Starting /dee2/code/volunteer_pipeline.sh SRR7171934 current disk space = 3112603570176 free memory = 1571367408 SRR7171934 SRAfilesize 5cb4d36e0eded626c3543337f2ba94a3 SRR7171934.sra SRR7171934.sra file validated SRR7171934 is paired end SRR7171934 is conventional basespace SRR7171934 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171934_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.78725 33.0 33.0 34.0 32.0 34.0 2 32.8865 34.0 33.0 34.0 32.0 34.0 3 32.05925 33.0 33.0 33.0 29.0 34.0 4 32.41425 33.0 33.0 33.0 32.0 34.0 5 32.835 33.0 33.0 34.0 32.0 34.0 6 36.295 38.0 36.0 38.0 33.0 38.0 7 37.078 38.0 38.0 38.0 35.0 38.0 8 37.35075 38.0 38.0 38.0 37.0 38.0 9 37.54375 38.0 38.0 38.0 37.0 38.0 10-14 37.554899999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.5707 38.0 38.0 38.0 38.0 38.0 20-24 37.552499999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.5158 38.0 38.0 38.0 38.0 38.0 30-34 37.5003 38.0 38.0 38.0 37.6 38.0 35-39 37.504599999999996 38.0 38.0 38.0 37.8 38.0 40-44 37.48485000000001 38.0 38.0 38.0 37.4 38.0 45-49 37.45155 38.0 38.0 38.0 37.2 38.0 50-54 37.427749999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.3713 38.0 38.0 38.0 37.0 38.0 60-64 37.384499999999996 38.0 38.0 38.0 37.0 38.0 65-69 37.33415 38.0 38.0 38.0 37.0 38.0 70-74 37.2929 38.0 38.0 38.0 37.0 38.0 75-79 37.25295 38.0 38.0 38.0 37.0 38.0 80-84 37.194900000000004 38.0 38.0 38.0 36.2 38.0 85-89 37.204249999999995 38.0 38.0 38.0 36.2 38.0 90-94 37.1087 38.0 38.0 38.0 36.0 38.0 95-99 37.03545 38.0 38.0 38.0 36.0 38.0 100-104 36.96965 38.0 38.0 38.0 35.8 38.0 105-109 36.8521 38.0 38.0 38.0 35.0 38.0 110-114 36.77165 38.0 38.0 38.0 35.2 38.0 115-119 36.67595 38.0 38.0 38.0 34.4 38.0 120-124 36.542899999999996 38.0 38.0 38.0 34.0 38.0 125-129 36.287 38.0 37.8 38.0 33.8 38.0 130-134 36.212399999999995 38.0 37.8 38.0 33.6 38.0 135-139 36.172549999999994 38.0 37.8 38.0 33.2 38.0 140-144 35.8795 38.0 36.6 38.0 33.0 38.0 145-149 35.5298 38.0 36.0 38.0 32.0 38.0 150-151 32.798 37.0 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 2.0 20 2.0 21 2.0 22 1.0 23 4.0 24 2.0 25 8.0 26 7.0 27 21.0 28 15.0 29 25.0 30 30.0 31 39.0 32 52.0 33 64.0 34 104.0 35 179.0 36 483.0 37 2959.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.43892339544513 14.440993788819876 11.25776397515528 37.86231884057971 2 20.9 19.525000000000002 30.625000000000004 28.95 3 20.275000000000002 26.55 26.0 27.175 4 22.3 33.525 20.925 23.25 5 21.0 36.5 22.3 20.200000000000003 6 19.525000000000002 36.35 24.15 19.975 7 14.499999999999998 23.549999999999997 43.55 18.4 8 17.575 23.65 29.325000000000003 29.45 9 19.325 21.975 32.925 25.775 10-14 19.48 29.315 27.04 24.165 15-19 19.785 28.470000000000002 27.99 23.755000000000003 20-24 20.080000000000002 28.194999999999997 28.055000000000003 23.669999999999998 25-29 19.755 27.975 28.299999999999997 23.97 30-34 20.305 28.21 27.87 23.615 35-39 20.03 28.435 27.73 23.805 40-44 19.97 28.175 28.23 23.625 45-49 20.455000000000002 28.249999999999996 27.005000000000003 24.29 50-54 20.015 28.07 27.72 24.195 55-59 20.62 28.37 27.13 23.880000000000003 60-64 20.02 27.665 27.975 24.34 65-69 20.505000000000003 27.694999999999997 28.025 23.775 70-74 20.669999999999998 27.725 27.794999999999998 23.810000000000002 75-79 20.575 27.975 27.58 23.87 80-84 20.495 27.834999999999997 27.805000000000003 23.865 85-89 20.41 28.165000000000003 27.595 23.830000000000002 90-94 20.395 27.43 28.285 23.89 95-99 20.585 28.065 27.57 23.78 100-104 20.849999999999998 27.450000000000003 27.73 23.97 105-109 20.49 28.26 27.58 23.669999999999998 110-114 20.974999999999998 27.295 27.800000000000004 23.93 115-119 20.91 27.38 27.575 24.135 120-124 21.2 26.91 27.805000000000003 24.085 125-129 21.19 27.115000000000002 27.634999999999998 24.060000000000002 130-134 21.17 27.61 27.339999999999996 23.880000000000003 135-139 21.285 27.639999999999997 27.12 23.955000000000002 140-144 20.72 27.810000000000002 27.005000000000003 24.465 145-149 21.04 27.805000000000003 26.58 24.575 150-151 21.1125 28.199999999999996 26.2125 24.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.5 22 1.5 23 1.0 24 3.0 25 4.0 26 4.0 27 5.0 28 7.0 29 9.0 30 13.0 31 18.0 32 24.5 33 38.5 34 48.0 35 54.5 36 71.0 37 97.0 38 132.0 39 160.0 40 177.0 41 208.0 42 255.0 43 286.5 44 286.0 45 281.5 46 287.5 47 274.5 48 241.5 49 193.5 50 161.0 51 143.5 52 122.0 53 96.5 54 75.5 55 55.5 56 39.5 57 28.5 58 21.0 59 21.0 60 12.5 61 7.5 62 4.5 63 4.5 64 3.5 65 4.0 66 4.0 67 2.0 68 2.0 69 1.5 70 1.0 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.4000000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0125 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0 0.025 0.0 0.0 0.0 70-71 0.0 0.025 0.0 0.0 0.0 72-73 0.0 0.025 0.0 0.0 0.0 74-75 0.037500000000000006 0.025 0.0 0.0 0.0 76-77 0.0625 0.025 0.0 0.0 0.0 78-79 0.125 0.025 0.0 0.0 0.0 80-81 0.175 0.025 0.0 0.0 0.0 82-83 0.1875 0.025 0.0 0.0 0.0 84-85 0.225 0.025 0.0 0.0 0.0 86-87 0.32499999999999996 0.025 0.0 0.0 0.0 88-89 0.42500000000000004 0.025 0.0 0.0 0.0 90-91 0.45 0.025 0.0 0.0 0.0 92-93 0.4625 0.025 0.0 0.0 0.0 94-95 0.5 0.025 0.0 0.0 0.0 96-97 0.5625 0.025 0.0 0.0 0.0 98-99 0.7 0.025 0.0 0.0 0.0 100-101 0.8500000000000001 0.025 0.0 0.0 0.0 102-103 0.9625 0.025 0.0 0.0 0.0 104-105 1.1 0.025 0.0 0.0 0.0 106-107 1.25 0.025 0.0 0.0 0.0 108-109 1.5125000000000002 0.025 0.0 0.0 0.0 110-111 1.725 0.025 0.0 0.0 0.0 112-113 1.9500000000000002 0.025 0.0 0.0 0.0 114-115 2.2125 0.025 0.0 0.0 0.0 116-117 2.425 0.025 0.0 0.0 0.0 118-119 2.675 0.025 0.0 0.0 0.0 120-121 3.05 0.025 0.0 0.0 0.0 122-123 3.525 0.025 0.0 0.0 0.0 124-125 3.9 0.025 0.0 0.0 0.0 126-127 4.1875 0.025 0.0 0.0 0.0 128-129 4.6625 0.025 0.0 0.0 0.0 130-131 5.1 0.025 0.0 0.0 0.0 132-133 5.7 0.025 0.0 0.0 0.0 134-135 6.3875 0.025 0.0 0.0 0.0 136-137 6.8875 0.025 0.0 0.0 0.0 138-139 7.275 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCTTGC 10 0.0068343505 144.975 6 ACGGTCT 30 0.0017985795 72.487495 145 ACACGGT 30 0.0014452472 24.162498 140-144 CAGTCAC 30 0.0014452472 24.162498 135-139 CACACGG 30 0.0014452472 24.162498 140-144 CCAGTCA 30 0.0014452472 24.162498 135-139 AGTCACA 30 0.0014452472 24.162498 135-139 CACGGTC 30 0.0014452472 24.162498 140-144 ACTCCAG 35 0.003540148 20.710714 130-134 GAACTCC 40 0.0076626483 18.121876 130-134 >>END_MODULE SRR7171934 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171934_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8175 33.0 33.0 34.0 32.0 34.0 2 32.949 34.0 33.0 34.0 32.0 34.0 3 32.989 34.0 33.0 34.0 32.0 34.0 4 32.94975 34.0 33.0 34.0 32.0 34.0 5 32.941 34.0 33.0 34.0 32.0 34.0 6 37.138 38.0 38.0 38.0 37.0 38.0 7 37.10325 38.0 38.0 38.0 37.0 38.0 8 37.07025 38.0 38.0 38.0 37.0 38.0 9 37.178 38.0 38.0 38.0 37.0 38.0 10-14 37.10465000000001 38.0 38.0 38.0 37.0 38.0 15-19 37.0167 38.0 38.0 38.0 37.0 38.0 20-24 36.96105 38.0 38.0 38.0 37.0 38.0 25-29 36.91485 38.0 38.0 38.0 37.0 38.0 30-34 36.8902 38.0 38.0 38.0 36.8 38.0 35-39 36.82915 38.0 38.0 38.0 36.4 38.0 40-44 36.79605 38.0 38.0 38.0 36.0 38.0 45-49 36.865449999999996 38.0 38.0 38.0 36.2 38.0 50-54 36.84995 38.0 38.0 38.0 36.2 38.0 55-59 36.83895 38.0 38.0 38.0 36.0 38.0 60-64 36.81425 38.0 38.0 38.0 36.0 38.0 65-69 36.7308 38.0 38.0 38.0 36.0 38.0 70-74 36.6677 38.0 38.0 38.0 35.6 38.0 75-79 36.6914 38.0 38.0 38.0 35.6 38.0 80-84 36.6314 38.0 38.0 38.0 35.2 38.0 85-89 36.5221 38.0 38.0 38.0 34.8 38.0 90-94 36.38775 38.0 38.0 38.0 34.4 38.0 95-99 36.364149999999995 38.0 38.0 38.0 34.0 38.0 100-104 36.143350000000005 38.0 38.0 38.0 33.6 38.0 105-109 36.0371 38.0 37.8 38.0 33.8 38.0 110-114 35.98295 38.0 38.0 38.0 33.6 38.0 115-119 35.849199999999996 38.0 37.4 38.0 32.4 38.0 120-124 35.6694 38.0 37.0 38.0 31.8 38.0 125-129 35.442499999999995 38.0 36.4 38.0 31.0 38.0 130-134 35.1759 38.0 36.0 38.0 29.8 38.0 135-139 34.8209 38.0 35.8 38.0 28.0 38.0 140-144 34.4542 38.0 35.2 38.0 26.0 38.0 145-149 33.8017 38.0 35.0 38.0 22.6 38.0 150-151 30.293875 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 8.0 4 2.0 5 4.0 6 1.0 7 2.0 8 2.0 9 1.0 10 2.0 11 3.0 12 2.0 13 3.0 14 2.0 15 6.0 16 0.0 17 2.0 18 5.0 19 3.0 20 3.0 21 3.0 22 1.0 23 13.0 24 9.0 25 10.0 26 20.0 27 21.0 28 21.0 29 37.0 30 44.0 31 44.0 32 74.0 33 76.0 34 147.0 35 221.0 36 593.0 37 2603.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.278195488721806 16.791979949874687 18.220551378446114 23.709273182957393 2 27.598297019784624 22.31404958677686 30.65364387678437 19.434009516654143 3 22.316737553164874 26.920190142606952 31.723792844633476 19.039279459594695 4 25.68784392196098 33.89194597298649 21.335667833916958 19.084542271135568 5 24.093069802351764 36.202151613710285 22.041531148361273 17.663247435576682 6 20.05 36.225 23.425 20.3 7 19.5 19.45 39.6 21.45 8 21.925 23.925 25.174999999999997 28.975 9 23.1 24.625 27.150000000000002 25.124999999999996 10-14 23.60618030901545 28.42642132106605 26.256312815640783 21.711085554277716 15-19 23.59533696902987 27.953169560214143 27.40781507980187 21.04367839095412 20-24 23.265838011226943 28.608660785886126 26.989775461106657 21.135725741780274 25-29 23.572467037649773 27.878879029427985 27.367523938436854 21.18112999448539 30-34 23.41204191106432 27.923998596280143 27.307364515967315 21.35659497668822 35-39 23.588740027096193 28.05961162125546 27.171458678307992 21.180189673340358 40-44 23.44886392135226 28.389426694086374 27.290966544615543 20.87074283994583 45-49 23.302770679893783 27.60158324565359 27.721829750989528 21.3738163234631 50-54 23.38903342005203 28.457074244546725 27.596557934760856 20.557334400640386 55-59 24.12309231923943 27.46059544658494 27.380535401551164 21.035776832624467 60-64 23.45086271567892 27.846961740435113 27.371842960740185 21.330332583145786 65-69 23.602360236023603 28.82788278827883 26.932693269326936 20.637063706370636 70-74 23.585 27.73 27.655 21.029999999999998 75-79 23.53 27.67 27.639999999999997 21.16 80-84 24.18 27.785 27.1 20.935000000000002 85-89 23.82 27.685 27.68 20.815 90-94 23.72 28.105000000000004 27.6 20.575 95-99 24.245 27.905 27.495000000000005 20.355 100-104 23.915 28.48 27.235 20.369999999999997 105-109 24.805 27.584999999999997 27.189999999999998 20.419999999999998 110-114 23.96 27.6 27.93 20.51 115-119 24.310000000000002 27.82 26.99 20.880000000000003 120-124 24.709999999999997 27.55 27.675 20.064999999999998 125-129 24.099999999999998 28.18 27.525 20.195 130-134 25.380000000000003 28.065 26.215 20.34 135-139 25.314999999999998 27.35 27.325 20.01 140-144 25.169999999999998 28.09 27.295 19.445 145-149 25.355 27.694999999999997 26.924999999999997 20.025000000000002 150-151 25.575 27.525 27.487499999999997 19.412499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 0.5 24 1.5 25 2.5 26 4.0 27 4.5 28 5.5 29 7.0 30 8.0 31 12.5 32 14.0 33 20.5 34 30.5 35 47.5 36 66.0 37 84.5 38 112.0 39 148.0 40 182.5 41 212.0 42 254.0 43 278.0 44 294.5 45 312.5 46 287.5 47 267.0 48 246.0 49 215.0 50 193.5 51 160.5 52 130.5 53 101.5 54 73.0 55 53.0 56 44.0 57 34.5 58 19.5 59 12.0 60 11.0 61 9.0 62 7.0 63 8.0 64 7.5 65 5.0 66 3.5 67 1.5 68 1.0 69 0.5 70 0.5 71 0.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.17500000000000002 3 0.075 4 0.05 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.065 20-24 0.24 25-29 0.265 30-34 0.265 35-39 0.35500000000000004 40-44 0.315 45-49 0.20500000000000002 50-54 0.06 55-59 0.075 60-64 0.025 65-69 0.01 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.425 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.5375 0.0 0.0 0.0 0.0 98-99 0.6625 0.0 0.0 0.0 0.0 100-101 0.8125 0.0 0.0 0.0 0.0 102-103 0.9625 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.25 0.0 0.0 0.0 0.0 108-109 1.5125000000000002 0.0 0.0 0.0 0.0 110-111 1.725 0.0 0.0 0.0 0.0 112-113 1.9500000000000002 0.0 0.0 0.0 0.0 114-115 2.25 0.0 0.0 0.0 0.0 116-117 2.4749999999999996 0.0 0.0 0.0 0.0 118-119 2.7249999999999996 0.0 0.0 0.0 0.0 120-121 3.1 0.0 0.0 0.0 0.0 122-123 3.55 0.0 0.0 0.0 0.0 124-125 3.9375 0.0 0.0 0.0 0.0 126-127 4.2375 0.0 0.0 0.0 0.0 128-129 4.7125 0.0 0.0 0.0 0.0 130-131 5.2 0.0 0.0 0.0 0.0 132-133 5.887499999999999 0.0 0.0 0.0 0.0 134-135 6.575 0.0 0.0 0.0 0.0 136-137 7.1 0.0 0.0 0.0 0.0 138-139 7.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGTCTT 30 0.0018016598 72.45625 145 GAGTGTA 30 0.0014488822 24.152082 135-139 TACGGTC 30 0.0014488822 24.152082 140-144 AGAGTGT 30 0.0014488822 24.152082 135-139 AGTGTAC 30 0.0014488822 24.152082 135-139 ACGGTCT 30 0.0014488822 24.152082 140-144 GTACGGT 40 0.0076817307 18.114063 140-144 >>END_MODULE Read 669490 spots for SRR7171934.sra Written 669490 spots for SRR7171934.sra Read 669490 spots for SRR7171934.sra Written 669490 spots for SRR7171934.sra Read 669490 spots for SRR7171934.sra Written 669490 spots for SRR7171934.sra Read 669490 spots for SRR7171934.sra Written 669490 spots for SRR7171934.sra Read 669490 spots for SRR7171934.sra Written 669490 spots for SRR7171934.sra Read 669490 spots for SRR7171934.sra Written 669490 spots for SRR7171934.sra Read 669490 spots for SRR7171934.sra Written 669490 spots for SRR7171934.sra Read 669490 spots for SRR7171934.sra Written 669490 spots for SRR7171934.sra Read 669490 spots for SRR7171934.sra Written 669490 spots for SRR7171934.sra Read 669490 spots for SRR7171934.sra Written 669490 spots for SRR7171934.sra Read 669490 spots for SRR7171934.sra Written 669490 spots for SRR7171934.sra Read 669490 spots for SRR7171934.sra Written 669490 spots for SRR7171934.sra Read 669490 spots for SRR7171934.sra Written 669490 spots for SRR7171934.sra Read 669490 spots for SRR7171934.sra Written 669490 spots for SRR7171934.sra Read 669490 spots for SRR7171934.sra Written 669490 spots for SRR7171934.sra Read 669490 spots for SRR7171934.sra Written 669490 spots for SRR7171934.sra Read 669490 spots for SRR7171934.sra Written 669490 spots for SRR7171934.sra Read 669490 spots for SRR7171934.sra Written 669490 spots for SRR7171934.sra Read 669490 spots for SRR7171934.sra Written 669490 spots for SRR7171934.sra Read 669504 spots for SRR7171934.sra Written 669504 spots for SRR7171934.sra SRR ids: ['SRR7171934.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x4l88dzh SRR7171934.sra spots: 13389814 blocks: [[1, 669490], [669491, 1338980], [1338981, 2008470], [2008471, 2677960], [2677961, 3347450], [3347451, 4016940], [4016941, 4686430], [4686431, 5355920], [5355921, 6025410], [6025411, 6694900], [6694901, 7364390], [7364391, 8033880], [8033881, 8703370], [8703371, 9372860], [9372861, 10042350], [10042351, 10711840], [10711841, 11381330], [11381331, 12050820], [12050821, 12720310], [12720311, 13389814]] SRR7171934 file size 4515668 SRR7171934 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171934 SRR7171934_1.fastq SRR7171934_2.fastq Input file: SRR7171934_1.fastq Paired file: SRR7171934_2.fastq trimmed: SRR7171934-trimmed-pair1.fastq, SRR7171934-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 15:49:08 2025 >> started Fri Feb 14 15:49:25 2025 >> done (17.707s) 13389814 read pairs processed; of these: 19822 ( 0.15%) short read pairs filtered out after trimming by size control 15604 ( 0.12%) empty read pairs filtered out after trimming by size control 13354388 (99.74%) read pairs available; of these: 4861360 (36.40%) trimmed read pairs available after processing 8493028 (63.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 6 0.00% 22 4 0.00% 23 6 0.00% 24 5 0.00% 25 6 0.00% 26 5 0.00% 27 6 0.00% 28 4 0.00% 29 3 0.00% 30 4 0.00% 31 6 0.00% 32 8 0.00% 33 3 0.00% 34 5 0.00% 35 5 0.00% 36 4 0.00% 37 6 0.00% 38 10 0.00% 39 16 0.00% 40 12 0.00% 41 7 0.00% 42 20 0.00% 43 39 0.00% 44 27 0.00% 45 23 0.00% 46 22 0.00% 47 72 0.00% 48 128 0.00% 49 39 0.00% 50 46 0.00% 51 45 0.00% 52 121 0.00% 53 102 0.00% 54 115 0.00% 55 81 0.00% 56 137 0.00% 57 148 0.00% 58 188 0.00% 59 148 0.00% 60 174 0.00% 61 225 0.00% 62 237 0.00% 63 265 0.00% 64 289 0.00% 65 314 0.00% 66 387 0.00% 67 420 0.00% 68 469 0.00% 69 571 0.00% 70 664 0.00% 71 733 0.01% 72 889 0.01% 73 981 0.01% 74 1072 0.01% 75 1230 0.01% 76 1399 0.01% 77 1516 0.01% 78 1736 0.01% 79 1851 0.01% 80 2106 0.02% 81 2418 0.02% 82 2751 0.02% 83 3092 0.02% 84 4187 0.03% 85 4976 0.04% 86 5265 0.04% 87 5664 0.04% 88 5853 0.04% 89 6317 0.05% 90 6708 0.05% 91 7003 0.05% 92 7719 0.06% 93 8336 0.06% 94 8709 0.07% 95 9261 0.07% 96 9390 0.07% 97 9973 0.07% 98 10166 0.08% 99 11166 0.08% 100 11469 0.09% 101 12058 0.09% 102 13128 0.10% 103 14012 0.10% 104 14516 0.11% 105 15249 0.11% 106 15757 0.12% 107 16203 0.12% 108 16667 0.12% 109 17294 0.13% 110 18082 0.14% 111 19115 0.14% 112 19785 0.15% 113 20763 0.16% 114 22237 0.17% 115 22860 0.17% 116 23653 0.18% 117 23987 0.18% 118 24586 0.18% 119 25605 0.19% 120 26851 0.20% 121 27215 0.20% 122 27786 0.21% 123 29536 0.22% 124 31267 0.23% 125 31420 0.24% 126 32798 0.25% 127 33187 0.25% 128 33982 0.25% 129 35173 0.26% 130 35762 0.27% 131 36828 0.28% 132 39490 0.30% 133 40617 0.30% 134 43199 0.32% 135 44618 0.33% 136 46918 0.35% 137 48565 0.36% 138 49887 0.37% 139 52414 0.39% 140 55170 0.41% 141 58809 0.44% 142 63677 0.48% 143 70271 0.53% 144 78594 0.59% 145 90432 0.68% 146 106120 0.79% 147 136845 1.02% 148 197482 1.48% 149 382744 2.87% 150 2358562 17.66% 151 8493028 63.60% 13354388 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=3.17 fanout-score-rank=24 prefix-density=0.48 prefix-fanout=2.2 sequence=CATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=42.49 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=4.6 sequence=AACAACAAGAGGAGCGGGCCTAACCAGGCTAAAAACAGGGCAGTTAAACCAACATTAATACCACAACTATCTTAATTGCCACTGACTAGCAATAACAACACCCATTTCTAAAGAAAATATCTTATTCTGCAAATCTCAGACTCTTCTCCCTCGTTGTAAACAAGGAAGAGAAGTACTTGAGTTTGACATGTAGCAAATCAAAGTTTCTAGTGGTGCTTGTTTGCAACAGTGCACTGCTTTCTGATCTCACCCTTGGTACCGGTGAGTGGGTTGTTCTCAGAAAGAATGGTGATAGCCCTAGAAAACTCCTTAAAGAAGTAATCCTGACTCTTGGCCATTTTCTTCACGTAAGGCTTAGTTCTCTTGTCAGTGGCTAGTTGGTGATCCACTATCAACAAGCCCTTGTTGTCCAATATGTTTCTGTAGTAGTTGTTGTCTAGAACCATGGGTGTGCCTCTGTCATTCCTCACATATTGGACAGCTTTAGGGTCTGGGATTGAATCAGGGCACT criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=4.82 fanout-score-rank=21 prefix-density=0.46 prefix-fanout=3.6 sequence=TGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=177.91 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=12.2 sequence=TTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGC SRR7171934 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 15:50:11 Started mapping on | Feb 14 15:50:11 Finished on | Feb 14 15:51:48 Mapping speed, Million of reads per hour | 495.63 Number of input reads | 13354388 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 12155424 Uniquely mapped reads % | 91.02% Average mapped length | 293.93 Number of splices: Total | 11575298 Number of splices: Annotated (sjdb) | 11343595 Number of splices: GT/AG | 11387217 Number of splices: GC/AG | 145227 Number of splices: AT/AC | 9969 Number of splices: Non-canonical | 32885 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.52 Insertion rate per base | 0.02% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 304645 % of reads mapped to multiple loci | 2.28% Number of reads mapped to too many loci | 54651 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.20% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 912196 912196 912196 N_multimapping 304645 304645 304645 N_noFeature 308779 11997593 392369 N_ambiguous 137458 766 62775 UnstrandedReadsAssigned:11709187 PositiveStrandReadsAssigned:157065 NegativeStrandReadsAssigned:11700280 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171934 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171934-trimmed-pair1.fastq SRR7171934-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,354,388 reads, 11,635,439 reads pseudoaligned [quant] estimated average fragment length: 230.628 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,104 rounds 52401 SRR7171934.ke.tsv 34699 SRR7171934.se.tsv 87100 total ==> SRR7171934.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.37 978 44.3923 Potri.005G024800.1.v4.1 1035 805.372 162 16.3284 Potri.004G059700.1.v4.1 961 731.377 44 4.88357 Potri.007G009000.2.v4.1 1416 1186.37 0 0 Potri.003G141000.2.v4.1 2943 2713.37 495 14.8089 Potri.016G087400.1.v4.1 270 80.3963 908.594 917.403 Potri.015G069301.1.v4.1 564 336.37 0 0 Potri.010G195200.1.v4.1 1773 1543.37 211.765 11.1381 Potri.012G127500.1.v4.1 977 747.377 5922 643.213 ==> SRR7171934.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 234 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 524 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 189 SRR7171934 completed mapping pipeline successfully