Starting /dee2/code/volunteer_pipeline.sh SRR7171935 current disk space = 3111839371264 free memory = 1569420932 SRR7171935 SRAfilesize c61b03cac5023894fcae9adc85e2a62a SRR7171935.sra SRR7171935.sra file validated SRR7171935 is paired end SRR7171935 is conventional basespace SRR7171935 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171935_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.2245 32.0 18.0 33.0 18.0 33.0 2 29.69225 31.0 29.0 33.0 25.0 34.0 3 31.244 32.0 32.0 33.0 27.0 33.0 4 32.13275 33.0 32.0 33.0 32.0 33.0 5 32.527 33.0 33.0 33.0 32.0 34.0 6 35.95075 37.0 36.0 38.0 33.0 38.0 7 37.033 38.0 37.0 38.0 35.0 38.0 8 37.25825 38.0 38.0 38.0 36.0 38.0 9 37.56725 38.0 38.0 38.0 37.0 38.0 10-14 37.60065 38.0 38.0 38.0 38.0 38.0 15-19 37.57875 38.0 38.0 38.0 38.0 38.0 20-24 37.56915 38.0 38.0 38.0 38.0 38.0 25-29 37.52405 38.0 38.0 38.0 37.8 38.0 30-34 37.50595 38.0 38.0 38.0 37.8 38.0 35-39 37.53125 38.0 38.0 38.0 37.6 38.0 40-44 37.44975 38.0 38.0 38.0 37.2 38.0 45-49 37.45225 38.0 38.0 38.0 37.0 38.0 50-54 37.363899999999994 38.0 38.0 38.0 37.0 38.0 55-59 37.30595 38.0 38.0 38.0 37.0 38.0 60-64 37.283699999999996 38.0 38.0 38.0 37.0 38.0 65-69 37.2286 38.0 38.0 38.0 36.4 38.0 70-74 37.1826 38.0 38.0 38.0 36.0 38.0 75-79 37.079600000000006 38.0 38.0 38.0 36.0 38.0 80-84 37.025800000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.94655 38.0 38.0 38.0 36.0 38.0 90-94 36.842600000000004 38.0 38.0 38.0 35.2 38.0 95-99 36.8048 38.0 38.0 38.0 35.0 38.0 100-104 36.6817 38.0 38.0 38.0 34.4 38.0 105-109 36.61295 38.0 38.0 38.0 34.2 38.0 110-114 36.466 38.0 38.0 38.0 34.0 38.0 115-119 36.26469999999999 38.0 37.2 38.0 33.4 38.0 120-124 36.19945 38.0 37.0 38.0 33.6 38.0 125-129 35.9948 38.0 37.2 38.0 32.8 38.0 130-134 35.74835 38.0 36.0 38.0 32.0 38.0 135-139 35.528349999999996 38.0 36.0 38.0 31.0 38.0 140-144 35.25135 38.0 36.0 38.0 30.0 38.0 145-149 34.6572 38.0 35.0 38.0 28.0 38.0 150-151 31.73525 36.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 3.0 15 1.0 16 1.0 17 3.0 18 0.0 19 6.0 20 1.0 21 4.0 22 2.0 23 4.0 24 4.0 25 4.0 26 9.0 27 20.0 28 6.0 29 20.0 30 27.0 31 41.0 32 57.0 33 86.0 34 136.0 35 277.0 36 726.0 37 2560.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.975 13.350000000000001 13.925 30.75 2 23.036518259129565 16.908454227113555 35.1175587793897 24.937468734367183 3 19.575 24.275 28.225 27.925 4 22.15 30.225 23.549999999999997 24.075 5 22.175 33.6 23.95 20.275000000000002 6 17.375 35.75 26.5 20.375 7 14.299999999999999 25.224999999999998 43.175000000000004 17.299999999999997 8 17.7 25.874999999999996 30.075000000000003 26.35 9 17.05 25.0 32.75 25.2 10-14 19.945 29.975 27.305 22.775000000000002 15-19 20.355 28.860000000000003 27.37 23.415 20-24 20.085 28.904999999999998 28.025 22.985 25-29 19.7 28.785 28.144999999999996 23.369999999999997 30-34 19.725 28.835 27.955000000000002 23.485 35-39 19.814999999999998 28.244999999999997 28.325 23.615 40-44 20.47 28.849999999999998 27.955000000000002 22.725 45-49 20.055 28.52 27.76 23.665 50-54 20.305 28.215 28.005000000000003 23.474999999999998 55-59 20.07 28.694999999999997 27.534999999999997 23.7 60-64 19.875 29.299999999999997 27.310000000000002 23.515 65-69 19.994999999999997 28.235 27.700000000000003 24.07 70-74 20.205000000000002 28.16 28.12 23.515 75-79 20.325 27.884999999999998 28.275 23.515 80-84 20.145 28.199999999999996 28.134999999999998 23.52 85-89 20.560000000000002 28.955 26.840000000000003 23.645 90-94 20.669999999999998 28.4 27.58 23.35 95-99 20.61 28.384999999999998 27.339999999999996 23.665 100-104 21.044999999999998 27.79 28.405 22.759999999999998 105-109 20.68 28.044999999999998 27.705000000000002 23.57 110-114 20.395 27.994999999999997 28.185 23.425 115-119 20.95 27.715 27.99 23.345 120-124 20.68 27.735 27.435 24.15 125-129 20.665 27.805000000000003 27.694999999999997 23.835 130-134 21.02 27.634999999999998 28.035 23.31 135-139 20.985 28.33 27.3 23.385 140-144 21.09 27.425 27.855 23.630000000000003 145-149 20.44 27.575 27.755000000000003 24.23 150-151 21.337500000000002 27.950000000000003 27.3125 23.400000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 1.0 19 1.0 20 1.0 21 2.0 22 2.5 23 2.5 24 4.0 25 4.0 26 1.5 27 2.0 28 6.0 29 14.0 30 17.5 31 26.0 32 34.5 33 49.0 34 68.5 35 75.5 36 87.5 37 115.0 38 141.5 39 164.0 40 201.0 41 234.0 42 246.0 43 254.5 44 264.0 45 264.0 46 268.0 47 249.5 48 217.5 49 197.0 50 172.0 51 144.5 52 115.5 53 85.5 54 67.5 55 53.5 56 34.5 57 27.0 58 21.0 59 12.5 60 12.0 61 11.5 62 5.5 63 3.5 64 5.0 65 4.0 66 1.0 67 0.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.36250000000000004 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.575 0.0 0.0 0.0 0.0 108-109 0.6375 0.0 0.0 0.0 0.0 110-111 0.8 0.0 0.0 0.0 0.0 112-113 0.9624999999999999 0.0 0.0 0.0 0.0 114-115 1.0125 0.0 0.0 0.0 0.0 116-117 1.1 0.0 0.0 0.0 0.0 118-119 1.1749999999999998 0.0 0.0 0.0 0.0 120-121 1.3375 0.0 0.0 0.0 0.0 122-123 1.6 0.0 0.0 0.0 0.0 124-125 1.7875 0.0 0.0 0.0 0.0 126-127 2.1 0.0 0.0 0.0 0.0 128-129 2.3 0.0 0.0 0.0 0.0 130-131 2.55 0.0 0.0 0.0 0.0 132-133 2.8125 0.0 0.0 0.0 0.0 134-135 3.1125 0.0 0.0 0.0 0.0 136-137 3.4125 0.0 0.0 0.0 0.0 138-139 3.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTAGTTT 10 0.0068343505 144.975 6 AGGTATC 10 0.0068343505 144.975 6 CCTAGTT 10 0.0068343505 144.975 5 GGTATCC 10 0.0068343505 144.975 7 >>END_MODULE SRR7171935 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171935_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0725 33.0 33.0 34.0 33.0 34.0 2 33.09875 34.0 33.0 34.0 33.0 34.0 3 33.18125 34.0 33.0 34.0 33.0 34.0 4 33.18375 34.0 33.0 34.0 33.0 34.0 5 33.146 34.0 33.0 34.0 33.0 34.0 6 37.37325 38.0 38.0 38.0 38.0 38.0 7 37.32275 38.0 38.0 38.0 37.0 38.0 8 37.3125 38.0 38.0 38.0 37.0 38.0 9 37.37675 38.0 38.0 38.0 37.0 38.0 10-14 37.3021 38.0 38.0 38.0 37.0 38.0 15-19 37.2387 38.0 38.0 38.0 37.0 38.0 20-24 37.21835 38.0 38.0 38.0 37.0 38.0 25-29 37.25215000000001 38.0 38.0 38.0 37.0 38.0 30-34 37.1703 38.0 38.0 38.0 37.0 38.0 35-39 37.049099999999996 38.0 38.0 38.0 36.8 38.0 40-44 36.920950000000005 38.0 38.0 38.0 36.6 38.0 45-49 37.126349999999995 38.0 38.0 38.0 36.8 38.0 50-54 37.13314999999999 38.0 38.0 38.0 37.0 38.0 55-59 37.098749999999995 38.0 38.0 38.0 37.0 38.0 60-64 37.08435 38.0 38.0 38.0 36.4 38.0 65-69 37.025400000000005 38.0 38.0 38.0 36.0 38.0 70-74 36.961349999999996 38.0 38.0 38.0 36.0 38.0 75-79 36.9659 38.0 38.0 38.0 36.0 38.0 80-84 36.866499999999995 38.0 38.0 38.0 35.8 38.0 85-89 36.752050000000004 38.0 38.0 38.0 35.4 38.0 90-94 36.6865 38.0 38.0 38.0 35.0 38.0 95-99 36.56735 38.0 38.0 38.0 34.2 38.0 100-104 36.41775 38.0 38.0 38.0 34.0 38.0 105-109 36.331 38.0 38.0 38.0 34.0 38.0 110-114 36.269549999999995 38.0 38.0 38.0 34.0 38.0 115-119 36.07375 38.0 37.2 38.0 33.4 38.0 120-124 35.88185 38.0 37.0 38.0 33.0 38.0 125-129 35.57040000000001 38.0 36.2 38.0 31.2 38.0 130-134 35.353649999999995 38.0 36.0 38.0 30.6 38.0 135-139 35.111599999999996 38.0 36.0 38.0 29.0 38.0 140-144 34.76865 38.0 35.0 38.0 28.0 38.0 145-149 34.2615 38.0 34.6 38.0 26.4 38.0 150-151 30.5805 36.5 29.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 1.0 4 1.0 5 3.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 3.0 16 3.0 17 4.0 18 3.0 19 4.0 20 3.0 21 5.0 22 5.0 23 6.0 24 8.0 25 14.0 26 16.0 27 13.0 28 23.0 29 30.0 30 25.0 31 35.0 32 65.0 33 71.0 34 133.0 35 241.0 36 709.0 37 2564.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.925 17.4 16.775000000000002 24.9 2 25.900000000000002 24.65 31.474999999999998 17.974999999999998 3 22.6 27.825 30.049999999999997 19.525000000000002 4 25.275 33.300000000000004 22.075 19.35 5 25.124999999999996 36.325 21.075 17.474999999999998 6 20.200000000000003 38.25 24.125 17.424999999999997 7 19.400000000000002 18.4 40.675 21.525 8 22.425 24.775 26.724999999999998 26.075 9 21.725 25.424999999999997 28.299999999999997 24.55 10-14 23.21 28.9 26.095000000000002 21.795 15-19 24.01 28.58 27.029999999999998 20.380000000000003 20-24 23.035 28.675 27.41 20.880000000000003 25-29 23.880000000000003 28.689999999999998 26.555 20.875 30-34 23.92370845014017 28.3189827793352 26.747096515818985 21.010212254705646 35-39 23.460381143430293 28.36008024072217 27.08124373119358 21.098294884653964 40-44 23.959798994974875 27.869346733668344 27.427135678391963 20.743718592964825 45-49 23.044999999999998 28.015 27.400000000000002 21.54 50-54 23.369999999999997 28.105000000000004 27.694999999999997 20.830000000000002 55-59 23.724999999999998 27.74 27.505000000000003 21.029999999999998 60-64 23.45 28.225 27.384999999999998 20.94 65-69 23.580000000000002 28.28 27.37 20.77 70-74 23.935000000000002 28.139999999999997 27.334999999999997 20.59 75-79 23.53 27.92 27.725 20.825 80-84 24.104999999999997 27.845 27.375 20.674999999999997 85-89 23.565 27.955000000000002 28.07 20.41 90-94 23.810000000000002 27.650000000000002 27.395000000000003 21.145 95-99 23.955000000000002 28.155 27.43 20.46 100-104 23.66 27.785 27.735 20.82 105-109 24.05 27.32 27.76 20.87 110-114 22.835 28.235 28.225 20.705000000000002 115-119 24.2 28.389999999999997 27.939999999999998 19.470000000000002 120-124 24.115000000000002 27.61 27.800000000000004 20.474999999999998 125-129 23.175 28.505000000000003 28.000000000000004 20.32 130-134 23.93 28.54 26.96 20.57 135-139 24.925 27.915 27.91 19.25 140-144 24.044999999999998 27.950000000000003 27.595 20.41 145-149 24.38 28.505000000000003 27.034999999999997 20.080000000000002 150-151 25.1 27.800000000000004 26.937499999999996 20.1625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 1.0 21 0.5 22 0.0 23 1.0 24 1.5 25 3.0 26 3.0 27 1.0 28 3.5 29 7.0 30 10.5 31 9.5 32 11.5 33 23.0 34 36.0 35 48.0 36 71.5 37 99.5 38 122.0 39 149.5 40 201.5 41 229.5 42 240.0 43 278.5 44 298.0 45 306.0 46 294.5 47 276.0 48 249.0 49 198.5 50 163.0 51 146.0 52 122.0 53 93.5 54 75.0 55 54.0 56 44.5 57 36.5 58 21.0 59 18.5 60 15.5 61 10.5 62 9.0 63 4.5 64 3.5 65 2.5 66 0.5 67 1.0 68 0.5 69 0.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.12 35-39 0.3 40-44 0.5 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69864389753893 99.25 2 0.22601707684580613 0.44999999999999996 3 0.025113008538422906 0.075 4 0.025113008538422906 0.1 5 0.025113008538422906 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.36250000000000004 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.575 0.0 0.0 0.0 0.0 108-109 0.625 0.0 0.0 0.0 0.0 110-111 0.775 0.0 0.0 0.0 0.0 112-113 0.9375 0.0 0.0 0.0 0.0 114-115 1.025 0.0 0.0 0.0 0.0 116-117 1.125 0.0 0.0 0.0 0.0 118-119 1.2000000000000002 0.0 0.0 0.0 0.0 120-121 1.3624999999999998 0.0 0.0 0.0 0.0 122-123 1.6 0.0 0.0 0.0 0.0 124-125 1.7625000000000002 0.0 0.0 0.0 0.0 126-127 2.1 0.0 0.0 0.0 0.0 128-129 2.325 0.0 0.0 0.0 0.0 130-131 2.5875000000000004 0.0 0.0 0.0 0.0 132-133 2.825 0.0 0.0 0.0 0.0 134-135 3.1375 0.0 0.0 0.0 0.0 136-137 3.45 0.0 0.0 0.0 0.0 138-139 3.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 750072 spots for SRR7171935.sra Written 750072 spots for SRR7171935.sra Read 750072 spots for SRR7171935.sra Written 750072 spots for SRR7171935.sra Read 750072 spots for SRR7171935.sra Written 750072 spots for SRR7171935.sra Read 750072 spots for SRR7171935.sra Written 750072 spots for SRR7171935.sra Read 750072 spots for SRR7171935.sra Written 750072 spots for SRR7171935.sra Read 750072 spots for SRR7171935.sra Written 750072 spots for SRR7171935.sra Read 750072 spots for SRR7171935.sra Written 750072 spots for SRR7171935.sra Read 750072 spots for SRR7171935.sra Written 750072 spots for SRR7171935.sra Read 750072 spots for SRR7171935.sra Written 750072 spots for SRR7171935.sra Read 750072 spots for SRR7171935.sra Written 750072 spots for SRR7171935.sra Read 750072 spots for SRR7171935.sra Written 750072 spots for SRR7171935.sra Read 750072 spots for SRR7171935.sra Written 750072 spots for SRR7171935.sra Read 750072 spots for SRR7171935.sra Written 750072 spots for SRR7171935.sra Read 750072 spots for SRR7171935.sra Written 750072 spots for SRR7171935.sra Read 750072 spots for SRR7171935.sra Written 750072 spots for SRR7171935.sra Read 750072 spots for SRR7171935.sra Written 750072 spots for SRR7171935.sra Read 750072 spots for SRR7171935.sra Written 750072 spots for SRR7171935.sra Read 750072 spots for SRR7171935.sra Written 750072 spots for SRR7171935.sra Read 750090 spots for SRR7171935.sra Written 750090 spots for SRR7171935.sra Read 750072 spots for SRR7171935.sra Written 750072 spots for SRR7171935.sra SRR ids: ['SRR7171935.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ywup6apo SRR7171935.sra spots: 15001458 blocks: [[1, 750072], [750073, 1500144], [1500145, 2250216], [2250217, 3000288], [3000289, 3750360], [3750361, 4500432], [4500433, 5250504], [5250505, 6000576], [6000577, 6750648], [6750649, 7500720], [7500721, 8250792], [8250793, 9000864], [9000865, 9750936], [9750937, 10501008], [10501009, 11251080], [11251081, 12001152], [12001153, 12751224], [12751225, 13501296], [13501297, 14251368], [14251369, 15001458]] SRR7171935 file size 5061801 SRR7171935 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171935 SRR7171935_1.fastq SRR7171935_2.fastq Input file: SRR7171935_1.fastq Paired file: SRR7171935_2.fastq trimmed: SRR7171935-trimmed-pair1.fastq, SRR7171935-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 16:28:09 2025 >> started Fri Feb 14 16:28:30 2025 >> done (20.942s) 15001458 read pairs processed; of these: 21596 ( 0.14%) short read pairs filtered out after trimming by size control 18343 ( 0.12%) empty read pairs filtered out after trimming by size control 14961519 (99.73%) read pairs available; of these: 6287961 (42.03%) trimmed read pairs available after processing 8673558 (57.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 7 0.00% 20 5 0.00% 21 7 0.00% 22 6 0.00% 23 7 0.00% 24 2 0.00% 25 8 0.00% 26 7 0.00% 27 10 0.00% 28 6 0.00% 29 7 0.00% 30 3 0.00% 31 6 0.00% 32 8 0.00% 33 9 0.00% 34 5 0.00% 35 6 0.00% 36 11 0.00% 37 11 0.00% 38 9 0.00% 39 12 0.00% 40 15 0.00% 41 10 0.00% 42 15 0.00% 43 16 0.00% 44 16 0.00% 45 13 0.00% 46 17 0.00% 47 24 0.00% 48 17 0.00% 49 22 0.00% 50 22 0.00% 51 29 0.00% 52 31 0.00% 53 42 0.00% 54 36 0.00% 55 61 0.00% 56 44 0.00% 57 66 0.00% 58 54 0.00% 59 69 0.00% 60 79 0.00% 61 92 0.00% 62 117 0.00% 63 98 0.00% 64 106 0.00% 65 148 0.00% 66 137 0.00% 67 165 0.00% 68 166 0.00% 69 201 0.00% 70 236 0.00% 71 266 0.00% 72 324 0.00% 73 357 0.00% 74 377 0.00% 75 474 0.00% 76 583 0.00% 77 630 0.00% 78 628 0.00% 79 747 0.00% 80 790 0.01% 81 931 0.01% 82 1087 0.01% 83 1266 0.01% 84 2255 0.02% 85 2904 0.02% 86 3348 0.02% 87 3767 0.03% 88 3840 0.03% 89 3903 0.03% 90 4049 0.03% 91 4183 0.03% 92 4427 0.03% 93 4663 0.03% 94 4976 0.03% 95 5026 0.03% 96 5270 0.04% 97 5530 0.04% 98 5861 0.04% 99 6152 0.04% 100 6584 0.04% 101 7166 0.05% 102 7663 0.05% 103 8151 0.05% 104 8613 0.06% 105 9102 0.06% 106 9733 0.07% 107 9912 0.07% 108 10473 0.07% 109 11036 0.07% 110 11737 0.08% 111 12495 0.08% 112 13250 0.09% 113 13976 0.09% 114 15149 0.10% 115 15950 0.11% 116 16424 0.11% 117 16751 0.11% 118 17655 0.12% 119 18103 0.12% 120 19206 0.13% 121 19805 0.13% 122 21150 0.14% 123 22239 0.15% 124 23827 0.16% 125 24451 0.16% 126 25539 0.17% 127 26435 0.18% 128 27384 0.18% 129 28806 0.19% 130 30015 0.20% 131 31777 0.21% 132 33734 0.23% 133 36216 0.24% 134 38086 0.25% 135 40967 0.27% 136 43446 0.29% 137 46247 0.31% 138 49061 0.33% 139 52703 0.35% 140 57659 0.39% 141 63849 0.43% 142 70933 0.47% 143 80983 0.54% 144 95370 0.64% 145 115968 0.78% 146 147828 0.99% 147 206076 1.38% 148 326397 2.18% 149 685531 4.58% 150 3475415 23.23% 151 8673558 57.97% 14961519 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=3.54 fanout-score-rank=17 prefix-density=0.54 prefix-fanout=3.2 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.11 sequence-density-rank=26 fanout-score=34.22 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=10.5 sequence=CCTTCCTTGTCCTGGATCTTGGCCTTCAC criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.41 fanout-score-rank=22 prefix-density=0.81 prefix-fanout=2.4 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=55.15 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=3.8 sequence=TCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCC SRR7171935 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 16:29:37 Started mapping on | Feb 14 16:29:42 Finished on | Feb 14 16:31:59 Mapping speed, Million of reads per hour | 393.15 Number of input reads | 14961519 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13733165 Uniquely mapped reads % | 91.79% Average mapped length | 296.23 Number of splices: Total | 13042899 Number of splices: Annotated (sjdb) | 12753685 Number of splices: GT/AG | 12828303 Number of splices: GC/AG | 167621 Number of splices: AT/AC | 11029 Number of splices: Non-canonical | 35946 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 336380 % of reads mapped to multiple loci | 2.25% Number of reads mapped to too many loci | 40714 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.61% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 912730 912730 912730 N_multimapping 336380 336380 336380 N_noFeature 395122 13552754 489995 N_ambiguous 164431 1213 78204 UnstrandedReadsAssigned:13173612 PositiveStrandReadsAssigned:179198 NegativeStrandReadsAssigned:13164966 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171935 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171935-trimmed-pair1.fastq SRR7171935-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,961,519 reads, 13,073,420 reads pseudoaligned [quant] estimated average fragment length: 248.982 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,085 rounds 52401 SRR7171935.ke.tsv 34699 SRR7171935.se.tsv 87100 total ==> SRR7171935.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1770.02 1321 48.4842 Potri.005G024800.1.v4.1 1035 787.018 271 22.3697 Potri.004G059700.1.v4.1 961 713.049 31 2.82434 Potri.007G009000.2.v4.1 1416 1168.02 0 0 Potri.003G141000.2.v4.1 2943 2695.02 648.507 15.6325 Potri.016G087400.1.v4.1 270 71.0233 1323 1210.14 Potri.015G069301.1.v4.1 564 319.205 0 0 Potri.010G195200.1.v4.1 1773 1525.02 240 10.2238 Potri.012G127500.1.v4.1 977 729.023 4683 417.309 ==> SRR7171935.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 85 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 419 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 357 SRR7171935 completed mapping pipeline successfully