Starting /dee2/code/volunteer_pipeline.sh SRR7171932 current disk space = 3087984947200 free memory = 1450072900 SRR7171932 SRAfilesize 30835913fd98a7ffe71a69720d7eaba0 SRR7171932.sra SRR7171932.sra file validated SRR7171932 is paired end SRR7171932 is conventional basespace SRR7171932 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171932_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.2845 18.0 18.0 25.0 18.0 32.0 2 22.3525 18.0 18.0 25.0 18.0 31.0 3 24.7995 27.0 18.0 27.0 18.0 32.0 4 27.98525 30.0 27.0 32.0 15.0 33.0 5 31.03575 32.0 32.0 33.0 27.0 33.0 6 34.56175 36.0 34.0 37.0 29.0 38.0 7 36.26825 38.0 36.0 38.0 33.0 38.0 8 36.28125 38.0 36.0 38.0 33.0 38.0 9 36.851 38.0 37.0 38.0 34.0 38.0 10-14 37.228500000000004 38.0 38.0 38.0 36.2 38.0 15-19 37.37555 38.0 38.0 38.0 37.0 38.0 20-24 37.43635 38.0 38.0 38.0 37.0 38.0 25-29 37.41865 38.0 38.0 38.0 37.0 38.0 30-34 37.417950000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.4351 38.0 38.0 38.0 37.0 38.0 40-44 37.32234999999999 38.0 38.0 38.0 37.0 38.0 45-49 37.290800000000004 38.0 38.0 38.0 36.8 38.0 50-54 37.25825 38.0 38.0 38.0 36.6 38.0 55-59 37.153999999999996 38.0 38.0 38.0 36.0 38.0 60-64 37.12755 38.0 38.0 38.0 36.0 38.0 65-69 37.029849999999996 38.0 38.0 38.0 36.0 38.0 70-74 36.971199999999996 38.0 38.0 38.0 35.8 38.0 75-79 36.970299999999995 38.0 38.0 38.0 35.8 38.0 80-84 36.8717 38.0 38.0 38.0 35.0 38.0 85-89 36.81055 38.0 38.0 38.0 34.8 38.0 90-94 36.6454 38.0 38.0 38.0 34.0 38.0 95-99 36.613600000000005 38.0 38.0 38.0 34.2 38.0 100-104 36.52334999999999 38.0 38.0 38.0 34.0 38.0 105-109 36.3606 38.0 37.2 38.0 34.0 38.0 110-114 36.1977 38.0 37.0 38.0 33.4 38.0 115-119 35.959849999999996 38.0 37.0 38.0 32.6 38.0 120-124 35.92954999999999 38.0 37.0 38.0 32.8 38.0 125-129 35.58575 38.0 36.2 38.0 31.0 38.0 130-134 35.37065 38.0 36.0 38.0 29.8 38.0 135-139 35.16904999999999 38.0 35.4 38.0 29.0 38.0 140-144 34.86895 38.0 35.0 38.0 28.0 38.0 145-149 34.133799999999994 38.0 34.8 38.0 25.4 38.0 150-151 30.757875 36.5 29.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 2.0 16 0.0 17 0.0 18 1.0 19 2.0 20 5.0 21 2.0 22 0.0 23 3.0 24 5.0 25 8.0 26 11.0 27 19.0 28 14.0 29 37.0 30 41.0 31 49.0 32 70.0 33 127.0 34 208.0 35 427.0 36 1131.0 37 1834.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 17.974999999999998 27.200000000000003 13.3 41.525 2 14.328582145536384 23.63090772693173 36.00900225056264 26.03150787696924 3 19.1 25.275 25.45 30.175 4 20.974999999999998 35.525 21.95 21.55 5 21.8 34.825 23.425 19.950000000000003 6 17.424999999999997 35.925000000000004 25.025 21.625 7 14.05 23.3 43.375 19.275000000000002 8 18.175 21.9 29.75 30.175 9 17.75 22.400000000000002 31.324999999999996 28.525 10-14 19.57 29.4 27.045 23.985 15-19 19.31 28.835 27.775 24.08 20-24 19.62 28.565 28.01 23.805 25-29 19.580000000000002 28.465 27.775 24.18 30-34 19.950000000000003 27.894999999999996 28.305000000000003 23.849999999999998 35-39 19.794999999999998 28.605000000000004 27.51 24.09 40-44 19.875 28.310000000000002 27.905 23.91 45-49 20.080000000000002 28.105000000000004 27.900000000000002 23.915 50-54 19.605 29.13 27.01 24.255 55-59 19.865 28.455000000000002 27.61 24.07 60-64 19.775000000000002 27.900000000000002 27.96 24.365000000000002 65-69 20.255000000000003 28.095 28.139999999999997 23.51 70-74 19.84 27.57 28.08 24.51 75-79 20.205000000000002 28.26 27.735 23.799999999999997 80-84 20.315 28.485 27.47 23.73 85-89 19.8 28.405 27.534999999999997 24.26 90-94 20.185 27.71 27.839999999999996 24.265 95-99 20.064999999999998 27.96 27.66 24.315 100-104 20.385 26.924999999999997 28.96 23.73 105-109 20.105 28.675 27.61 23.61 110-114 19.96 28.42 27.755000000000003 23.865 115-119 20.705000000000002 27.295 27.900000000000002 24.099999999999998 120-124 20.225 28.084999999999997 27.415 24.275 125-129 20.015 27.639999999999997 28.265 24.08 130-134 20.369999999999997 28.549999999999997 27.605 23.474999999999998 135-139 20.765 27.834999999999997 27.544999999999998 23.855 140-144 20.580000000000002 27.41 28.07 23.94 145-149 20.575 27.779999999999998 27.97 23.674999999999997 150-151 20.962500000000002 26.8125 27.5125 24.712500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 1.0 23 1.0 24 1.0 25 1.0 26 2.5 27 6.0 28 9.0 29 12.0 30 16.5 31 27.0 32 37.5 33 38.5 34 45.5 35 70.5 36 85.0 37 103.0 38 139.0 39 165.5 40 189.0 41 223.5 42 263.0 43 280.5 44 272.0 45 291.0 46 278.5 47 250.0 48 234.0 49 192.5 50 161.0 51 137.0 52 109.0 53 83.5 54 71.5 55 54.5 56 43.0 57 32.5 58 19.5 59 11.5 60 10.5 61 9.5 62 3.5 63 1.5 64 1.5 65 2.0 66 2.0 67 1.5 68 1.5 69 1.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.36250000000000004 0.0 0.0 0.0 0.0 114-115 0.4375 0.0 0.0 0.0 0.0 116-117 0.4625 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.5375000000000001 0.0 0.0 0.0 0.0 122-123 0.5874999999999999 0.0 0.0 0.0 0.0 124-125 0.7 0.0 0.0 0.0 0.0 126-127 0.7875000000000001 0.0 0.0 0.0 0.0 128-129 0.925 0.0 0.0 0.0 0.0 130-131 1.1124999999999998 0.0 0.0 0.0 0.0 132-133 1.2125 0.0 0.0 0.0 0.0 134-135 1.35 0.0 0.0 0.0 0.0 136-137 1.6 0.0 0.0 0.0 0.0 138-139 1.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 35 3.5374105E-6 29.0 135-139 GGGGGGG 35 0.0035366106 20.714287 95-99 >>END_MODULE SRR7171932 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171932_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.98275 33.0 33.0 34.0 32.0 34.0 2 33.1125 34.0 33.0 34.0 32.0 34.0 3 33.133 34.0 33.0 34.0 33.0 34.0 4 33.131 34.0 33.0 34.0 33.0 34.0 5 33.05575 34.0 33.0 34.0 33.0 34.0 6 37.249 38.0 38.0 38.0 37.0 38.0 7 37.27325 38.0 38.0 38.0 37.0 38.0 8 37.24375 38.0 38.0 38.0 37.0 38.0 9 37.30625 38.0 38.0 38.0 37.0 38.0 10-14 37.17165 38.0 38.0 38.0 37.0 38.0 15-19 37.12455 38.0 38.0 38.0 37.0 38.0 20-24 37.1765 38.0 38.0 38.0 37.0 38.0 25-29 37.1668 38.0 38.0 38.0 37.0 38.0 30-34 37.15795 38.0 38.0 38.0 37.0 38.0 35-39 37.030100000000004 38.0 38.0 38.0 36.4 38.0 40-44 36.92655 38.0 38.0 38.0 36.2 38.0 45-49 37.01025 38.0 38.0 38.0 36.0 38.0 50-54 36.9812 38.0 38.0 38.0 36.0 38.0 55-59 36.9442 38.0 38.0 38.0 36.0 38.0 60-64 36.8781 38.0 38.0 38.0 35.6 38.0 65-69 36.8566 38.0 38.0 38.0 35.8 38.0 70-74 36.7951 38.0 38.0 38.0 35.4 38.0 75-79 36.785250000000005 38.0 38.0 38.0 35.2 38.0 80-84 36.626400000000004 38.0 38.0 38.0 34.8 38.0 85-89 36.543949999999995 38.0 38.0 38.0 34.0 38.0 90-94 36.502250000000004 38.0 38.0 38.0 34.4 38.0 95-99 36.30475 38.0 38.0 38.0 34.0 38.0 100-104 36.11965 38.0 37.6 38.0 33.6 38.0 105-109 35.99205 38.0 37.0 38.0 33.0 38.0 110-114 35.8831 38.0 37.0 38.0 33.0 38.0 115-119 35.713499999999996 38.0 37.0 38.0 31.4 38.0 120-124 35.47975 38.0 36.4 38.0 30.6 38.0 125-129 35.2784 38.0 36.0 38.0 30.2 38.0 130-134 34.89125 38.0 35.4 38.0 27.8 38.0 135-139 34.73945 38.0 35.0 38.0 27.6 38.0 140-144 34.242000000000004 38.0 35.0 38.0 24.0 38.0 145-149 33.74495 38.0 34.6 38.0 21.2 38.0 150-151 30.179875000000003 36.0 29.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 3.0 5 1.0 6 1.0 7 0.0 8 2.0 9 2.0 10 1.0 11 1.0 12 2.0 13 3.0 14 3.0 15 2.0 16 1.0 17 2.0 18 4.0 19 6.0 20 6.0 21 8.0 22 5.0 23 7.0 24 13.0 25 11.0 26 15.0 27 29.0 28 26.0 29 30.0 30 46.0 31 57.0 32 61.0 33 92.0 34 176.0 35 291.0 36 723.0 37 2368.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.025000000000006 15.950000000000001 17.525 29.5 2 25.0 23.799999999999997 34.5 16.7 3 21.425 27.0 30.85 20.724999999999998 4 23.974999999999998 35.825 21.65 18.55 5 24.175 36.775000000000006 21.15 17.9 6 19.35 37.175000000000004 24.275 19.2 7 18.175 17.575 41.575 22.675 8 20.825 23.65 27.474999999999998 28.050000000000004 9 21.55 25.4 28.65 24.4 10-14 22.99 28.355000000000004 26.58 22.075 15-19 22.919999999999998 27.87 27.860000000000003 21.349999999999998 20-24 22.865 28.64 27.145000000000003 21.349999999999998 25-29 22.55 28.605000000000004 27.755000000000003 21.09 30-34 22.634712563166058 28.298393956071443 28.053234602491617 21.013658878270878 35-39 22.46104514254221 27.791973545768826 27.882158424770783 21.86482288691818 40-44 22.833500501504513 27.833500501504517 27.803410230692077 21.529588766298897 45-49 22.455 28.125 27.905 21.515 50-54 23.125 28.189999999999998 28.035 20.65 55-59 23.294999999999998 27.685 28.21 20.810000000000002 60-64 23.474999999999998 28.634999999999998 27.650000000000002 20.24 65-69 23.73 28.405 27.235 20.630000000000003 70-74 23.724999999999998 28.605000000000004 27.205000000000002 20.465 75-79 23.465 28.37 27.29 20.875 80-84 24.48 28.34 26.86 20.32 85-89 24.044999999999998 28.294999999999998 27.095000000000002 20.565 90-94 23.9 28.139999999999997 27.51 20.45 95-99 23.669999999999998 27.865000000000002 28.015 20.45 100-104 23.875 28.12 27.88 20.125 105-109 23.785 28.51 27.68 20.025000000000002 110-114 24.060000000000002 27.634999999999998 27.83 20.474999999999998 115-119 24.25 27.63 27.544999999999998 20.575 120-124 23.5 27.825 27.97 20.705000000000002 125-129 24.025 28.23 27.805000000000003 19.939999999999998 130-134 24.265 27.685 27.615000000000002 20.435 135-139 24.34 28.38 27.189999999999998 20.09 140-144 24.135 28.060000000000002 27.595 20.21 145-149 24.63 28.655 26.400000000000002 20.315 150-151 23.974999999999998 28.812500000000004 27.275 19.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.5 24 2.5 25 2.0 26 2.5 27 5.5 28 5.0 29 5.5 30 10.5 31 15.5 32 21.0 33 28.5 34 37.5 35 55.5 36 75.0 37 96.0 38 128.0 39 163.0 40 196.5 41 224.5 42 253.5 43 285.5 44 308.0 45 313.0 46 297.0 47 256.5 48 227.0 49 204.5 50 169.0 51 146.0 52 121.0 53 96.5 54 66.5 55 44.0 56 36.0 57 30.5 58 23.5 59 12.0 60 7.0 61 5.5 62 6.5 63 4.5 64 4.0 65 3.0 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.065 35-39 0.20500000000000002 40-44 0.3 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77443609022556 99.52499999999999 2 0.20050125313283207 0.4 3 0.02506265664160401 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.2875 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.38749999999999996 0.0 0.0 0.0 0.0 114-115 0.4625 0.0 0.0 0.0 0.0 116-117 0.4875 0.0 0.0 0.0 0.0 118-119 0.525 0.0 0.0 0.0 0.0 120-121 0.5625 0.0 0.0 0.0 0.0 122-123 0.6125 0.0 0.0 0.0 0.0 124-125 0.725 0.0 0.0 0.0 0.0 126-127 0.8125 0.0 0.0 0.0 0.0 128-129 0.975 0.0 0.0 0.0 0.0 130-131 1.1625 0.0 0.0 0.0 0.0 132-133 1.275 0.0 0.0 0.0 0.0 134-135 1.4375 0.0 0.0 0.0 0.0 136-137 1.7 0.0 0.0 0.0 0.0 138-139 1.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 619319 spots for SRR7171932.sra Written 619319 spots for SRR7171932.sra Read 619319 spots for SRR7171932.sra Written 619319 spots for SRR7171932.sra Read 619319 spots for SRR7171932.sra Written 619319 spots for SRR7171932.sra Read 619319 spots for SRR7171932.sra Written 619319 spots for SRR7171932.sra Read 619319 spots for SRR7171932.sra Written 619319 spots for SRR7171932.sra Read 619319 spots for SRR7171932.sra Written 619319 spots for SRR7171932.sra Read 619319 spots for SRR7171932.sra Written 619319 spots for SRR7171932.sra Read 619319 spots for SRR7171932.sra Written 619319 spots for SRR7171932.sra Read 619319 spots for SRR7171932.sra Written 619319 spots for SRR7171932.sra Read 619319 spots for SRR7171932.sra Written 619319 spots for SRR7171932.sra Read 619319 spots for SRR7171932.sra Written 619319 spots for SRR7171932.sra Read 619319 spots for SRR7171932.sra Written 619319 spots for SRR7171932.sra Read 619319 spots for SRR7171932.sra Written 619319 spots for SRR7171932.sra Read 619319 spots for SRR7171932.sra Written 619319 spots for SRR7171932.sra Read 619319 spots for SRR7171932.sra Written 619319 spots for SRR7171932.sra Read 619319 spots for SRR7171932.sra Written 619319 spots for SRR7171932.sra Read 619319 spots for SRR7171932.sra Written 619319 spots for SRR7171932.sra Read 619319 spots for SRR7171932.sra Written 619319 spots for SRR7171932.sra Read 619319 spots for SRR7171932.sra Written 619319 spots for SRR7171932.sra Read 619319 spots for SRR7171932.sra Written 619319 spots for SRR7171932.sra SRR ids: ['SRR7171932.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_89cq6leb SRR7171932.sra spots: 12386380 blocks: [[1, 619319], [619320, 1238638], [1238639, 1857957], [1857958, 2477276], [2477277, 3096595], [3096596, 3715914], [3715915, 4335233], [4335234, 4954552], [4954553, 5573871], [5573872, 6193190], [6193191, 6812509], [6812510, 7431828], [7431829, 8051147], [8051148, 8670466], [8670467, 9289785], [9289786, 9909104], [9909105, 10528423], [10528424, 11147742], [11147743, 11767061], [11767062, 12386380]] SRR7171932 file size 4175637 SRR7171932 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171932 SRR7171932_1.fastq SRR7171932_2.fastq Input file: SRR7171932_1.fastq Paired file: SRR7171932_2.fastq trimmed: SRR7171932-trimmed-pair1.fastq, SRR7171932-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 02:07:37 2025 >> started Fri Feb 14 02:07:51 2025 >> done (14.028s) 12386380 read pairs processed; of these: 10829 ( 0.09%) short read pairs filtered out after trimming by size control 8862 ( 0.07%) empty read pairs filtered out after trimming by size control 12366689 (99.84%) read pairs available; of these: 5324616 (43.06%) trimmed read pairs available after processing 7042073 (56.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 2 0.00% 21 4 0.00% 22 2 0.00% 23 2 0.00% 24 2 0.00% 25 5 0.00% 26 1 0.00% 27 0 0.00% 28 5 0.00% 29 1 0.00% 30 1 0.00% 31 3 0.00% 32 2 0.00% 33 3 0.00% 34 3 0.00% 35 3 0.00% 36 1 0.00% 37 5 0.00% 38 4 0.00% 39 1 0.00% 40 4 0.00% 41 4 0.00% 42 4 0.00% 43 4 0.00% 44 4 0.00% 45 3 0.00% 46 6 0.00% 47 6 0.00% 48 10 0.00% 49 4 0.00% 50 8 0.00% 51 6 0.00% 52 9 0.00% 53 16 0.00% 54 12 0.00% 55 27 0.00% 56 17 0.00% 57 24 0.00% 58 38 0.00% 59 35 0.00% 60 20 0.00% 61 46 0.00% 62 47 0.00% 63 55 0.00% 64 51 0.00% 65 60 0.00% 66 67 0.00% 67 71 0.00% 68 93 0.00% 69 105 0.00% 70 137 0.00% 71 137 0.00% 72 142 0.00% 73 163 0.00% 74 189 0.00% 75 229 0.00% 76 305 0.00% 77 274 0.00% 78 298 0.00% 79 327 0.00% 80 374 0.00% 81 438 0.00% 82 514 0.00% 83 653 0.01% 84 1126 0.01% 85 1455 0.01% 86 1551 0.01% 87 1753 0.01% 88 1894 0.02% 89 1885 0.02% 90 1943 0.02% 91 2128 0.02% 92 2201 0.02% 93 2259 0.02% 94 2477 0.02% 95 2471 0.02% 96 2595 0.02% 97 2820 0.02% 98 2953 0.02% 99 3095 0.03% 100 3373 0.03% 101 3561 0.03% 102 3826 0.03% 103 4022 0.03% 104 4376 0.04% 105 4527 0.04% 106 4797 0.04% 107 5104 0.04% 108 5422 0.04% 109 5788 0.05% 110 6110 0.05% 111 6479 0.05% 112 6832 0.06% 113 7301 0.06% 114 7891 0.06% 115 8406 0.07% 116 8838 0.07% 117 8981 0.07% 118 9518 0.08% 119 9987 0.08% 120 10787 0.09% 121 11347 0.09% 122 11939 0.10% 123 12723 0.10% 124 13436 0.11% 125 14174 0.11% 126 15569 0.13% 127 16139 0.13% 128 17077 0.14% 129 18381 0.15% 130 19379 0.16% 131 20594 0.17% 132 22291 0.18% 133 24270 0.20% 134 25721 0.21% 135 27813 0.22% 136 30413 0.25% 137 33444 0.27% 138 36697 0.30% 139 40640 0.33% 140 45097 0.36% 141 50823 0.41% 142 58832 0.48% 143 68409 0.55% 144 83022 0.67% 145 103596 0.84% 146 136714 1.11% 147 195618 1.58% 148 314277 2.54% 149 655816 5.30% 150 3024743 24.46% 151 7042073 56.94% 12366689 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=3.15 fanout-score-rank=24 prefix-density=0.46 prefix-fanout=2.2 sequence=CATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCA criterion=fanout-score sequence-density=0.10 sequence-density-rank=21 fanout-score=127.51 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=21.6 sequence=CCACCACCATGGGCT criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=31 prefix-density=0.53 prefix-fanout=2.2 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=107.89 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=7.5 sequence=TTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATA SRR7171932 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 02:08:38 Started mapping on | Feb 14 02:08:38 Finished on | Feb 14 02:10:15 Mapping speed, Million of reads per hour | 458.97 Number of input reads | 12366689 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 11674390 Uniquely mapped reads % | 94.40% Average mapped length | 297.13 Number of splices: Total | 12007893 Number of splices: Annotated (sjdb) | 11802911 Number of splices: GT/AG | 11816543 Number of splices: GC/AG | 151585 Number of splices: AT/AC | 8641 Number of splices: Non-canonical | 31124 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.51 Insertion rate per base | 0.02% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 324960 % of reads mapped to multiple loci | 2.63% Number of reads mapped to too many loci | 30373 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.66% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 378381 378381 378381 N_multimapping 324960 324960 324960 N_noFeature 249648 11565474 299513 N_ambiguous 125175 776 65574 UnstrandedReadsAssigned:11299567 PositiveStrandReadsAssigned:108140 NegativeStrandReadsAssigned:11309303 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171932 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171932-trimmed-pair1.fastq SRR7171932-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,366,689 reads, 11,166,687 reads pseudoaligned [quant] estimated average fragment length: 277.507 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,103 rounds 52401 SRR7171932.ke.tsv 34699 SRR7171932.se.tsv 87100 total ==> SRR7171932.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1741.49 817 38.4955 Potri.005G024800.1.v4.1 1035 758.493 152 16.4438 Potri.004G059700.1.v4.1 961 684.544 22 2.63713 Potri.007G009000.2.v4.1 1416 1139.49 1 0.0720109 Potri.003G141000.2.v4.1 2943 2666.49 436.331 13.4272 Potri.016G087400.1.v4.1 270 64.2795 814 1039.11 Potri.015G069301.1.v4.1 564 295.82 0 0 Potri.010G195200.1.v4.1 1773 1496.49 177 9.70529 Potri.012G127500.1.v4.1 977 700.538 2050 240.122 ==> SRR7171932.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 32 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 293 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 195 SRR7171932 completed mapping pipeline successfully