Starting /dee2/code/volunteer_pipeline.sh SRR7171936 current disk space = 3087979970560 free memory = 1463695244 SRR7171936 SRAfilesize de75b3fb81e0fb2ee96972752f4cc508 SRR7171936.sra SRR7171936.sra file validated SRR7171936 is paired end SRR7171936 is conventional basespace SRR7171936 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171936_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.725 33.0 33.0 34.0 32.0 34.0 2 32.0955 33.0 33.0 34.0 29.0 34.0 3 32.9395 33.0 33.0 34.0 31.0 34.0 4 32.637 33.0 33.0 34.0 31.0 34.0 5 32.637 33.0 33.0 34.0 31.0 34.0 6 36.1015 38.0 36.0 38.0 33.0 38.0 7 36.29775 38.0 36.0 38.0 33.0 38.0 8 37.21275 38.0 38.0 38.0 36.0 38.0 9 37.409 38.0 38.0 38.0 37.0 38.0 10-14 37.4832 38.0 38.0 38.0 37.2 38.0 15-19 37.52955 38.0 38.0 38.0 37.6 38.0 20-24 37.52415 38.0 38.0 38.0 37.8 38.0 25-29 37.45495 38.0 38.0 38.0 37.0 38.0 30-34 37.43835 38.0 38.0 38.0 37.0 38.0 35-39 37.4533 38.0 38.0 38.0 37.0 38.0 40-44 37.380449999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.33815 38.0 38.0 38.0 37.0 38.0 50-54 37.32695 38.0 38.0 38.0 37.0 38.0 55-59 37.2583 38.0 38.0 38.0 37.0 38.0 60-64 37.246449999999996 38.0 38.0 38.0 36.6 38.0 65-69 37.214000000000006 38.0 38.0 38.0 36.6 38.0 70-74 37.128949999999996 38.0 38.0 38.0 36.0 38.0 75-79 37.103750000000005 38.0 38.0 38.0 36.0 38.0 80-84 37.0865 38.0 38.0 38.0 36.0 38.0 85-89 36.976549999999996 38.0 38.0 38.0 36.0 38.0 90-94 36.867050000000006 38.0 38.0 38.0 35.0 38.0 95-99 36.8375 38.0 38.0 38.0 35.4 38.0 100-104 36.7318 38.0 38.0 38.0 34.8 38.0 105-109 36.5685 38.0 38.0 38.0 34.0 38.0 110-114 36.414 38.0 38.0 38.0 34.0 38.0 115-119 36.4089 38.0 38.0 38.0 34.0 38.0 120-124 36.283699999999996 38.0 37.8 38.0 33.8 38.0 125-129 36.0817 38.0 37.0 38.0 33.2 38.0 130-134 35.77850000000001 38.0 36.4 38.0 31.8 38.0 135-139 35.572050000000004 38.0 36.0 38.0 31.0 38.0 140-144 35.16435 38.0 36.0 38.0 29.6 38.0 145-149 34.8121 38.0 35.4 38.0 28.4 38.0 150-151 31.917125000000002 36.5 33.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 1.0 20 2.0 21 6.0 22 2.0 23 8.0 24 8.0 25 6.0 26 15.0 27 16.0 28 11.0 29 37.0 30 39.0 31 39.0 32 56.0 33 74.0 34 119.0 35 227.0 36 612.0 37 2717.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.550000000000004 14.399999999999999 9.75 36.3 2 20.625 18.3 37.5 23.575 3 20.175 26.150000000000002 24.925 28.749999999999996 4 24.325 34.65 20.549999999999997 20.474999999999998 5 22.275 36.25 23.200000000000003 18.275 6 17.8 36.8 24.775 20.625 7 13.775 22.2 43.175000000000004 20.849999999999998 8 17.625 22.675 31.225 28.475 9 19.45 23.599999999999998 32.05 24.9 10-14 20.05 29.825000000000003 27.055 23.07 15-19 20.349999999999998 28.595 27.275 23.78 20-24 19.794999999999998 29.465000000000003 27.125 23.615 25-29 20.055 28.965000000000003 27.644999999999996 23.335 30-34 20.315 28.560000000000002 27.48 23.645 35-39 19.695 28.610000000000003 27.500000000000004 24.195 40-44 20.150000000000002 28.57 27.6 23.68 45-49 20.495 28.78 26.82 23.905 50-54 19.869999999999997 28.92 27.37 23.84 55-59 19.905 28.43 27.800000000000004 23.865 60-64 19.99 28.845 27.689999999999998 23.474999999999998 65-69 20.69 28.675 27.334999999999997 23.3 70-74 20.580000000000002 27.900000000000002 27.36 24.16 75-79 20.105 28.199999999999996 28.09 23.605 80-84 19.885 28.720000000000002 27.584999999999997 23.810000000000002 85-89 20.3 28.63 27.05 24.02 90-94 19.98 28.43 27.515 24.075 95-99 20.26 28.185 27.584999999999997 23.97 100-104 20.34 28.634999999999998 27.694999999999997 23.330000000000002 105-109 20.544999999999998 28.060000000000002 27.500000000000004 23.895 110-114 20.07 28.7 27.72 23.51 115-119 20.41 27.794999999999998 27.97 23.825 120-124 20.305 27.35 28.035 24.310000000000002 125-129 20.91 27.22 28.060000000000002 23.810000000000002 130-134 21.04 27.55 27.42 23.990000000000002 135-139 20.625 27.694999999999997 27.355 24.325 140-144 20.565 28.025 27.765 23.645 145-149 20.64 28.470000000000002 27.125 23.765 150-151 20.7875 27.1125 27.187499999999996 24.9125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 1.0 21 0.5 22 1.0 23 1.5 24 1.5 25 4.0 26 6.5 27 6.0 28 5.5 29 8.0 30 19.0 31 27.0 32 33.0 33 37.5 34 44.5 35 61.5 36 78.0 37 102.5 38 138.5 39 165.5 40 185.5 41 219.0 42 247.0 43 274.5 44 288.5 45 278.0 46 264.0 47 253.0 48 235.5 49 216.0 50 184.5 51 145.0 52 113.5 53 92.5 54 70.0 55 47.0 56 36.5 57 23.5 58 19.0 59 16.0 60 10.5 61 9.5 62 10.5 63 7.0 64 3.0 65 1.5 66 0.5 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.32499999999999996 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.5375 0.0 0.0 0.0 0.0 106-107 0.7250000000000001 0.0 0.0 0.0 0.0 108-109 0.85 0.0 0.0 0.0 0.0 110-111 0.95 0.0 0.0 0.0 0.0 112-113 0.975 0.0 0.0 0.0 0.0 114-115 1.1375000000000002 0.0 0.0 0.0 0.0 116-117 1.2374999999999998 0.0 0.0 0.0 0.0 118-119 1.55 0.0 0.0 0.0 0.0 120-121 1.6875 0.0 0.0 0.0 0.0 122-123 1.7875 0.0 0.0 0.0 0.0 124-125 1.9874999999999998 0.0 0.0 0.0 0.0 126-127 2.25 0.0 0.0 0.0 0.0 128-129 2.4000000000000004 0.0 0.0 0.0 0.0 130-131 2.6125 0.0 0.0 0.0 0.0 132-133 2.775 0.0 0.0 0.0 0.0 134-135 3.1375 0.0 0.0 0.0 0.0 136-137 3.4375 0.0 0.0 0.0 0.0 138-139 3.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171936 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171936_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.993 33.0 33.0 34.0 32.0 34.0 2 33.07175 34.0 33.0 34.0 32.0 34.0 3 33.1045 34.0 33.0 34.0 32.0 34.0 4 33.01725 34.0 33.0 34.0 32.0 34.0 5 33.04325 34.0 33.0 34.0 32.0 34.0 6 37.20175 38.0 38.0 38.0 37.0 38.0 7 37.178 38.0 38.0 38.0 37.0 38.0 8 37.28425 38.0 38.0 38.0 37.0 38.0 9 37.187 38.0 38.0 38.0 37.0 38.0 10-14 37.21995 38.0 38.0 38.0 37.0 38.0 15-19 37.226549999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.1768 38.0 38.0 38.0 36.8 38.0 25-29 37.23795 38.0 38.0 38.0 36.8 38.0 30-34 37.13135 38.0 38.0 38.0 36.4 38.0 35-39 36.734899999999996 38.0 38.0 38.0 36.0 38.0 40-44 36.48345 38.0 38.0 38.0 35.6 38.0 45-49 36.96035 38.0 38.0 38.0 36.0 38.0 50-54 37.06705 38.0 38.0 38.0 36.0 38.0 55-59 37.0762 38.0 38.0 38.0 36.0 38.0 60-64 37.01925 38.0 38.0 38.0 36.0 38.0 65-69 36.9178 38.0 38.0 38.0 35.8 38.0 70-74 36.8338 38.0 38.0 38.0 35.8 38.0 75-79 36.832550000000005 38.0 38.0 38.0 35.2 38.0 80-84 36.79655 38.0 38.0 38.0 35.0 38.0 85-89 36.638999999999996 38.0 38.0 38.0 34.4 38.0 90-94 36.49595 38.0 38.0 38.0 34.0 38.0 95-99 36.459649999999996 38.0 38.0 38.0 34.0 38.0 100-104 36.31995 38.0 38.0 38.0 34.0 38.0 105-109 36.166199999999996 38.0 37.0 38.0 33.2 38.0 110-114 36.077549999999995 38.0 37.0 38.0 33.2 38.0 115-119 35.9307 38.0 37.0 38.0 32.6 38.0 120-124 35.76055 38.0 36.6 38.0 31.8 38.0 125-129 35.45795 38.0 36.0 38.0 30.6 38.0 130-134 35.107000000000006 38.0 36.0 38.0 28.8 38.0 135-139 34.8285 38.0 35.2 38.0 28.0 38.0 140-144 34.611399999999996 38.0 35.0 38.0 27.8 38.0 145-149 34.02075 38.0 35.0 38.0 23.6 38.0 150-151 30.384625 36.5 29.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 2.0 7 1.0 8 0.0 9 1.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 2.0 16 0.0 17 3.0 18 2.0 19 6.0 20 3.0 21 6.0 22 9.0 23 12.0 24 12.0 25 15.0 26 27.0 27 24.0 28 22.0 29 36.0 30 49.0 31 69.0 32 65.0 33 77.0 34 156.0 35 299.0 36 655.0 37 2445.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.325 17.025000000000002 13.925 27.725 2 24.6 24.099999999999998 34.0 17.299999999999997 3 21.0 27.700000000000003 29.5 21.8 4 24.175 35.9 20.75 19.175 5 23.175 37.625 21.425 17.775 6 19.575 37.85 23.7 18.875 7 18.7 19.525000000000002 40.375 21.4 8 21.6 22.525000000000002 27.800000000000004 28.075 9 24.099999999999998 22.95 28.175 24.775 10-14 23.44 28.470000000000002 26.795 21.295 15-19 22.915 28.335 27.565 21.185000000000002 20-24 23.04 27.985 27.38 21.595 25-29 22.84 27.785 28.16 21.215 30-34 23.465812393632994 27.94073480828912 27.385123635999598 21.208329162078286 35-39 23.175099631740906 28.204610805629827 27.38737829793674 21.23291126469253 40-44 23.8208985566172 27.7190485871112 27.637731246188252 20.82232161008335 45-49 23.544999999999998 27.79 27.889999999999997 20.775 50-54 22.805 28.560000000000002 27.644999999999996 20.990000000000002 55-59 23.44 28.035 27.29 21.235 60-64 23.905 27.534999999999997 27.85 20.71 65-69 23.580000000000002 28.125 27.755000000000003 20.54 70-74 23.66 28.144999999999996 27.455000000000002 20.74 75-79 23.71 27.215 27.77 21.305 80-84 23.785 27.58 28.134999999999998 20.5 85-89 23.925 27.634999999999998 28.044999999999998 20.395 90-94 23.825 27.92 27.845 20.41 95-99 23.875 28.249999999999996 27.33 20.544999999999998 100-104 23.93 28.405 26.840000000000003 20.825 105-109 23.945 28.189999999999998 27.485 20.380000000000003 110-114 24.279999999999998 28.1 27.495000000000005 20.125 115-119 23.724999999999998 28.050000000000004 27.77 20.455000000000002 120-124 24.104999999999997 27.22 27.950000000000003 20.724999999999998 125-129 24.46 28.055000000000003 27.065 20.419999999999998 130-134 24.69 28.105000000000004 27.165 20.04 135-139 24.315 27.400000000000002 27.944999999999997 20.34 140-144 24.425 27.83 27.200000000000003 20.544999999999998 145-149 24.23 27.96 27.315 20.495 150-151 25.75 27.537499999999998 27.462500000000002 19.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.5 24 1.0 25 2.0 26 2.5 27 1.5 28 4.5 29 7.5 30 9.5 31 12.5 32 17.5 33 26.5 34 35.0 35 49.5 36 65.5 37 98.5 38 132.0 39 156.5 40 201.5 41 227.0 42 242.0 43 264.5 44 291.0 45 310.5 46 287.0 47 256.5 48 248.5 49 231.5 50 192.5 51 147.5 52 119.0 53 100.0 54 74.0 55 56.5 56 39.0 57 27.5 58 19.0 59 8.5 60 8.0 61 8.5 62 4.5 63 2.5 64 3.5 65 2.0 66 1.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.11 35-39 0.885 40-44 1.6199999999999999 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.32499999999999996 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.5375 0.0 0.0 0.0 0.0 106-107 0.7250000000000001 0.0 0.0 0.0 0.0 108-109 0.85 0.0 0.0 0.0 0.0 110-111 0.95 0.0 0.0 0.0 0.0 112-113 0.95 0.0 0.0 0.0 0.0 114-115 1.0875 0.0 0.0 0.0 0.0 116-117 1.1875 0.0 0.0 0.0 0.0 118-119 1.5125000000000002 0.0 0.0 0.0 0.0 120-121 1.6625 0.0 0.0 0.0 0.0 122-123 1.7625 0.0 0.0 0.0 0.0 124-125 1.9625 0.0 0.0 0.0 0.0 126-127 2.225 0.0 0.0 0.0 0.0 128-129 2.375 0.0 0.0 0.0 0.0 130-131 2.5875 0.0 0.0 0.0 0.0 132-133 2.75 0.0 0.0 0.0 0.0 134-135 3.1375 0.0 0.0 0.0 0.0 136-137 3.45 0.0 0.0 0.0 0.0 138-139 3.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTGCA 10 0.0068803662 144.65 4 >>END_MODULE Read 952300 spots for SRR7171936.sra Written 952300 spots for SRR7171936.sra Read 952300 spots for SRR7171936.sra Written 952300 spots for SRR7171936.sra Read 952300 spots for SRR7171936.sra Written 952300 spots for SRR7171936.sra Read 952300 spots for SRR7171936.sra Written 952300 spots for SRR7171936.sra Read 952300 spots for SRR7171936.sra Written 952300 spots for SRR7171936.sra Read 952300 spots for SRR7171936.sra Written 952300 spots for SRR7171936.sra Read 952300 spots for SRR7171936.sra Written 952300 spots for SRR7171936.sra Read 952300 spots for SRR7171936.sra Written 952300 spots for SRR7171936.sra Read 952300 spots for SRR7171936.sra Written 952300 spots for SRR7171936.sra Read 952300 spots for SRR7171936.sra Written 952300 spots for SRR7171936.sra Read 952300 spots for SRR7171936.sra Written 952300 spots for SRR7171936.sra Read 952300 spots for SRR7171936.sra Written 952300 spots for SRR7171936.sra Read 952300 spots for SRR7171936.sra Written 952300 spots for SRR7171936.sra Read 952300 spots for SRR7171936.sra Written 952300 spots for SRR7171936.sra Read 952300 spots for SRR7171936.sra Written 952300 spots for SRR7171936.sra Read 952300 spots for SRR7171936.sra Written 952300 spots for SRR7171936.sra Read 952300 spots for SRR7171936.sra Written 952300 spots for SRR7171936.sra Read 952300 spots for SRR7171936.sra Written 952300 spots for SRR7171936.sra Read 952300 spots for SRR7171936.sra Written 952300 spots for SRR7171936.sra Read 952300 spots for SRR7171936.sra Written 952300 spots for SRR7171936.sra SRR ids: ['SRR7171936.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5fny6qag SRR7171936.sra spots: 19046000 blocks: [[1, 952300], [952301, 1904600], [1904601, 2856900], [2856901, 3809200], [3809201, 4761500], [4761501, 5713800], [5713801, 6666100], [6666101, 7618400], [7618401, 8570700], [8570701, 9523000], [9523001, 10475300], [10475301, 11427600], [11427601, 12379900], [12379901, 13332200], [13332201, 14284500], [14284501, 15236800], [15236801, 16189100], [16189101, 17141400], [17141401, 18093700], [18093701, 19046000]] SRR7171936 file size 6432364 SRR7171936 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171936 SRR7171936_1.fastq SRR7171936_2.fastq Input file: SRR7171936_1.fastq Paired file: SRR7171936_2.fastq trimmed: SRR7171936-trimmed-pair1.fastq, SRR7171936-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 02:23:28 2025 >> started Fri Feb 14 02:23:48 2025 >> done (20.375s) 19046000 read pairs processed; of these: 13259 ( 0.07%) short read pairs filtered out after trimming by size control 10560 ( 0.06%) empty read pairs filtered out after trimming by size control 19022181 (99.87%) read pairs available; of these: 7378210 (38.79%) trimmed read pairs available after processing 11643971 (61.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 3 0.00% 21 0 0.00% 22 3 0.00% 23 5 0.00% 24 5 0.00% 25 7 0.00% 26 4 0.00% 27 5 0.00% 28 5 0.00% 29 4 0.00% 30 3 0.00% 31 0 0.00% 32 2 0.00% 33 4 0.00% 34 4 0.00% 35 7 0.00% 36 7 0.00% 37 3 0.00% 38 6 0.00% 39 3 0.00% 40 12 0.00% 41 9 0.00% 42 9 0.00% 43 9 0.00% 44 15 0.00% 45 11 0.00% 46 11 0.00% 47 15 0.00% 48 15 0.00% 49 27 0.00% 50 30 0.00% 51 29 0.00% 52 36 0.00% 53 52 0.00% 54 36 0.00% 55 46 0.00% 56 56 0.00% 57 73 0.00% 58 62 0.00% 59 90 0.00% 60 68 0.00% 61 107 0.00% 62 117 0.00% 63 143 0.00% 64 158 0.00% 65 162 0.00% 66 193 0.00% 67 224 0.00% 68 256 0.00% 69 316 0.00% 70 333 0.00% 71 385 0.00% 72 419 0.00% 73 519 0.00% 74 596 0.00% 75 693 0.00% 76 796 0.00% 77 859 0.00% 78 974 0.01% 79 1092 0.01% 80 1214 0.01% 81 1333 0.01% 82 1611 0.01% 83 1845 0.01% 84 2683 0.01% 85 3145 0.02% 86 3616 0.02% 87 4357 0.02% 88 4440 0.02% 89 4276 0.02% 90 4652 0.02% 91 5103 0.03% 92 5478 0.03% 93 5734 0.03% 94 6284 0.03% 95 6610 0.03% 96 7119 0.04% 97 7346 0.04% 98 7648 0.04% 99 8439 0.04% 100 8989 0.05% 101 9297 0.05% 102 10220 0.05% 103 11020 0.06% 104 11526 0.06% 105 12269 0.06% 106 12957 0.07% 107 13634 0.07% 108 13777 0.07% 109 15026 0.08% 110 15962 0.08% 111 16824 0.09% 112 17477 0.09% 113 18659 0.10% 114 19606 0.10% 115 20637 0.11% 116 21406 0.11% 117 22281 0.12% 118 22935 0.12% 119 24226 0.13% 120 24885 0.13% 121 26226 0.14% 122 27376 0.14% 123 28549 0.15% 124 30031 0.16% 125 31424 0.17% 126 32801 0.17% 127 34248 0.18% 128 35890 0.19% 129 37560 0.20% 130 38895 0.20% 131 41024 0.22% 132 43205 0.23% 133 46063 0.24% 134 48814 0.26% 135 52261 0.27% 136 56189 0.30% 137 58622 0.31% 138 63291 0.33% 139 68293 0.36% 140 73486 0.39% 141 80863 0.43% 142 89802 0.47% 143 101265 0.53% 144 117753 0.62% 145 140395 0.74% 146 175824 0.92% 147 239695 1.26% 148 368600 1.94% 149 750440 3.95% 150 3993644 20.99% 151 11643971 61.21% 19022181 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.51 fanout-score-rank=32 prefix-density=0.17 prefix-fanout=2.3 sequence=CAGGTGCAGTTTGATCCACATTTGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=56.18 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=7.0 sequence=AAGAAAAACATTACGATTATTACATTACATGCGCAATTGGGATAAAAAGGCCCTTGAAGAAATACACGTCACTGTTATAGCACGCGCTTACTTATAGGTACAAATGCACAAAAGGCCAACACGGAGAAAATGGAACAAACTGGGCTTGATTTTCATCTTTAATACATCATCAAATGGCCAAAAGTAAAGCATCACAATCATCACTTCTTGAAAGGAATGGCTCT criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=4.95 fanout-score-rank=24 prefix-density=0.27 prefix-fanout=3.8 sequence=TGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.10 sequence-density-rank=15 fanout-score=23.80 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=8.0 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7171936 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 02:24:35 Started mapping on | Feb 14 02:24:35 Finished on | Feb 14 02:26:59 Mapping speed, Million of reads per hour | 475.55 Number of input reads | 19022181 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 17802570 Uniquely mapped reads % | 93.59% Average mapped length | 296.27 Number of splices: Total | 18253833 Number of splices: Annotated (sjdb) | 17935489 Number of splices: GT/AG | 17969989 Number of splices: GC/AG | 228586 Number of splices: AT/AC | 13689 Number of splices: Non-canonical | 41569 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 437900 % of reads mapped to multiple loci | 2.30% Number of reads mapped to too many loci | 62216 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.71% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 795266 795266 795266 N_multimapping 437900 437900 437900 N_noFeature 411432 17639167 486556 N_ambiguous 180869 1502 91510 UnstrandedReadsAssigned:17210269 PositiveStrandReadsAssigned:161901 NegativeStrandReadsAssigned:17224504 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171936 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171936-trimmed-pair1.fastq SRR7171936-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,022,181 reads, 17,103,255 reads pseudoaligned [quant] estimated average fragment length: 249.482 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,127 rounds 52401 SRR7171936.ke.tsv 34699 SRR7171936.se.tsv 87100 total ==> SRR7171936.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1769.52 2127 69.4853 Potri.005G024800.1.v4.1 1035 786.518 517 37.9982 Potri.004G059700.1.v4.1 961 712.529 20 1.62259 Potri.007G009000.2.v4.1 1416 1167.52 0 0 Potri.003G141000.2.v4.1 2943 2694.52 782.185 16.7807 Potri.016G087400.1.v4.1 270 70.9987 1127 917.602 Potri.015G069301.1.v4.1 564 318.414 0 0 Potri.010G195200.1.v4.1 1773 1524.52 267 10.1242 Potri.012G127500.1.v4.1 977 728.529 9940 788.715 ==> SRR7171936.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 25 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 404 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 101 SRR7171936 completed mapping pipeline successfully