Starting /dee2/code/volunteer_pipeline.sh SRR7171933 current disk space = 3088015294464 free memory = 1450113704 SRR7171933 SRAfilesize 6efc91ac08da13101856ba2e14db665a SRR7171933.sra SRR7171933.sra file validated SRR7171933 is paired end SRR7171933 is conventional basespace SRR7171933 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171933_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.2335 18.0 18.0 18.0 18.0 25.0 2 22.43775 25.0 18.0 27.0 18.0 27.0 3 23.978 25.0 18.0 27.0 18.0 32.0 4 27.28525 29.0 27.0 30.0 15.0 31.0 5 29.7495 32.0 30.0 32.0 25.0 33.0 6 35.46825 37.0 35.0 38.0 31.0 38.0 7 36.825 38.0 37.0 38.0 35.0 38.0 8 36.84925 38.0 37.0 38.0 34.0 38.0 9 37.16 38.0 38.0 38.0 36.0 38.0 10-14 37.250600000000006 38.0 38.0 38.0 36.4 38.0 15-19 37.4153 38.0 38.0 38.0 37.0 38.0 20-24 37.43985 38.0 38.0 38.0 37.0 38.0 25-29 37.3745 38.0 38.0 38.0 37.0 38.0 30-34 37.362 38.0 38.0 38.0 37.0 38.0 35-39 37.29925 38.0 38.0 38.0 37.0 38.0 40-44 37.24550000000001 38.0 38.0 38.0 36.8 38.0 45-49 37.2476 38.0 38.0 38.0 36.8 38.0 50-54 37.161350000000006 38.0 38.0 38.0 36.2 38.0 55-59 37.089150000000004 38.0 38.0 38.0 36.0 38.0 60-64 37.046549999999996 38.0 38.0 38.0 36.0 38.0 65-69 36.950300000000006 38.0 38.0 38.0 35.8 38.0 70-74 36.898300000000006 38.0 38.0 38.0 35.4 38.0 75-79 36.85915 38.0 38.0 38.0 35.4 38.0 80-84 36.7324 38.0 38.0 38.0 34.8 38.0 85-89 36.61905 38.0 38.0 38.0 34.2 38.0 90-94 36.532399999999996 38.0 38.0 38.0 34.0 38.0 95-99 36.4755 38.0 38.0 38.0 34.0 38.0 100-104 36.2802 38.0 37.4 38.0 34.0 38.0 105-109 36.188250000000004 38.0 37.2 38.0 33.8 38.0 110-114 35.93435 38.0 37.0 38.0 32.4 38.0 115-119 35.743050000000004 38.0 36.8 38.0 31.4 38.0 120-124 35.61755000000001 38.0 36.8 38.0 31.0 38.0 125-129 35.48244999999999 38.0 36.0 38.0 30.6 38.0 130-134 35.09535 38.0 35.8 38.0 28.6 38.0 135-139 34.6811 38.0 35.0 38.0 27.4 38.0 140-144 34.5875 38.0 35.0 38.0 26.6 38.0 145-149 34.041 38.0 35.0 38.0 24.0 38.0 150-151 30.70325 36.5 31.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 2.0 9 1.0 10 2.0 11 0.0 12 1.0 13 1.0 14 1.0 15 3.0 16 3.0 17 2.0 18 6.0 19 1.0 20 5.0 21 2.0 22 4.0 23 5.0 24 11.0 25 19.0 26 9.0 27 19.0 28 25.0 29 29.0 30 41.0 31 60.0 32 74.0 33 115.0 34 211.0 35 387.0 36 1084.0 37 1876.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.4 5.525 19.575 31.5 2 22.8 16.6 36.575 24.025 3 21.15 23.9 28.425 26.525 4 23.849999999999998 30.0 22.75 23.400000000000002 5 22.125 33.2 24.275 20.4 6 19.225 34.825 25.8 20.150000000000002 7 15.0 23.125 43.625 18.25 8 17.95 23.599999999999998 29.775000000000002 28.675 9 18.175 23.225 32.525 26.075 10-14 20.09 28.38 27.3 24.23 15-19 20.14 27.689999999999998 28.075 24.095 20-24 20.119999999999997 27.405 28.585 23.89 25-29 20.28 28.29 28.025 23.405 30-34 19.759999999999998 28.07 28.175 23.995 35-39 20.61 27.41 28.51 23.47 40-44 20.345 28.32 27.405 23.93 45-49 20.595 28.18 27.655 23.57 50-54 20.085 28.13 27.495000000000005 24.29 55-59 20.44 28.105000000000004 27.810000000000002 23.645 60-64 20.465 28.235 27.11 24.19 65-69 20.51 27.625 27.950000000000003 23.915 70-74 20.185 27.715 28.59 23.51 75-79 20.075000000000003 28.134999999999998 27.560000000000002 24.23 80-84 20.39 28.015 27.750000000000004 23.845 85-89 20.78 27.495000000000005 28.435 23.29 90-94 20.51 27.765 27.97 23.755000000000003 95-99 20.48 27.765 27.589999999999996 24.165 100-104 20.974999999999998 27.235 27.939999999999998 23.849999999999998 105-109 20.315 27.800000000000004 27.860000000000003 24.025 110-114 20.674999999999997 27.705000000000002 27.595 24.025 115-119 21.060000000000002 27.834999999999997 27.24 23.865 120-124 20.465 27.834999999999997 27.595 24.104999999999997 125-129 20.79 27.485 27.355 24.37 130-134 21.455 27.43 27.284999999999997 23.830000000000002 135-139 21.08 27.43 27.79 23.7 140-144 21.17 27.265 27.87 23.695 145-149 20.765 27.785 27.200000000000003 24.25 150-151 21.099999999999998 28.6625 25.5375 24.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.5 16 1.0 17 0.5 18 0.5 19 1.0 20 1.0 21 0.5 22 1.0 23 2.5 24 1.5 25 1.0 26 2.0 27 8.0 28 11.5 29 9.5 30 17.0 31 20.5 32 25.0 33 36.0 34 48.5 35 68.0 36 80.5 37 94.5 38 128.0 39 162.0 40 175.0 41 197.0 42 236.5 43 252.0 44 262.5 45 285.0 46 275.0 47 254.0 48 241.5 49 207.5 50 180.0 51 156.0 52 128.5 53 104.0 54 75.0 55 56.0 56 41.5 57 35.5 58 27.5 59 20.0 60 18.0 61 10.5 62 5.5 63 3.5 64 6.0 65 8.5 66 6.0 67 3.0 68 1.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.5249999999999999 0.0 0.0 0.0 0.0 106-107 0.6625 0.0 0.0 0.0 0.0 108-109 0.7375 0.0 0.0 0.0 0.0 110-111 0.8625 0.0 0.0 0.0 0.0 112-113 0.9625 0.0 0.0 0.0 0.0 114-115 1.0499999999999998 0.0 0.0 0.0 0.0 116-117 1.225 0.0 0.0 0.0 0.0 118-119 1.4375 0.0 0.0 0.0 0.0 120-121 1.6625 0.0 0.0 0.0 0.0 122-123 1.9375 0.0 0.0 0.0 0.0 124-125 2.0999999999999996 0.0 0.0 0.0 0.0 126-127 2.325 0.0 0.0 0.0 0.0 128-129 2.4749999999999996 0.0 0.0 0.0 0.0 130-131 2.7 0.0 0.0 0.0 0.0 132-133 2.95 0.0 0.0 0.0 0.0 134-135 3.25 0.0 0.0 0.0 0.0 136-137 3.4875 0.0 0.0 0.0 0.0 138-139 3.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAACAA 10 0.006830828 145.0 8 GTAGTGA 10 0.006830828 145.0 1 >>END_MODULE SRR7171933 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171933_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.75775 33.0 33.0 34.0 32.0 34.0 2 32.88075 33.0 33.0 34.0 32.0 34.0 3 32.88375 33.0 33.0 34.0 32.0 34.0 4 32.8545 34.0 33.0 34.0 32.0 34.0 5 32.858 34.0 33.0 34.0 32.0 34.0 6 37.027 38.0 38.0 38.0 36.0 38.0 7 37.05875 38.0 38.0 38.0 37.0 38.0 8 37.1065 38.0 38.0 38.0 37.0 38.0 9 37.05825 38.0 38.0 38.0 37.0 38.0 10-14 36.90325 38.0 38.0 38.0 35.8 38.0 15-19 36.854949999999995 38.0 38.0 38.0 36.0 38.0 20-24 36.924850000000006 38.0 38.0 38.0 36.0 38.0 25-29 36.8728 38.0 38.0 38.0 36.0 38.0 30-34 36.8026 38.0 38.0 38.0 36.0 38.0 35-39 36.400400000000005 38.0 38.0 38.0 34.8 38.0 40-44 36.3214 38.0 38.0 38.0 34.4 38.0 45-49 36.70765 38.0 38.0 38.0 35.4 38.0 50-54 36.694050000000004 38.0 38.0 38.0 35.4 38.0 55-59 36.61555 38.0 38.0 38.0 35.0 38.0 60-64 36.5701 38.0 38.0 38.0 34.6 38.0 65-69 36.54415 38.0 38.0 38.0 34.6 38.0 70-74 36.421949999999995 38.0 38.0 38.0 34.2 38.0 75-79 36.40155 38.0 38.0 38.0 34.0 38.0 80-84 36.37859999999999 38.0 38.0 38.0 34.2 38.0 85-89 36.12555 38.0 38.0 38.0 33.6 38.0 90-94 36.063900000000004 38.0 37.8 38.0 33.4 38.0 95-99 35.903949999999995 38.0 37.4 38.0 33.0 38.0 100-104 35.78135000000001 38.0 37.0 38.0 31.8 38.0 105-109 35.62595 38.0 37.0 38.0 31.4 38.0 110-114 35.46145 38.0 37.0 38.0 30.6 38.0 115-119 35.33295 38.0 36.8 38.0 30.6 38.0 120-124 34.91665 38.0 36.0 38.0 28.0 38.0 125-129 34.687949999999994 38.0 35.8 38.0 26.6 38.0 130-134 34.550799999999995 38.0 35.2 38.0 26.4 38.0 135-139 34.09715 38.0 35.0 38.0 23.6 38.0 140-144 33.85435 38.0 35.0 38.0 22.2 38.0 145-149 33.339600000000004 38.0 34.6 38.0 18.4 38.0 150-151 29.47775 36.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 4.0 4 0.0 5 1.0 6 0.0 7 3.0 8 3.0 9 3.0 10 2.0 11 3.0 12 3.0 13 0.0 14 4.0 15 4.0 16 7.0 17 3.0 18 10.0 19 4.0 20 8.0 21 7.0 22 8.0 23 12.0 24 11.0 25 23.0 26 12.0 27 35.0 28 42.0 29 29.0 30 49.0 31 70.0 32 76.0 33 112.0 34 176.0 35 309.0 36 635.0 37 2319.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.825 18.625 15.475 23.075000000000003 2 24.375 24.8 31.6 19.225 3 21.4 27.750000000000004 30.8 20.05 4 24.875 33.525 21.675 19.925 5 23.225 37.7 21.025 18.05 6 20.95 35.575 24.05 19.425 7 20.375 19.3 38.550000000000004 21.775 8 21.875 23.9 26.900000000000002 27.325 9 21.975 25.95 28.1 23.974999999999998 10-14 22.634999999999998 28.9 26.575 21.89 15-19 23.03 28.384999999999998 27.450000000000003 21.135 20-24 23.05 28.21 27.894999999999996 20.845 25-29 23.005 28.335 27.165 21.495 30-34 23.226097414311486 28.327320104229305 27.084586089396673 21.361996392062537 35-39 23.102977604772256 28.648703301147567 27.248369647641674 20.9999494464385 40-44 22.940373236231224 28.0230617508724 27.66904364537501 21.367521367521366 45-49 23.645 27.63 27.415 21.310000000000002 50-54 22.900000000000002 27.985 27.825 21.29 55-59 23.419999999999998 27.389999999999997 27.85 21.34 60-64 23.635 27.900000000000002 27.095000000000002 21.37 65-69 23.09 28.185 27.275 21.45 70-74 23.69 28.139999999999997 27.05 21.12 75-79 23.810000000000002 28.134999999999998 27.245 20.810000000000002 80-84 24.32 27.55 27.055 21.075 85-89 23.82 28.435 27.125 20.62 90-94 23.385 28.395 27.26 20.96 95-99 23.65 28.26 26.935 21.154999999999998 100-104 23.965 28.095 27.175 20.765 105-109 23.974999999999998 27.955000000000002 27.224999999999998 20.845 110-114 24.099999999999998 27.544999999999998 27.315 21.04 115-119 23.665 28.060000000000002 27.575 20.7 120-124 24.310000000000002 27.515 27.525 20.65 125-129 24.54 27.744999999999997 27.089999999999996 20.625 130-134 24.635 27.339999999999996 27.13 20.895 135-139 24.21 27.82 27.485 20.485 140-144 24.535 28.465 26.840000000000003 20.16 145-149 24.169999999999998 27.775 27.455000000000002 20.599999999999998 150-151 23.962500000000002 27.975 28.0875 19.975 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 1.0 20 0.0 21 0.0 22 1.0 23 1.5 24 1.0 25 2.0 26 3.5 27 5.5 28 7.5 29 7.5 30 8.0 31 14.0 32 20.0 33 29.0 34 43.5 35 55.0 36 66.0 37 93.0 38 123.5 39 152.0 40 186.5 41 234.0 42 252.5 43 249.5 44 272.0 45 296.0 46 282.0 47 266.0 48 252.0 49 212.5 50 170.5 51 140.0 52 123.5 53 97.5 54 73.0 55 60.5 56 49.5 57 34.0 58 26.5 59 21.0 60 15.0 61 10.0 62 9.5 63 9.0 64 4.5 65 4.0 66 4.0 67 2.5 68 1.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.22 35-39 1.095 40-44 1.135 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59778783308195 99.05000000000001 2 0.301659125188537 0.6 3 0.07541478129713425 0.22499999999999998 4 0.0 0.0 5 0.025138260432378077 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.5249999999999999 0.0 0.0 0.0 0.0 106-107 0.6625 0.0 0.0 0.0 0.0 108-109 0.7375 0.0 0.0 0.0 0.0 110-111 0.8500000000000001 0.0 0.0 0.0 0.0 112-113 0.9375 0.0 0.0 0.0 0.0 114-115 1.0125 0.0 0.0 0.0 0.0 116-117 1.15 0.0 0.0 0.0 0.0 118-119 1.3625 0.0 0.0 0.0 0.0 120-121 1.6125 0.0 0.0 0.0 0.0 122-123 1.9 0.0 0.0 0.0 0.0 124-125 2.075 0.0 0.0 0.0 0.0 126-127 2.3 0.0 0.0 0.0 0.0 128-129 2.4875 0.0 0.0 0.0 0.0 130-131 2.7750000000000004 0.0 0.0 0.0 0.0 132-133 3.025 0.0 0.0 0.0 0.0 134-135 3.2750000000000004 0.0 0.0 0.0 0.0 136-137 3.5125 0.0 0.0 0.0 0.0 138-139 3.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTTTA 10 0.0068608476 144.78749 1 AGAGTGT 10 0.0068608476 144.78749 145 >>END_MODULE Read 787800 spots for SRR7171933.sra Written 787800 spots for SRR7171933.sra Read 787800 spots for SRR7171933.sra Written 787800 spots for SRR7171933.sra Read 787800 spots for SRR7171933.sra Written 787800 spots for SRR7171933.sra Read 787800 spots for SRR7171933.sra Written 787800 spots for SRR7171933.sra Read 787800 spots for SRR7171933.sra Written 787800 spots for SRR7171933.sra Read 787800 spots for SRR7171933.sra Written 787800 spots for SRR7171933.sra Read 787800 spots for SRR7171933.sra Written 787800 spots for SRR7171933.sra Read 787800 spots for SRR7171933.sra Written 787800 spots for SRR7171933.sra Read 787800 spots for SRR7171933.sra Written 787800 spots for SRR7171933.sra Read 787800 spots for SRR7171933.sra Written 787800 spots for SRR7171933.sra Read 787800 spots for SRR7171933.sra Written 787800 spots for SRR7171933.sra Read 787800 spots for SRR7171933.sra Written 787800 spots for SRR7171933.sra Read 787800 spots for SRR7171933.sra Written 787800 spots for SRR7171933.sra Read 787800 spots for SRR7171933.sra Written 787800 spots for SRR7171933.sra Read 787800 spots for SRR7171933.sra Written 787800 spots for SRR7171933.sra Read 787800 spots for SRR7171933.sra Written 787800 spots for SRR7171933.sra Read 787800 spots for SRR7171933.sra Written 787800 spots for SRR7171933.sra Read 787814 spots for SRR7171933.sra Written 787814 spots for SRR7171933.sra Read 787800 spots for SRR7171933.sra Written 787800 spots for SRR7171933.sra Read 787800 spots for SRR7171933.sra Written 787800 spots for SRR7171933.sra SRR ids: ['SRR7171933.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7k965ixq SRR7171933.sra spots: 15756014 blocks: [[1, 787800], [787801, 1575600], [1575601, 2363400], [2363401, 3151200], [3151201, 3939000], [3939001, 4726800], [4726801, 5514600], [5514601, 6302400], [6302401, 7090200], [7090201, 7878000], [7878001, 8665800], [8665801, 9453600], [9453601, 10241400], [10241401, 11029200], [11029201, 11817000], [11817001, 12604800], [12604801, 13392600], [13392601, 14180400], [14180401, 14968200], [14968201, 15756014]] SRR7171933 file size 5317495 SRR7171933 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171933 SRR7171933_1.fastq SRR7171933_2.fastq Input file: SRR7171933_1.fastq Paired file: SRR7171933_2.fastq trimmed: SRR7171933-trimmed-pair1.fastq, SRR7171933-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 02:15:06 2025 >> started Fri Feb 14 02:15:31 2025 >> done (25.201s) 15756014 read pairs processed; of these: 34833 ( 0.22%) short read pairs filtered out after trimming by size control 27853 ( 0.18%) empty read pairs filtered out after trimming by size control 15693328 (99.60%) read pairs available; of these: 6963076 (44.37%) trimmed read pairs available after processing 8730252 (55.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 4 0.00% 20 5 0.00% 21 8 0.00% 22 7 0.00% 23 12 0.00% 24 12 0.00% 25 11 0.00% 26 11 0.00% 27 16 0.00% 28 5 0.00% 29 9 0.00% 30 7 0.00% 31 11 0.00% 32 14 0.00% 33 8 0.00% 34 6 0.00% 35 11 0.00% 36 7 0.00% 37 10 0.00% 38 13 0.00% 39 10 0.00% 40 14 0.00% 41 18 0.00% 42 7 0.00% 43 12 0.00% 44 12 0.00% 45 19 0.00% 46 22 0.00% 47 33 0.00% 48 28 0.00% 49 27 0.00% 50 41 0.00% 51 44 0.00% 52 59 0.00% 53 45 0.00% 54 59 0.00% 55 60 0.00% 56 68 0.00% 57 67 0.00% 58 110 0.00% 59 102 0.00% 60 108 0.00% 61 112 0.00% 62 133 0.00% 63 152 0.00% 64 199 0.00% 65 201 0.00% 66 232 0.00% 67 210 0.00% 68 265 0.00% 69 299 0.00% 70 325 0.00% 71 402 0.00% 72 433 0.00% 73 486 0.00% 74 576 0.00% 75 640 0.00% 76 808 0.01% 77 867 0.01% 78 885 0.01% 79 941 0.01% 80 1238 0.01% 81 1356 0.01% 82 1578 0.01% 83 1796 0.01% 84 3275 0.02% 85 4221 0.03% 86 4726 0.03% 87 5336 0.03% 88 5330 0.03% 89 5281 0.03% 90 5560 0.04% 91 5803 0.04% 92 6015 0.04% 93 6316 0.04% 94 6486 0.04% 95 6803 0.04% 96 6991 0.04% 97 7377 0.05% 98 7792 0.05% 99 7974 0.05% 100 8591 0.05% 101 9162 0.06% 102 9852 0.06% 103 10428 0.07% 104 11175 0.07% 105 11917 0.08% 106 12557 0.08% 107 13226 0.08% 108 13470 0.09% 109 14030 0.09% 110 14812 0.09% 111 15909 0.10% 112 17140 0.11% 113 18340 0.12% 114 19581 0.12% 115 20222 0.13% 116 21076 0.13% 117 21706 0.14% 118 22393 0.14% 119 23009 0.15% 120 24199 0.15% 121 25004 0.16% 122 26613 0.17% 123 28497 0.18% 124 29515 0.19% 125 31378 0.20% 126 32458 0.21% 127 33701 0.21% 128 34731 0.22% 129 36298 0.23% 130 37815 0.24% 131 39847 0.25% 132 42983 0.27% 133 45717 0.29% 134 48735 0.31% 135 51969 0.33% 136 55153 0.35% 137 58397 0.37% 138 62980 0.40% 139 66958 0.43% 140 72881 0.46% 141 79550 0.51% 142 89353 0.57% 143 100998 0.64% 144 119379 0.76% 145 143406 0.91% 146 181357 1.16% 147 248391 1.58% 148 383018 2.44% 149 757752 4.83% 150 3554870 22.65% 151 8730252 55.63% 15693328 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=4.00 fanout-score-rank=27 prefix-density=0.75 prefix-fanout=1.7 sequence=TTCTCAGCACCGAAGTCCATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=23 fanout-score=46.92 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=12.8 sequence=TTCTTGATAAATTTCTTAATCTGTGTAAGAAACTGCTTCTTGTCAAATGGAGGTTGCTCCTGGAGCCTAAATGTGTCAACGATGTCAACAACCTTGGCAGCTTGGTCATCAACACCCTCATCCTCATCACCTCCTTCAGCTGAAGGATTTGCACCAATGTCTACATCAACGGCTCCTTGAACAACCCACTTTCCTTCAACTTCCCACAGTATCCCATTCTCAATCTCCTTGTATGGGAACGAATCCGAGAGAAGCTCATCACCAGAGAGAAGATCTTGATA criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=6.21 fanout-score-rank=20 prefix-density=0.34 prefix-fanout=4.5 sequence=GGTGCTGAGAATGGCTGCAAGTGTG criterion=fanout-score sequence-density=0.04 sequence-density-rank=33 fanout-score=35.34 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=11.2 sequence=TCTCTTCAATCCTTTTGTTGTGTGTTTTCTACTCTGCCTGATCACCATGACAGCCACCGAAGAAGCTGAAACTGAGGCTCCAGTCGTGGAGCAACCAACTGCTACGGAGGAGCCTAAGGTGGAGGAGAATCCCGTTAAAGGAAAGAGGCCAAGGACTCCCAG SRR7171933 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 02:16:21 Started mapping on | Feb 14 02:16:21 Finished on | Feb 14 02:18:38 Mapping speed, Million of reads per hour | 412.38 Number of input reads | 15693328 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 14267279 Uniquely mapped reads % | 90.91% Average mapped length | 295.10 Number of splices: Total | 13734658 Number of splices: Annotated (sjdb) | 13411067 Number of splices: GT/AG | 13495589 Number of splices: GC/AG | 179553 Number of splices: AT/AC | 11689 Number of splices: Non-canonical | 47827 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 371413 % of reads mapped to multiple loci | 2.37% Number of reads mapped to too many loci | 62380 % of reads mapped to too many loci | 0.40% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.24% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1085412 1085412 1085412 N_multimapping 371413 371413 371413 N_noFeature 428602 14129226 501650 N_ambiguous 144186 1410 78250 UnstrandedReadsAssigned:13694491 PositiveStrandReadsAssigned:136643 NegativeStrandReadsAssigned:13687379 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171933 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171933-trimmed-pair1.fastq SRR7171933-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,693,328 reads, 13,608,050 reads pseudoaligned [quant] estimated average fragment length: 252.994 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,204 rounds 52401 SRR7171933.ke.tsv 34699 SRR7171933.se.tsv 87100 total ==> SRR7171933.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.01 1527 59.0106 Potri.005G024800.1.v4.1 1035 783.006 222 19.3496 Potri.004G059700.1.v4.1 961 709.028 11 1.0588 Potri.007G009000.2.v4.1 1416 1164.01 0 0 Potri.003G141000.2.v4.1 2943 2691.01 468.221 11.8746 Potri.016G087400.1.v4.1 270 74.6023 613 560.778 Potri.015G069301.1.v4.1 564 317.463 0 0 Potri.010G195200.1.v4.1 1773 1521.01 525 23.5565 Potri.012G127500.1.v4.1 977 725.011 21061 1982.52 ==> SRR7171933.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 22 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 390 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 444 SRR7171933 completed mapping pipeline successfully