Starting /dee2/code/volunteer_pipeline.sh SRR7171931 current disk space = 3087994130432 free memory = 1582770788 SRR7171931 SRAfilesize 0c16f832cc4b383c33ee28f7faafd9ac SRR7171931.sra SRR7171931.sra file validated SRR7171931 is paired end SRR7171931 is conventional basespace SRR7171931 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171931_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.26825 32.0 25.0 33.0 18.0 33.0 2 29.665 31.0 29.0 33.0 25.0 33.0 3 31.543 32.0 32.0 33.0 27.0 33.0 4 30.2645 32.0 30.0 33.0 25.0 33.0 5 32.41875 33.0 33.0 33.0 32.0 33.0 6 35.96575 37.0 36.0 38.0 33.0 38.0 7 37.0795 38.0 37.0 38.0 35.0 38.0 8 37.22375 38.0 38.0 38.0 36.0 38.0 9 37.54475 38.0 38.0 38.0 37.0 38.0 10-14 37.5797 38.0 38.0 38.0 37.6 38.0 15-19 37.58515 38.0 38.0 38.0 38.0 38.0 20-24 37.5096 38.0 38.0 38.0 37.8 38.0 25-29 37.52595 38.0 38.0 38.0 37.4 38.0 30-34 37.50175 38.0 38.0 38.0 37.8 38.0 35-39 37.433749999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.3741 38.0 38.0 38.0 37.0 38.0 45-49 37.391450000000006 38.0 38.0 38.0 37.0 38.0 50-54 37.30105 38.0 38.0 38.0 37.0 38.0 55-59 37.26225 38.0 38.0 38.0 36.6 38.0 60-64 37.2046 38.0 38.0 38.0 36.2 38.0 65-69 37.1787 38.0 38.0 38.0 36.0 38.0 70-74 37.13115 38.0 38.0 38.0 36.0 38.0 75-79 37.02804999999999 38.0 38.0 38.0 36.0 38.0 80-84 36.95685 38.0 38.0 38.0 35.6 38.0 85-89 36.88340000000001 38.0 38.0 38.0 35.6 38.0 90-94 36.7778 38.0 38.0 38.0 35.0 38.0 95-99 36.772949999999994 38.0 38.0 38.0 35.0 38.0 100-104 36.621500000000005 38.0 38.0 38.0 34.4 38.0 105-109 36.5156 38.0 38.0 38.0 34.2 38.0 110-114 36.38415 38.0 37.8 38.0 34.0 38.0 115-119 36.2416 38.0 37.2 38.0 33.4 38.0 120-124 36.037850000000006 38.0 37.0 38.0 33.0 38.0 125-129 35.9084 38.0 36.8 38.0 32.8 38.0 130-134 35.4936 38.0 36.0 38.0 31.0 38.0 135-139 35.33465 38.0 36.0 38.0 31.0 38.0 140-144 35.0736 38.0 35.6 38.0 29.0 38.0 145-149 34.47965 38.0 35.0 38.0 27.4 38.0 150-151 31.7235 36.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 1.0 12 2.0 13 1.0 14 1.0 15 1.0 16 0.0 17 1.0 18 1.0 19 0.0 20 3.0 21 3.0 22 3.0 23 9.0 24 6.0 25 13.0 26 13.0 27 12.0 28 15.0 29 21.0 30 28.0 31 41.0 32 62.0 33 77.0 34 143.0 35 299.0 36 769.0 37 2473.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.55 12.2 13.450000000000001 32.800000000000004 2 21.66624968726545 17.112834625969477 36.602451838879155 24.618463847885916 3 19.75 24.2 28.975 27.075 4 21.95 29.75 25.275 23.025000000000002 5 21.725 34.775 24.525 18.975 6 19.875 34.675 25.025 20.424999999999997 7 13.925 22.900000000000002 43.8 19.375 8 17.65 22.575 30.425 29.349999999999998 9 18.35 23.3 31.525 26.825 10-14 19.73 29.625 27.075 23.57 15-19 20.365 28.09 28.285 23.26 20-24 20.79 28.23 27.595 23.385 25-29 19.814999999999998 28.67 27.96 23.555 30-34 19.945 28.52 28.305000000000003 23.23 35-39 20.07 28.535 27.72 23.674999999999997 40-44 20.215 27.495000000000005 28.205000000000002 24.085 45-49 20.335 28.165000000000003 27.88 23.62 50-54 19.875 28.060000000000002 28.4 23.665 55-59 20.369999999999997 28.12 28.03 23.48 60-64 20.05 27.884999999999998 27.894999999999996 24.169999999999998 65-69 20.72 27.865000000000002 27.650000000000002 23.765 70-74 20.825 27.505000000000003 27.705000000000002 23.965 75-79 20.335 28.59 27.46 23.615 80-84 20.06 28.365000000000002 27.589999999999996 23.985 85-89 20.580000000000002 27.584999999999997 28.16 23.674999999999997 90-94 20.47 27.825 27.61 24.095 95-99 20.4 27.905 28.244999999999997 23.45 100-104 20.635 27.63 27.76 23.974999999999998 105-109 20.855 27.625 27.93 23.59 110-114 20.915 27.99 27.88 23.215 115-119 20.97 27.589999999999996 28.28 23.16 120-124 20.985 27.639999999999997 27.875 23.5 125-129 21.215 27.839999999999996 27.305 23.64 130-134 20.95 27.750000000000004 27.685 23.615 135-139 21.42 27.845 27.24 23.494999999999997 140-144 20.75 27.634999999999998 27.57 24.044999999999998 145-149 21.11 27.16 28.07 23.66 150-151 20.962500000000002 27.6125 27.474999999999998 23.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 1.0 23 1.5 24 1.0 25 3.5 26 6.0 27 3.5 28 8.5 29 15.5 30 14.0 31 14.0 32 26.5 33 42.5 34 55.5 35 67.0 36 82.0 37 106.0 38 120.0 39 144.5 40 189.5 41 229.5 42 260.0 43 280.0 44 288.5 45 283.0 46 268.5 47 236.5 48 216.0 49 202.0 50 177.0 51 155.5 52 126.0 53 100.5 54 72.0 55 45.0 56 39.5 57 32.5 58 18.0 59 13.0 60 13.5 61 12.0 62 6.5 63 4.0 64 3.0 65 2.5 66 2.0 67 2.0 68 2.0 69 1.0 70 1.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.21250000000000002 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.32499999999999996 0.0 0.0 0.0 0.0 112-113 0.4375 0.0 0.0 0.0 0.0 114-115 0.575 0.0 0.0 0.0 0.0 116-117 0.675 0.0 0.0 0.0 0.0 118-119 0.8 0.0 0.0 0.0 0.0 120-121 0.925 0.0 0.0 0.0 0.0 122-123 1.0125 0.0 0.0 0.0 0.0 124-125 1.125 0.0 0.0 0.0 0.0 126-127 1.2125 0.0 0.0 0.0 0.0 128-129 1.2625 0.0 0.0 0.0 0.0 130-131 1.4 0.0 0.0 0.0 0.0 132-133 1.6 0.0 0.0 0.0 0.0 134-135 1.9 0.0 0.0 0.0 0.0 136-137 2.2125 0.0 0.0 0.0 0.0 138-139 2.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTGCTG 10 0.006830828 145.0 9 >>END_MODULE SRR7171931 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171931_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.10325 33.0 33.0 34.0 33.0 34.0 2 33.163 34.0 33.0 34.0 33.0 34.0 3 33.201 34.0 33.0 34.0 33.0 34.0 4 33.1965 34.0 33.0 34.0 33.0 34.0 5 33.12475 34.0 33.0 34.0 33.0 34.0 6 37.31125 38.0 38.0 38.0 37.0 38.0 7 37.3305 38.0 38.0 38.0 37.0 38.0 8 37.32025 38.0 38.0 38.0 37.0 38.0 9 37.35075 38.0 38.0 38.0 37.0 38.0 10-14 37.2719 38.0 38.0 38.0 37.0 38.0 15-19 37.222750000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.295649999999995 38.0 38.0 38.0 37.0 38.0 25-29 37.2757 38.0 38.0 38.0 37.0 38.0 30-34 37.220099999999995 38.0 38.0 38.0 37.0 38.0 35-39 37.01975 38.0 38.0 38.0 37.0 38.0 40-44 36.9078 38.0 38.0 38.0 36.2 38.0 45-49 37.098150000000004 38.0 38.0 38.0 36.8 38.0 50-54 37.01375 38.0 38.0 38.0 36.2 38.0 55-59 37.01785 38.0 38.0 38.0 36.0 38.0 60-64 36.9188 38.0 38.0 38.0 36.0 38.0 65-69 36.93044999999999 38.0 38.0 38.0 36.0 38.0 70-74 36.902899999999995 38.0 38.0 38.0 36.0 38.0 75-79 36.85025 38.0 38.0 38.0 36.0 38.0 80-84 36.72500000000001 38.0 38.0 38.0 35.4 38.0 85-89 36.6665 38.0 38.0 38.0 34.8 38.0 90-94 36.55735 38.0 38.0 38.0 34.8 38.0 95-99 36.4295 38.0 38.0 38.0 34.0 38.0 100-104 36.25045 38.0 38.0 38.0 33.8 38.0 105-109 36.1524 38.0 37.8 38.0 33.6 38.0 110-114 36.1426 38.0 37.6 38.0 34.0 38.0 115-119 35.83005000000001 38.0 37.0 38.0 32.2 38.0 120-124 35.7559 38.0 36.8 38.0 32.4 38.0 125-129 35.419500000000006 38.0 36.0 38.0 31.0 38.0 130-134 35.170249999999996 38.0 36.0 38.0 29.0 38.0 135-139 35.03529999999999 38.0 36.0 38.0 28.0 38.0 140-144 34.653 38.0 35.0 38.0 27.4 38.0 145-149 34.18555 38.0 34.6 38.0 26.4 38.0 150-151 30.69625 36.5 29.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 3.0 4 0.0 5 1.0 6 3.0 7 1.0 8 2.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 2.0 15 3.0 16 2.0 17 1.0 18 2.0 19 4.0 20 6.0 21 8.0 22 8.0 23 8.0 24 11.0 25 8.0 26 19.0 27 18.0 28 20.0 29 23.0 30 36.0 31 43.0 32 65.0 33 90.0 34 155.0 35 251.0 36 642.0 37 2557.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.574999999999996 17.8 17.075000000000003 26.55 2 25.0 24.325 32.15 18.525 3 21.0 27.975 31.35 19.675 4 23.575 35.275 22.650000000000002 18.5 5 24.099999999999998 36.175000000000004 21.224999999999998 18.5 6 18.65 37.45 24.3 19.6 7 19.650000000000002 17.75 40.0 22.6 8 21.05 23.849999999999998 27.1 28.000000000000004 9 21.45 25.874999999999996 28.175 24.5 10-14 23.119999999999997 28.895 26.595000000000002 21.39 15-19 22.355 28.435 27.455000000000002 21.755 20-24 22.99 28.595 27.43 20.985 25-29 23.25 28.68 26.655 21.415 30-34 23.006058178541032 28.308216091723825 27.787513142742704 20.89821258699244 35-39 22.722707642864318 28.487496233805366 27.21201165009541 21.57778447323491 40-44 23.06531905264746 28.30995122441796 27.716598783124653 20.908130939809926 45-49 23.155 27.975 27.779999999999998 21.09 50-54 23.135 27.595 28.225 21.044999999999998 55-59 23.575 27.82 27.839999999999996 20.765 60-64 23.505000000000003 28.015 27.41 21.07 65-69 23.395 28.305000000000003 27.685 20.615 70-74 23.549999999999997 28.51 26.834999999999997 21.105 75-79 23.724999999999998 28.4 27.395000000000003 20.48 80-84 22.845 28.265 28.305000000000003 20.585 85-89 23.765 28.389999999999997 27.325 20.52 90-94 23.825 28.53 27.169999999999998 20.474999999999998 95-99 23.53 27.810000000000002 27.49 21.17 100-104 23.35 28.275 27.625 20.75 105-109 23.165 27.705000000000002 27.955000000000002 21.175 110-114 23.965 28.499999999999996 27.215 20.32 115-119 24.015 28.485 27.495000000000005 20.005 120-124 23.965 28.09 27.35 20.595 125-129 23.855 28.194999999999997 27.115000000000002 20.835 130-134 23.91 28.17 27.175 20.745 135-139 23.98 28.34 27.715 19.965 140-144 24.38 27.884999999999998 27.650000000000002 20.085 145-149 24.135 27.865000000000002 27.400000000000002 20.599999999999998 150-151 24.2625 27.6625 27.1 20.974999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 0.5 22 0.5 23 0.5 24 0.5 25 1.0 26 3.0 27 4.5 28 4.0 29 6.5 30 7.0 31 13.5 32 24.0 33 26.5 34 35.5 35 52.0 36 63.0 37 85.0 38 129.5 39 167.0 40 207.5 41 245.0 42 267.5 43 293.5 44 307.5 45 305.5 46 296.0 47 264.5 48 237.5 49 209.0 50 160.0 51 124.0 52 100.5 53 79.0 54 66.0 55 54.0 56 38.5 57 28.5 58 21.0 59 16.0 60 9.5 61 7.5 62 7.0 63 5.5 64 6.0 65 4.5 66 2.5 67 2.0 68 1.0 69 1.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.135 35-39 0.43 40-44 0.565 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.21250000000000002 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.32499999999999996 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.6125 0.0 0.0 0.0 0.0 116-117 0.7 0.0 0.0 0.0 0.0 118-119 0.825 0.0 0.0 0.0 0.0 120-121 0.95 0.0 0.0 0.0 0.0 122-123 1.0375 0.0 0.0 0.0 0.0 124-125 1.15 0.0 0.0 0.0 0.0 126-127 1.2375 0.0 0.0 0.0 0.0 128-129 1.2875 0.0 0.0 0.0 0.0 130-131 1.4125 0.0 0.0 0.0 0.0 132-133 1.6 0.0 0.0 0.0 0.0 134-135 1.9 0.0 0.0 0.0 0.0 136-137 2.1625 0.0 0.0 0.0 0.0 138-139 2.4625000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAACAGC 10 0.006882143 144.6375 2 >>END_MODULE Read 735950 spots for SRR7171931.sra Written 735950 spots for SRR7171931.sra Read 735950 spots for SRR7171931.sra Written 735950 spots for SRR7171931.sra Read 735950 spots for SRR7171931.sra Written 735950 spots for SRR7171931.sra Read 735950 spots for SRR7171931.sra Written 735950 spots for SRR7171931.sra Read 735950 spots for SRR7171931.sra Written 735950 spots for SRR7171931.sra Read 735950 spots for SRR7171931.sra Written 735950 spots for SRR7171931.sra Read 735950 spots for SRR7171931.sra Written 735950 spots for SRR7171931.sra Read 735950 spots for SRR7171931.sra Written 735950 spots for SRR7171931.sra Read 735950 spots for SRR7171931.sra Written 735950 spots for SRR7171931.sra Read 735950 spots for SRR7171931.sra Written 735950 spots for SRR7171931.sra Read 735950 spots for SRR7171931.sra Written 735950 spots for SRR7171931.sra Read 735950 spots for SRR7171931.sra Written 735950 spots for SRR7171931.sra Read 735950 spots for SRR7171931.sra Written 735950 spots for SRR7171931.sra Read 735950 spots for SRR7171931.sra Written 735950 spots for SRR7171931.sra Read 735950 spots for SRR7171931.sra Written 735950 spots for SRR7171931.sra Read 735950 spots for SRR7171931.sra Written 735950 spots for SRR7171931.sra Read 735950 spots for SRR7171931.sra Written 735950 spots for SRR7171931.sra Read 735956 spots for SRR7171931.sra Written 735956 spots for SRR7171931.sra Read 735950 spots for SRR7171931.sra Written 735950 spots for SRR7171931.sra Read 735950 spots for SRR7171931.sra Written 735950 spots for SRR7171931.sra SRR ids: ['SRR7171931.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ajopqpah SRR7171931.sra spots: 14719006 blocks: [[1, 735950], [735951, 1471900], [1471901, 2207850], [2207851, 2943800], [2943801, 3679750], [3679751, 4415700], [4415701, 5151650], [5151651, 5887600], [5887601, 6623550], [6623551, 7359500], [7359501, 8095450], [8095451, 8831400], [8831401, 9567350], [9567351, 10303300], [10303301, 11039250], [11039251, 11775200], [11775201, 12511150], [12511151, 13247100], [13247101, 13983050], [13983051, 14719006]] SRR7171931 file size 4966087 SRR7171931 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171931 SRR7171931_1.fastq SRR7171931_2.fastq Input file: SRR7171931_1.fastq Paired file: SRR7171931_2.fastq trimmed: SRR7171931-trimmed-pair1.fastq, SRR7171931-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 03:06:46 2025 >> started Fri Feb 14 03:07:02 2025 >> done (15.798s) 14719006 read pairs processed; of these: 17745 ( 0.12%) short read pairs filtered out after trimming by size control 12823 ( 0.09%) empty read pairs filtered out after trimming by size control 14688438 (99.79%) read pairs available; of these: 6200882 (42.22%) trimmed read pairs available after processing 8487556 (57.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 4 0.00% 21 2 0.00% 22 2 0.00% 23 8 0.00% 24 6 0.00% 25 8 0.00% 26 6 0.00% 27 4 0.00% 28 5 0.00% 29 4 0.00% 30 8 0.00% 31 6 0.00% 32 7 0.00% 33 5 0.00% 34 1 0.00% 35 4 0.00% 36 5 0.00% 37 2 0.00% 38 8 0.00% 39 6 0.00% 40 7 0.00% 41 9 0.00% 42 7 0.00% 43 6 0.00% 44 11 0.00% 45 12 0.00% 46 19 0.00% 47 11 0.00% 48 14 0.00% 49 18 0.00% 50 17 0.00% 51 21 0.00% 52 29 0.00% 53 31 0.00% 54 21 0.00% 55 42 0.00% 56 39 0.00% 57 38 0.00% 58 57 0.00% 59 57 0.00% 60 68 0.00% 61 63 0.00% 62 72 0.00% 63 82 0.00% 64 76 0.00% 65 98 0.00% 66 128 0.00% 67 133 0.00% 68 124 0.00% 69 160 0.00% 70 191 0.00% 71 201 0.00% 72 230 0.00% 73 250 0.00% 74 293 0.00% 75 332 0.00% 76 402 0.00% 77 402 0.00% 78 438 0.00% 79 504 0.00% 80 613 0.00% 81 670 0.00% 82 780 0.01% 83 985 0.01% 84 1710 0.01% 85 2297 0.02% 86 2512 0.02% 87 2943 0.02% 88 3089 0.02% 89 3118 0.02% 90 3115 0.02% 91 3194 0.02% 92 3477 0.02% 93 3456 0.02% 94 3697 0.03% 95 3742 0.03% 96 4097 0.03% 97 4282 0.03% 98 4463 0.03% 99 4827 0.03% 100 5014 0.03% 101 5443 0.04% 102 5740 0.04% 103 6014 0.04% 104 6472 0.04% 105 7033 0.05% 106 7489 0.05% 107 7815 0.05% 108 8337 0.06% 109 8842 0.06% 110 9416 0.06% 111 9949 0.07% 112 10680 0.07% 113 11162 0.08% 114 11817 0.08% 115 12585 0.09% 116 13012 0.09% 117 13776 0.09% 118 14058 0.10% 119 14692 0.10% 120 15483 0.11% 121 16551 0.11% 122 17154 0.12% 123 18176 0.12% 124 19246 0.13% 125 20200 0.14% 126 21419 0.15% 127 22321 0.15% 128 22997 0.16% 129 24457 0.17% 130 26128 0.18% 131 27618 0.19% 132 29137 0.20% 133 31603 0.22% 134 33758 0.23% 135 35903 0.24% 136 38289 0.26% 137 41667 0.28% 138 44855 0.31% 139 48517 0.33% 140 53503 0.36% 141 60058 0.41% 142 67557 0.46% 143 78406 0.53% 144 92483 0.63% 145 114812 0.78% 146 148939 1.01% 147 210309 1.43% 148 337774 2.30% 149 712347 4.85% 150 3517983 23.95% 151 8487556 57.78% 14688438 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=3.35 fanout-score-rank=30 prefix-density=0.46 prefix-fanout=2.9 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.04 sequence-density-rank=37 fanout-score=37.54 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=5.4 sequence=CAAGAACAAAGATCATGCCACCAAA criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=38 prefix-density=0.71 prefix-fanout=2.1 sequence=GGCAGTGGCTGCAAATGTGGCATGTACCCTGACTTAGGTTTCTCAGAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=108.55 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=10.3 sequence=GAAAAATGGCGACTCCAATGAAGTACATTTGCTTGTTTATGTTTCTTGCAATTCTCAGCATTGCTGGGCTCAATCAAGTTGACGGGGCTGGTGAATGTGGGAAAAACACCACTCCTGACATGGAGGCTTTCAAGATGGCTCCTTGTGCATCAGCAGCACAGGATGAGAATTCTTCAGTTTCGAGCCAGTGCTGCGCTCGGGTGAAGAAAATTGGACAGAACCCAGCGTGCCTTTGTGCTGTTATGCTTTCCAACACTGCTAAGAGCTCTGGAATCAAGCCAGAAATTGCAATGACCATTCCCAAACGATGCAACATTGCTGATCGTCCTGTGGGCTACAAGTGTGGAGCTTATACTTTACCTTGAAGAGTGAAGACCATGAACTGTGCTCGCCCTGTAAAGTACTTTCTATCAACCTG SRR7171931 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 03:07:55 Started mapping on | Feb 14 03:08:56 Finished on | Feb 14 03:10:58 Mapping speed, Million of reads per hour | 433.43 Number of input reads | 14688438 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13513319 Uniquely mapped reads % | 92.00% Average mapped length | 296.85 Number of splices: Total | 13496759 Number of splices: Annotated (sjdb) | 13216383 Number of splices: GT/AG | 13272806 Number of splices: GC/AG | 171300 Number of splices: AT/AC | 11470 Number of splices: Non-canonical | 41183 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.66 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 353269 % of reads mapped to multiple loci | 2.41% Number of reads mapped to too many loci | 59192 % of reads mapped to too many loci | 0.40% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.10% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 839703 839703 839703 N_multimapping 353269 353269 353269 N_noFeature 373022 13361673 457429 N_ambiguous 144744 1084 76745 UnstrandedReadsAssigned:12995553 PositiveStrandReadsAssigned:150562 NegativeStrandReadsAssigned:12979145 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171931 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171931-trimmed-pair1.fastq SRR7171931-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,688,438 reads, 12,828,799 reads pseudoaligned [quant] estimated average fragment length: 260.034 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,142 rounds 52401 SRR7171931.ke.tsv 34699 SRR7171931.se.tsv 87100 total ==> SRR7171931.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1758.97 1155 45.8468 Potri.005G024800.1.v4.1 1035 775.966 130 11.6973 Potri.004G059700.1.v4.1 961 701.971 16 1.59142 Potri.007G009000.2.v4.1 1416 1156.97 0 0 Potri.003G141000.2.v4.1 2943 2683.97 374 9.72924 Potri.016G087400.1.v4.1 270 67.653 770 794.672 Potri.015G069301.1.v4.1 564 309.202 0 0 Potri.010G195200.1.v4.1 1773 1513.97 187 8.62402 Potri.012G127500.1.v4.1 977 717.971 11712 1138.96 ==> SRR7171931.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 93 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 375 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 316 SRR7171931 completed mapping pipeline successfully