0 34 156.0 35 347.0 36 995.0 37 2142.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.76169042260565 11.677919479869967 12.478119529882472 29.08227056764191 2 24.775 14.325 36.6 24.3 3 18.775 24.6 29.599999999999998 27.025 4 24.075 29.225 25.4 21.3 5 23.35 32.300000000000004 25.025 19.325 6 18.925 35.6 25.374999999999996 20.1 7 15.125 22.0 43.85 19.025 8 18.925 24.224999999999998 28.749999999999996 28.1 9 18.2 22.525000000000002 32.824999999999996 26.450000000000003 10-14 20.5 28.444999999999997 27.384999999999998 23.669999999999998 15-19 20.25 28.035 27.779999999999998 23.935000000000002 20-24 19.744999999999997 28.285 27.815 24.154999999999998 25-29 20.65 28.235 27.29 23.825 30-34 20.11 27.88 27.85 24.16 35-39 20.560000000000002 27.700000000000003 28.025 23.715 40-44 20.915 28.315 27.900000000000002 22.869999999999997 45-49 20.29 28.405 27.589999999999996 23.715 50-54 20.91 28.345 27.735 23.01 55-59 20.415 28.299999999999997 27.029999999999998 24.255 60-64 20.46 27.839999999999996 27.97 23.73 65-69 20.1 28.13 27.88 23.89 70-74 20.8 27.46 28.18 23.56 75-79 20.64 27.529999999999998 27.744999999999997 24.085 80-84 19.905 27.544999999999998 28.465 24.085 85-89 20.29 27.74 28.265 23.705000000000002 90-94 20.830000000000002 28.33 27.584999999999997 23.255 95-99 20.405 28.000000000000004 27.905 23.69 100-104 20.135 28.57 27.084999999999997 24.21 105-109 20.645 27.16 28.615000000000002 23.580000000000002 110-114 20.72 27.439999999999998 27.700000000000003 24.14 115-119 20.165 28.055000000000003 28.185 23.595 120-124 20.875 28.000000000000004 27.275 23.849999999999998 125-129 20.885 28.035 27.334999999999997 23.745 130-134 20.974999999999998 27.67 27.250000000000004 24.104999999999997 135-139 20.94 27.439999999999998 27.52 24.099999999999998 140-144 20.580000000000002 27.775 27.975 23.669999999999998 145-149 21.099999999999998 27.495000000000005 27.560000000000002 23.845 150-151 21.525 27.3 27.474999999999998 23.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 1.5 23 0.5 24 1.0 25 4.5 26 4.5 27 4.5 28 8.5 29 8.5 30 12.0 31 15.5 32 19.0 33 32.0 34 55.5 35 75.0 36 78.0 37 92.0 38 119.0 39 142.0 40 162.0 41 210.5 42 257.5 43 264.5 44 267.0 45 287.5 46 282.5 47 261.0 48 242.0 49 215.5 50 189.0 51 156.5 52 129.0 53 99.0 54 79.5 55 63.5 56 46.5 57 34.5 58 20.0 59 13.5 60 10.5 61 6.5 62 6.0 63 3.0 64 2.0 65 2.5 66 1.5 67 1.5 68 1.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79949874686717 99.55000000000001 2 0.17543859649122806 0.35000000000000003 3 0.0 0.0 4 0.02506265664160401 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.275 0.0125 0.0 0.0 0.0 104-105 0.32499999999999996 0.025 0.0 0.0 0.0 106-107 0.35 0.025 0.0 0.0 0.0 108-109 0.4375 0.025 0.0 0.0 0.0 110-111 0.5375000000000001 0.025 0.0 0.0 0.0 112-113 0.6 0.025 0.0 0.0 0.0 114-115 0.725 0.025 0.0 0.0 0.0 116-117 0.9125 0.025 0.0 0.0 0.0 118-119 1.0375 0.025 0.0 0.0 0.0 120-121 1.15 0.025 0.0 0.0 0.0 122-123 1.3250000000000002 0.025 0.0 0.0 0.0 124-125 1.35 0.025 0.0 0.0 0.0 126-127 1.4375 0.025 0.0 0.0 0.0 128-129 1.5625 0.025 0.0 0.0 0.0 130-131 1.8250000000000002 0.025 0.0 0.0 0.0 132-133 2.0 0.025 0.0 0.0 0.0 134-135 2.2125 0.025 0.0 0.0 0.0 136-137 2.35 0.025 0.0 0.0 0.0 138-139 2.55 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCTCTC 20 0.00593511 29.0 55-59 >>END_MODULE SRR7171930 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171930_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.912 33.0 33.0 34.0 32.0 34.0 2 33.00525 33.0 33.0 34.0 32.0 34.0 3 33.07275 34.0 33.0 34.0 32.0 34.0 4 32.98275 34.0 33.0 34.0 32.0 34.0 5 32.9905 34.0 33.0 34.0 32.0 34.0 6 37.212 38.0 38.0 38.0 37.0 38.0 7 37.18525 38.0 38.0 38.0 37.0 38.0 8 37.091 38.0 38.0 38.0 36.0 38.0 9 37.2065 38.0 38.0 38.0 37.0 38.0 10-14 37.1702 38.0 38.0 38.0 36.8 38.0 15-19 37.16675 38.0 38.0 38.0 37.0 38.0 20-24 37.15095 38.0 38.0 38.0 37.0 38.0 25-29 37.1312 38.0 38.0 38.0 37.0 38.0 30-34 37.06589999999999 38.0 38.0 38.0 36.6 38.0 35-39 36.88590000000001 38.0 38.0 38.0 36.4 38.0 40-44 36.61185 38.0 38.0 38.0 35.8 38.0 45-49 36.90725 38.0 38.0 38.0 36.0 38.0 50-54 36.94955 38.0 38.0 38.0 36.0 38.0 55-59 36.90295 38.0 38.0 38.0 36.0 38.0 60-64 36.8753 38.0 38.0 38.0 36.0 38.0 65-69 36.779399999999995 38.0 38.0 38.0 35.6 38.0 70-74 36.7274 38.0 38.0 38.0 35.2 38.0 75-79 36.629 38.0 38.0 38.0 35.0 38.0 80-84 36.5128 38.0 38.0 38.0 34.0 38.0 85-89 36.419850000000004 38.0 38.0 38.0 34.0 38.0 90-94 36.3351 38.0 38.0 38.0 34.0 38.0 95-99 36.21115 38.0 37.8 38.0 34.0 38.0 100-104 36.173500000000004 38.0 37.0 38.0 33.6 38.0 105-109 35.909949999999995 38.0 37.0 38.0 32.6 38.0 110-114 35.670100000000005 38.0 37.0 38.0 31.2 38.0 115-119 35.5774 38.0 36.6 38.0 31.0 38.0 120-124 35.3692 38.0 36.0 38.0 30.6 38.0 125-129 35.20525 38.0 36.0 38.0 29.2 38.0 130-134 34.83985 38.0 35.2 38.0 27.8 38.0 135-139 34.470749999999995 38.0 35.0 38.0 26.2 38.0 140-144 34.0678 38.0 34.8 38.0 23.4 38.0 145-149 33.43215 38.0 34.2 38.0 19.0 38.0 150-151 29.82425 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 4.0 4 1.0 5 2.0 6 1.0 7 1.0 8 1.0 9 0.0 10 2.0 11 3.0 12 2.0 13 1.0 14 3.0 15 6.0 16 3.0 17 2.0 18 4.0 19 3.0 20 7.0 21 2.0 22 5.0 23 5.0 24 10.0 25 16.0 26 18.0 27 27.0 28 25.0 29 25.0 30 33.0 31 48.0 32 78.0 33 119.0 34 183.0 35 355.0 36 707.0 37 2293.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.525 18.6 16.525000000000002 24.349999999999998 2 26.025 23.825 32.275 17.875 3 20.3 28.4 31.1 20.200000000000003 4 24.2 35.6 21.025 19.175 5 23.275000000000002 36.975 21.075 18.675 6 19.825 36.525 23.875 19.775000000000002 7 20.525 17.724999999999998 41.25 20.5 8 21.125 23.325000000000003 27.474999999999998 28.075 9 21.575 23.974999999999998 29.325000000000003 25.124999999999996 10-14 22.81 28.725 25.89 22.575 15-19 22.835 28.365000000000002 27.894999999999996 20.905 20-24 23.075000000000003 28.565 27.315 21.044999999999998 25-29 22.134999999999998 27.900000000000002 28.060000000000002 21.905 30-34 23.185 27.529999999999998 27.985 21.3 35-39 23.067651047159863 27.74848073928984 27.76857013711014 21.41529807644016 40-44 23.06411743933814 28.3509055137971 27.34197649195379 21.243000554910964 45-49 23.035 28.54 27.35 21.075 50-54 22.78 28.21 27.985 21.025 55-59 23.064999999999998 27.98 27.21 21.745 60-64 23.23 27.805000000000003 27.860000000000003 21.105 65-69 22.855 27.744999999999997 28.165000000000003 21.235 70-74 23.76 27.750000000000004 27.37 21.12 75-79 23.71 27.435 27.395000000000003 21.46 80-84 23.62 28.499999999999996 26.66 21.22 85-89 24.175 27.284999999999997 27.439999999999998 21.099999999999998 90-94 23.830000000000002 27.939999999999998 27.169999999999998 21.060000000000002 95-99 23.830000000000002 28.225 27.450000000000003 20.495 100-104 23.665 28.595 26.895000000000003 20.845 105-109 23.575 27.534999999999997 27.765 21.125 110-114 23.875 27.939999999999998 27.83 20.355 115-119 23.735 28.875 27.245 20.145 120-124 23.69 28.4 26.784999999999997 21.125 125-129 23.66 28.050000000000004 27.405 20.885 130-134 23.75 28.050000000000004 27.544999999999998 20.655 135-139 24.015 28.005000000000003 27.18 20.8 140-144 23.74 27.66 28.38 20.22 145-149 24.375 28.28 26.82 20.525 150-151 23.375 28.325 27.1 21.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.5 24 1.0 25 0.0 26 1.5 27 3.0 28 3.5 29 2.5 30 6.0 31 12.5 32 17.0 33 24.0 34 36.5 35 52.5 36 66.5 37 88.5 38 127.5 39 168.5 40 191.5 41 213.0 42 253.5 43 287.0 44 307.5 45 308.0 46 282.5 47 256.0 48 232.5 49 213.0 50 187.5 51 158.5 52 115.0 53 91.0 54 85.0 55 59.5 56 43.0 57 31.0 58 19.0 59 13.5 60 13.5 61 8.0 62 3.5 63 4.5 64 3.0 65 2.0 66 1.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.445 40-44 0.885 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72382626161185 99.3 2 0.20085362791865427 0.4 3 0.05021340697966357 0.15 4 0.0 0.0 5 0.0 0.0 6 0.025106703489831784 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTAGGCTTGAGCAGATTCATTCGCCAACTAACCCTTTAATTTATCCTAT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.30000000000000004 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.625 0.0 0.0 0.0 0.0 114-115 0.7375 0.0 0.0 0.0 0.0 116-117 0.8875 0.0 0.0 0.0 0.0 118-119 1.0125 0.0 0.0 0.0 0.0 120-121 1.125 0.0 0.0 0.0 0.0 122-123 1.3250000000000002 0.0 0.0 0.0 0.0 124-125 1.375 0.0 0.0 0.0 0.0 126-127 1.4625 0.0 0.0 0.0 0.0 128-129 1.5625 0.0 0.0 0.0 0.0 130-131 1.8125 0.0 0.0 0.0 0.0 132-133 1.975 0.0 0.0 0.0 0.0 134-135 2.1875 0.0 0.0 0.0 0.0 136-137 2.325 0.0 0.0 0.0 0.0 138-139 2.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTGCAA 10 0.0068555363 144.825 7 AACTGCA 10 0.0068555363 144.825 6 >>END_MODULE Read 792542 spots for SRR7171930.sra Written 792542 spots for SRR7171930.sra Read 792542 spots for SRR7171930.sra Written 792542 spots for SRR7171930.sra Read 792542 spots for SRR7171930.sra Written 792542 spots for SRR7171930.sra Read 792542 spots for SRR7171930.sra Written 792542 spots for SRR7171930.sra Read 792542 spots for SRR7171930.sra Written 792542 spots for SRR7171930.sra Read 792542 spots for SRR7171930.sra Written 792542 spots for SRR7171930.sra Read 792542 spots for SRR7171930.sra Written 792542 spots for SRR7171930.sra Read 792542 spots for SRR7171930.sra Written 792542 spots for SRR7171930.sra Read 792542 spots for SRR7171930.sra Written 792542 spots for SRR7171930.sra Read 792542 spots for SRR7171930.sra Written 792542 spots for SRR7171930.sra Read 792542 spots for SRR7171930.sra Written 792542 spots for SRR7171930.sra Read 792542 spots for SRR7171930.sra Written 792542 spots for SRR7171930.sra Read 792542 spots for SRR7171930.sra Written 792542 spots for SRR7171930.sra Read 792542 spots for SRR7171930.sra Written 792542 spots for SRR7171930.sra Read 792542 spots for SRR7171930.sra Written 792542 spots for SRR7171930.sra Read 792542 spots for SRR7171930.sra Written 792542 spots for SRR7171930.sra Read 792542 spots for SRR7171930.sra Written 792542 spots for SRR7171930.sra Read 792542 spots for SRR7171930.sra Written 792542 spots for SRR7171930.sra Read 792552 spots for SRR7171930.sra Written 792552 spots for SRR7171930.sra Read 792542 spots for SRR7171930.sra Written 792542 spots for SRR7171930.sra SRR ids: ['SRR7171930.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gtsmerwh SRR7171930.sra spots: 15850850 blocks: [[1, 792542], [792543, 1585084], [1585085, 2377626], [2377627, 3170168], [3170169, 3962710], [3962711, 4755252], [4755253, 5547794], [5547795, 6340336], [6340337, 7132878], [7132879, 7925420], [7925421, 8717962], [8717963, 9510504], [9510505, 10303046], [10303047, 11095588], [11095589, 11888130], [11888131, 12680672], [12680673, 13473214], [13473215, 14265756], [14265757, 15058298], [15058299, 15850850]] SRR7171930 file size 5349632 SRR7171930 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171930 SRR7171930_1.fastq SRR7171930_2.fastq Input file: SRR7171930_1.fastq Paired file: SRR7171930_2.fastq trimmed: SRR7171930-trimmed-pair1.fastq, SRR7171930-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 03:14:57 2025 >> started Fri Feb 14 03:15:14 2025 >> done (16.748s) 15850850 read pairs processed; of these: 18278 ( 0.12%) short read pairs filtered out after trimming by size control 11943 ( 0.08%) empty read pairs filtered out after trimming by size control 15820629 (99.81%) read pairs available; of these: 6668388 (42.15%) trimmed read pairs available after processing 9152241 (57.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 6 0.00% 21 1 0.00% 22 2 0.00% 23 4 0.00% 24 6 0.00% 25 4 0.00% 26 4 0.00% 27 8 0.00% 28 4 0.00% 29 6 0.00% 30 8 0.00% 31 4 0.00% 32 3 0.00% 33 2 0.00% 34 6 0.00% 35 5 0.00% 36 4 0.00% 37 5 0.00% 38 5 0.00% 39 5 0.00% 40 10 0.00% 41 9 0.00% 42 6 0.00% 43 8 0.00% 44 13 0.00% 45 8 0.00% 46 9 0.00% 47 16 0.00% 48 14 0.00% 49 13 0.00% 50 28 0.00% 51 32 0.00% 52 18 0.00% 53 40 0.00% 54 34 0.00% 55 30 0.00% 56 40 0.00% 57 66 0.00% 58 70 0.00% 59 75 0.00% 60 58 0.00% 61 74 0.00% 62 89 0.00% 63 104 0.00% 64 115 0.00% 65 110 0.00% 66 123 0.00% 67 139 0.00% 68 154 0.00% 69 157 0.00% 70 234 0.00% 71 236 0.00% 72 262 0.00% 73 313 0.00% 74 362 0.00% 75 421 0.00% 76 490 0.00% 77 558 0.00% 78 544 0.00% 79 662 0.00% 80 712 0.00% 81 893 0.01% 82 976 0.01% 83 1217 0.01% 84 2103 0.01% 85 2641 0.02% 86 2795 0.02% 87 3418 0.02% 88 3379 0.02% 89 3449 0.02% 90 3601 0.02% 91 3770 0.02% 92 3986 0.03% 93 4039 0.03% 94 4298 0.03% 95 4360 0.03% 96 4633 0.03% 97 4956 0.03% 98 5105 0.03% 99 5403 0.03% 100 5825 0.04% 101 6218 0.04% 102 6767 0.04% 103 7272 0.05% 104 7471 0.05% 105 8036 0.05% 106 8397 0.05% 107 8726 0.06% 108 9238 0.06% 109 9792 0.06% 110 10638 0.07% 111 11629 0.07% 112 12023 0.08% 113 12763 0.08% 114 13305 0.08% 115 14152 0.09% 116 14806 0.09% 117 15614 0.10% 118 15905 0.10% 119 16466 0.10% 120 16998 0.11% 121 17972 0.11% 122 18999 0.12% 123 20253 0.13% 124 21185 0.13% 125 22089 0.14% 126 23425 0.15% 127 24482 0.15% 128 25761 0.16% 129 26972 0.17% 130 28408 0.18% 131 29884 0.19% 132 32050 0.20% 133 34488 0.22% 134 36830 0.23% 135 40141 0.25% 136 42772 0.27% 137 45700 0.29% 138 49986 0.32% 139 54257 0.34% 140 59659 0.38% 141 66498 0.42% 142 75913 0.48% 143 87813 0.56% 144 104997 0.66% 145 127646 0.81% 146 166590 1.05% 147 234294 1.48% 148 371446 2.35% 149 766997 4.85% 150 3707263 23.43% 151 9152241 57.85% 15820629 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.83 fanout-score-rank=27 prefix-density=0.65 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACCAGAGTTCATCTCAGACC criterion=fanout-score sequence-density=0.10 sequence-density-rank=21 fanout-score=41.75 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=10.6 sequence=AGCACCAAGTGGAGGGTGGACTCCTTCTGGAT criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.62 fanout-score-rank=23 prefix-density=0.68 prefix-fanout=2.6 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=25 fanout-score=26.29 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=3.5 sequence=AGAAAATGTCTTGCTGTGGAGGAAACTGTGG SRR7171930 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 03:16:06 Started mapping on | Feb 14 03:16:06 Finished on | Feb 14 03:18:00 Mapping speed, Million of reads per hour | 499.60 Number of input reads | 15820629 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14597764 Uniquely mapped reads % | 92.27% Average mapped length | 296.73 Number of splices: Total | 14854161 Number of splices: Annotated (sjdb) | 14599810 Number of splices: GT/AG | 14623598 Number of splices: GC/AG | 185389 Number of splices: AT/AC | 11428 Number of splices: Non-canonical | 33746 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 388998 % of reads mapped to multiple loci | 2.46% Number of reads mapped to too many loci | 41123 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.94% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 853725 853725 853725 N_multimapping 388998 388998 388998 N_noFeature 304968 14458924 371491 N_ambiguous 143560 825 70762 UnstrandedReadsAssigned:14149236 PositiveStrandReadsAssigned:138015 NegativeStrandReadsAssigned:14155511 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171930 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171930-trimmed-pair1.fastq SRR7171930-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,820,629 reads, 14,012,454 reads pseudoaligned [quant] estimated average fragment length: 270.392 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,157 rounds 52401 SRR7171930.ke.tsv 34699 SRR7171930.se.tsv 87100 total ==> SRR7171930.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1748.61 1238 47.819 Potri.005G024800.1.v4.1 1035 765.608 219 19.3201 Potri.004G059700.1.v4.1 961 691.635 35 3.41793 Potri.007G009000.2.v4.1 1416 1146.61 0 0 Potri.003G141000.2.v4.1 2943 2673.61 563 14.2227 Potri.016G087400.1.v4.1 270 67.0101 833 839.609 Potri.015G069301.1.v4.1 564 300.513 0 0 Potri.010G195200.1.v4.1 1773 1503.61 397 17.8331 Potri.012G127500.1.v4.1 977 707.635 1994 190.321 ==> SRR7171930.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 33 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 457 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 278 SRR7171930 completed mapping pipeline successfully