Starting /dee2/code/volunteer_pipeline.sh SRR7171937 current disk space = 3088202674176 free memory = 1576719712 SRR7171937 SRAfilesize 14235199979f296f78d38e89178c6baf SRR7171937.sra SRR7171937.sra file validated SRR7171937 is paired end SRR7171937 is conventional basespace SRR7171937 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171937_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.702 32.0 18.0 33.0 18.0 33.0 2 24.899 25.0 18.0 31.0 18.0 33.0 3 28.5425 29.0 27.0 31.0 18.0 33.0 4 30.74275 31.0 29.0 33.0 27.0 33.0 5 31.71 33.0 32.0 33.0 30.0 33.0 6 36.3345 37.0 36.0 38.0 34.0 38.0 7 37.2235 38.0 38.0 38.0 36.0 38.0 8 37.31025 38.0 38.0 38.0 36.0 38.0 9 37.34725 38.0 38.0 38.0 37.0 38.0 10-14 37.47705 38.0 38.0 38.0 37.0 38.0 15-19 37.517 38.0 38.0 38.0 37.2 38.0 20-24 37.47619999999999 38.0 38.0 38.0 37.2 38.0 25-29 37.45375 38.0 38.0 38.0 37.2 38.0 30-34 37.455 38.0 38.0 38.0 37.0 38.0 35-39 37.41074999999999 38.0 38.0 38.0 37.0 38.0 40-44 37.4281 38.0 38.0 38.0 37.0 38.0 45-49 37.358799999999995 38.0 38.0 38.0 37.0 38.0 50-54 37.291050000000006 38.0 38.0 38.0 36.8 38.0 55-59 37.16875 38.0 38.0 38.0 36.2 38.0 60-64 37.1441 38.0 38.0 38.0 36.0 38.0 65-69 37.1437 38.0 38.0 38.0 36.0 38.0 70-74 37.059099999999994 38.0 38.0 38.0 36.0 38.0 75-79 37.03355 38.0 38.0 38.0 36.0 38.0 80-84 36.97695 38.0 38.0 38.0 36.0 38.0 85-89 36.9313 38.0 38.0 38.0 35.8 38.0 90-94 36.7583 38.0 38.0 38.0 34.8 38.0 95-99 36.6553 38.0 38.0 38.0 34.6 38.0 100-104 36.56145 38.0 38.0 38.0 34.0 38.0 105-109 36.4301 38.0 38.0 38.0 34.0 38.0 110-114 36.4377 38.0 37.8 38.0 34.0 38.0 115-119 36.20385 38.0 37.0 38.0 33.4 38.0 120-124 36.12265000000001 38.0 37.0 38.0 33.0 38.0 125-129 35.9516 38.0 36.8 38.0 32.4 38.0 130-134 35.6301 38.0 36.0 38.0 31.0 38.0 135-139 35.2595 38.0 36.0 38.0 30.0 38.0 140-144 34.88719999999999 38.0 35.2 38.0 28.6 38.0 145-149 34.316599999999994 38.0 35.0 38.0 26.0 38.0 150-151 31.41275 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 1.0 15 0.0 16 1.0 17 0.0 18 0.0 19 1.0 20 2.0 21 3.0 22 6.0 23 7.0 24 9.0 25 13.0 26 8.0 27 23.0 28 18.0 29 30.0 30 34.0 31 41.0 32 60.0 33 99.0 34 160.0 35 323.0 36 816.0 37 2344.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.6 16.400000000000002 10.725 35.275 2 16.35 22.875 37.375 23.400000000000002 3 18.425 26.450000000000003 26.400000000000002 28.725 4 20.875 35.575 23.0 20.549999999999997 5 19.6 35.075 24.65 20.674999999999997 6 16.975 37.724999999999994 25.1 20.200000000000003 7 13.750000000000002 21.55 45.425 19.275000000000002 8 17.875 22.225 30.625000000000004 29.275000000000002 9 18.275 22.05 31.85 27.825 10-14 19.885 29.4 26.919999999999998 23.794999999999998 15-19 19.82 28.449999999999996 28.015 23.715 20-24 20.315 28.470000000000002 27.92 23.294999999999998 25-29 19.950000000000003 27.98 28.110000000000003 23.96 30-34 19.695 28.68 28.025 23.599999999999998 35-39 19.675 28.415000000000003 28.000000000000004 23.91 40-44 19.67 28.53 27.495000000000005 24.305 45-49 19.68 28.735 27.805000000000003 23.78 50-54 20.205000000000002 28.660000000000004 27.325 23.810000000000002 55-59 19.78 29.125 27.474999999999998 23.62 60-64 20.11 28.7 27.815 23.375 65-69 19.935 28.48 27.36 24.224999999999998 70-74 20.02 28.645 27.655 23.68 75-79 20.125 28.849999999999998 27.175 23.849999999999998 80-84 20.095 28.375 27.495000000000005 24.035 85-89 20.18 28.1 27.57 24.15 90-94 20.085 28.285 27.79 23.84 95-99 19.98 28.965000000000003 27.279999999999998 23.775 100-104 20.13 27.96 27.525 24.385 105-109 20.119999999999997 28.225 27.189999999999998 24.465 110-114 20.005 28.42 27.61 23.965 115-119 20.380000000000003 28.055000000000003 27.894999999999996 23.669999999999998 120-124 20.044999999999998 27.939999999999998 28.15 23.865 125-129 20.655 27.715 27.915 23.715 130-134 20.955 28.575 27.195000000000004 23.275000000000002 135-139 20.435 27.6 28.215 23.75 140-144 20.64 28.075 27.49 23.794999999999998 145-149 20.87 28.055000000000003 27.560000000000002 23.515 150-151 20.8875 27.474999999999998 28.799999999999997 22.8375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 2.5 24 4.5 25 3.0 26 3.5 27 6.0 28 9.0 29 12.0 30 19.0 31 30.5 32 39.0 33 43.0 34 51.0 35 70.0 36 93.0 37 104.0 38 123.0 39 166.5 40 204.5 41 229.0 42 255.5 43 271.0 44 281.5 45 276.5 46 264.5 47 251.5 48 229.0 49 196.5 50 161.5 51 142.0 52 112.0 53 87.5 54 67.5 55 47.5 56 36.0 57 27.5 58 24.0 59 16.0 60 9.5 61 10.5 62 9.0 63 4.5 64 1.5 65 0.5 66 0.0 67 0.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84973703981969 99.675 2 0.12521913348359628 0.25 3 0.025043826696719257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.2125 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.725 0.0 0.0 0.0 0.0 110-111 0.8999999999999999 0.0 0.0 0.0 0.0 112-113 1.0125 0.0 0.0 0.0 0.0 114-115 1.1749999999999998 0.0 0.0 0.0 0.0 116-117 1.2875 0.0 0.0 0.0 0.0 118-119 1.4125 0.0 0.0 0.0 0.0 120-121 1.5 0.0 0.0 0.0 0.0 122-123 1.6625 0.0 0.0 0.0 0.0 124-125 1.775 0.0 0.0 0.0 0.0 126-127 1.9375 0.0 0.0 0.0 0.0 128-129 2.1625 0.0 0.0 0.0 0.0 130-131 2.2750000000000004 0.0 0.0 0.0 0.0 132-133 2.5250000000000004 0.0 0.0 0.0 0.0 134-135 2.7249999999999996 0.0 0.0 0.0 0.0 136-137 2.95 0.0 0.0 0.0 0.0 138-139 3.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171937 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171937_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.92325 33.0 33.0 34.0 32.0 34.0 2 33.06625 34.0 33.0 34.0 32.0 34.0 3 33.09675 34.0 33.0 34.0 32.0 34.0 4 33.09425 34.0 33.0 34.0 33.0 34.0 5 33.08325 34.0 33.0 34.0 33.0 34.0 6 37.27875 38.0 38.0 38.0 37.0 38.0 7 37.2405 38.0 38.0 38.0 37.0 38.0 8 37.074 38.0 38.0 38.0 36.0 38.0 9 37.20825 38.0 38.0 38.0 37.0 38.0 10-14 37.23545 38.0 38.0 38.0 37.0 38.0 15-19 37.1443 38.0 38.0 38.0 37.0 38.0 20-24 37.1165 38.0 38.0 38.0 37.0 38.0 25-29 37.103249999999996 38.0 38.0 38.0 36.8 38.0 30-34 37.05650000000001 38.0 38.0 38.0 36.6 38.0 35-39 36.8381 38.0 38.0 38.0 36.2 38.0 40-44 36.552749999999996 38.0 38.0 38.0 35.6 38.0 45-49 36.90865 38.0 38.0 38.0 36.0 38.0 50-54 36.9888 38.0 38.0 38.0 36.0 38.0 55-59 36.913 38.0 38.0 38.0 36.0 38.0 60-64 36.85850000000001 38.0 38.0 38.0 36.0 38.0 65-69 36.8414 38.0 38.0 38.0 36.0 38.0 70-74 36.8274 38.0 38.0 38.0 35.8 38.0 75-79 36.708099999999995 38.0 38.0 38.0 35.0 38.0 80-84 36.6648 38.0 38.0 38.0 35.0 38.0 85-89 36.49695 38.0 38.0 38.0 34.2 38.0 90-94 36.36955 38.0 38.0 38.0 34.0 38.0 95-99 36.38355 38.0 38.0 38.0 34.0 38.0 100-104 36.19695 38.0 38.0 38.0 33.8 38.0 105-109 36.077149999999996 38.0 37.4 38.0 33.6 38.0 110-114 35.866949999999996 38.0 37.0 38.0 32.8 38.0 115-119 35.7332 38.0 36.8 38.0 32.2 38.0 120-124 35.5431 38.0 36.8 38.0 31.0 38.0 125-129 35.338350000000005 38.0 36.0 38.0 30.6 38.0 130-134 35.00545 38.0 36.0 38.0 28.0 38.0 135-139 34.6739 38.0 35.0 38.0 27.6 38.0 140-144 34.3429 38.0 35.0 38.0 25.6 38.0 145-149 33.66515 38.0 34.8 38.0 22.2 38.0 150-151 30.252000000000002 36.5 28.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 3.0 4 1.0 5 1.0 6 1.0 7 1.0 8 2.0 9 2.0 10 1.0 11 0.0 12 1.0 13 1.0 14 2.0 15 2.0 16 3.0 17 1.0 18 5.0 19 4.0 20 3.0 21 7.0 22 12.0 23 9.0 24 9.0 25 8.0 26 20.0 27 22.0 28 29.0 29 31.0 30 51.0 31 43.0 32 68.0 33 96.0 34 177.0 35 300.0 36 657.0 37 2420.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.95 17.599999999999998 13.8 25.650000000000002 2 23.724999999999998 24.275 33.875 18.125 3 21.0 27.200000000000003 30.825000000000003 20.974999999999998 4 25.525 35.575 20.175 18.725 5 24.575 37.15 22.1 16.175 6 19.1 38.074999999999996 23.849999999999998 18.975 7 19.0 19.425 40.775 20.8 8 20.825 23.0 28.725 27.450000000000003 9 23.45 24.725 27.0 24.825 10-14 22.98 28.999999999999996 27.045 20.974999999999998 15-19 23.189999999999998 28.29 27.955000000000002 20.565 20-24 23.73 28.294999999999998 27.089999999999996 20.885 25-29 23.315 28.37 27.725 20.59 30-34 23.29 28.315 27.474999999999998 20.919999999999998 35-39 23.10594627226079 28.347922326189757 27.638595432136032 20.90753596941342 40-44 23.12127035501163 28.016587438049967 27.657530090017197 21.204612116921208 45-49 23.095 27.49 28.22 21.195 50-54 23.02 27.834999999999997 28.32 20.825 55-59 23.685000000000002 28.21 27.71 20.395 60-64 23.705000000000002 27.845 27.51 20.94 65-69 23.595 28.444999999999997 27.66 20.3 70-74 23.330000000000002 27.79 28.09 20.79 75-79 23.94 27.58 27.82 20.66 80-84 24.04 27.694999999999997 27.589999999999996 20.674999999999997 85-89 24.395 28.095 27.52 19.99 90-94 23.955000000000002 27.82 28.025 20.200000000000003 95-99 23.330000000000002 27.26 28.499999999999996 20.91 100-104 23.87 28.22 27.41 20.5 105-109 23.825 28.485 27.48 20.21 110-114 23.735 28.294999999999998 27.595 20.375 115-119 23.185 28.175 28.505000000000003 20.135 120-124 23.56 28.215 27.389999999999997 20.835 125-129 24.04 27.815 28.215 19.93 130-134 23.880000000000003 27.865000000000002 27.875 20.380000000000003 135-139 24.085 27.889999999999997 27.66 20.365 140-144 24.765 27.88 27.375 19.98 145-149 24.709999999999997 27.775 27.93 19.585 150-151 24.8 27.150000000000002 28.212500000000002 19.8375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 2.0 27 5.5 28 6.0 29 5.5 30 10.5 31 19.5 32 25.5 33 29.5 34 38.0 35 48.5 36 65.0 37 100.5 38 135.5 39 164.5 40 200.5 41 225.0 42 266.0 43 306.5 44 293.5 45 286.0 46 287.0 47 259.5 48 243.5 49 213.5 50 165.0 51 138.5 52 111.5 53 83.0 54 66.0 55 50.5 56 40.5 57 31.5 58 19.5 59 15.0 60 14.0 61 8.0 62 3.5 63 4.5 64 3.0 65 1.5 66 1.5 67 1.0 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.61 40-44 1.13 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.2125 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.725 0.0 0.0 0.0 0.0 110-111 0.8999999999999999 0.0 0.0 0.0 0.0 112-113 1.0125 0.0 0.0 0.0 0.0 114-115 1.1749999999999998 0.0 0.0 0.0 0.0 116-117 1.2875 0.0 0.0 0.0 0.0 118-119 1.4125 0.0 0.0 0.0 0.0 120-121 1.4875 0.0 0.0 0.0 0.0 122-123 1.6375000000000002 0.0 0.0 0.0 0.0 124-125 1.75 0.0 0.0 0.0 0.0 126-127 1.9125 0.0 0.0 0.0 0.0 128-129 2.1375 0.0 0.0 0.0 0.0 130-131 2.25 0.0 0.0 0.0 0.0 132-133 2.5 0.0 0.0 0.0 0.0 134-135 2.7125 0.0 0.0 0.0 0.0 136-137 2.925 0.0 0.0 0.0 0.0 138-139 3.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTCGCA 10 0.0068661636 144.75 5 >>END_MODULE Read 752316 spots for SRR7171937.sra Written 752316 spots for SRR7171937.sra Read 752316 spots for SRR7171937.sra Written 752316 spots for SRR7171937.sra Read 752316 spots for SRR7171937.sra Written 752316 spots for SRR7171937.sra Read 752316 spots for SRR7171937.sra Written 752316 spots for SRR7171937.sra Read 752316 spots for SRR7171937.sra Written 752316 spots for SRR7171937.sra Read 752316 spots for SRR7171937.sra Written 752316 spots for SRR7171937.sra Read 752316 spots for SRR7171937.sra Written 752316 spots for SRR7171937.sra Read 752316 spots for SRR7171937.sra Written 752316 spots for SRR7171937.sra Read 752316 spots for SRR7171937.sra Written 752316 spots for SRR7171937.sra Read 752331 spots for SRR7171937.sra Written 752331 spots for SRR7171937.sra Read 752316 spots for SRR7171937.sra Written 752316 spots for SRR7171937.sra Read 752316 spots for SRR7171937.sra Written 752316 spots for SRR7171937.sra Read 752316 spots for SRR7171937.sra Written 752316 spots for SRR7171937.sra Read 752316 spots for SRR7171937.sra Written 752316 spots for SRR7171937.sra Read 752316 spots for SRR7171937.sra Written 752316 spots for SRR7171937.sra Read 752316 spots for SRR7171937.sra Written 752316 spots for SRR7171937.sra Read 752316 spots for SRR7171937.sra Written 752316 spots for SRR7171937.sra Read 752316 spots for SRR7171937.sra Written 752316 spots for SRR7171937.sra Read 752316 spots for SRR7171937.sra Written 752316 spots for SRR7171937.sra Read 752316 spots for SRR7171937.sra Written 752316 spots for SRR7171937.sra SRR ids: ['SRR7171937.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e_mxau9b SRR7171937.sra spots: 15046335 blocks: [[1, 752316], [752317, 1504632], [1504633, 2256948], [2256949, 3009264], [3009265, 3761580], [3761581, 4513896], [4513897, 5266212], [5266213, 6018528], [6018529, 6770844], [6770845, 7523160], [7523161, 8275476], [8275477, 9027792], [9027793, 9780108], [9780109, 10532424], [10532425, 11284740], [11284741, 12037056], [12037057, 12789372], [12789373, 13541688], [13541689, 14294004], [14294005, 15046335]] SRR7171937 file size 5077008 SRR7171937 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171937 SRR7171937_1.fastq SRR7171937_2.fastq Input file: SRR7171937_1.fastq Paired file: SRR7171937_2.fastq trimmed: SRR7171937-trimmed-pair1.fastq, SRR7171937-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 03:35:07 2025 >> started Fri Feb 14 03:35:24 2025 >> done (17.177s) 15046335 read pairs processed; of these: 18311 ( 0.12%) short read pairs filtered out after trimming by size control 15149 ( 0.10%) empty read pairs filtered out after trimming by size control 15012875 (99.78%) read pairs available; of these: 6039942 (40.23%) trimmed read pairs available after processing 8972933 (59.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 4 0.00% 21 2 0.00% 22 3 0.00% 23 5 0.00% 24 7 0.00% 25 7 0.00% 26 6 0.00% 27 4 0.00% 28 6 0.00% 29 5 0.00% 30 0 0.00% 31 3 0.00% 32 3 0.00% 33 3 0.00% 34 6 0.00% 35 1 0.00% 36 3 0.00% 37 5 0.00% 38 8 0.00% 39 3 0.00% 40 4 0.00% 41 8 0.00% 42 6 0.00% 43 5 0.00% 44 8 0.00% 45 8 0.00% 46 10 0.00% 47 13 0.00% 48 16 0.00% 49 14 0.00% 50 15 0.00% 51 19 0.00% 52 19 0.00% 53 21 0.00% 54 25 0.00% 55 33 0.00% 56 30 0.00% 57 45 0.00% 58 43 0.00% 59 66 0.00% 60 73 0.00% 61 70 0.00% 62 92 0.00% 63 87 0.00% 64 101 0.00% 65 124 0.00% 66 163 0.00% 67 158 0.00% 68 164 0.00% 69 201 0.00% 70 177 0.00% 71 280 0.00% 72 301 0.00% 73 327 0.00% 74 430 0.00% 75 443 0.00% 76 537 0.00% 77 622 0.00% 78 654 0.00% 79 735 0.00% 80 787 0.01% 81 976 0.01% 82 1120 0.01% 83 1315 0.01% 84 2168 0.01% 85 2773 0.02% 86 2814 0.02% 87 3283 0.02% 88 3251 0.02% 89 3409 0.02% 90 3635 0.02% 91 3774 0.03% 92 3976 0.03% 93 4250 0.03% 94 4608 0.03% 95 4762 0.03% 96 5046 0.03% 97 5359 0.04% 98 5667 0.04% 99 5879 0.04% 100 6287 0.04% 101 6827 0.05% 102 7116 0.05% 103 7814 0.05% 104 8252 0.05% 105 8605 0.06% 106 9138 0.06% 107 9602 0.06% 108 10143 0.07% 109 10570 0.07% 110 11147 0.07% 111 11939 0.08% 112 12416 0.08% 113 13180 0.09% 114 13841 0.09% 115 14474 0.10% 116 15204 0.10% 117 16034 0.11% 118 16638 0.11% 119 17325 0.12% 120 17955 0.12% 121 18972 0.13% 122 19647 0.13% 123 20715 0.14% 124 22200 0.15% 125 23248 0.15% 126 23945 0.16% 127 25180 0.17% 128 25931 0.17% 129 27222 0.18% 130 28759 0.19% 131 30309 0.20% 132 32286 0.22% 133 33932 0.23% 134 36624 0.24% 135 38993 0.26% 136 41692 0.28% 137 44278 0.29% 138 47633 0.32% 139 51343 0.34% 140 56522 0.38% 141 62337 0.42% 142 69582 0.46% 143 80237 0.53% 144 94380 0.63% 145 112815 0.75% 146 144519 0.96% 147 198867 1.32% 148 310131 2.07% 149 636971 4.24% 150 3361078 22.39% 151 8972933 59.77% 15012875 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.56 fanout-score-rank=21 prefix-density=0.53 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=23 fanout-score=29.45 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=9.6 sequence=ATCAACCTCTGCTGGTCTGG criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=3.08 fanout-score-rank=16 prefix-density=0.55 prefix-fanout=3.0 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=26 fanout-score=27.82 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=9.6 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7171937 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 03:36:09 Started mapping on | Feb 14 03:36:10 Finished on | Feb 14 03:37:44 Mapping speed, Million of reads per hour | 574.96 Number of input reads | 15012875 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14110509 Uniquely mapped reads % | 93.99% Average mapped length | 296.49 Number of splices: Total | 14054913 Number of splices: Annotated (sjdb) | 13793598 Number of splices: GT/AG | 13836831 Number of splices: GC/AG | 174390 Number of splices: AT/AC | 10496 Number of splices: Non-canonical | 33196 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.51 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 333253 % of reads mapped to multiple loci | 2.22% Number of reads mapped to too many loci | 32250 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.51% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 585719 585719 585719 N_multimapping 333253 333253 333253 N_noFeature 370731 13966645 438958 N_ambiguous 148931 971 72781 UnstrandedReadsAssigned:13590847 PositiveStrandReadsAssigned:142893 NegativeStrandReadsAssigned:13598770 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171937 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171937-trimmed-pair1.fastq SRR7171937-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,012,875 reads, 13,488,137 reads pseudoaligned [quant] estimated average fragment length: 260.371 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,299 rounds 52401 SRR7171937.ke.tsv 34699 SRR7171937.se.tsv 87100 total ==> SRR7171937.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1758.63 1495 61.1666 Potri.005G024800.1.v4.1 1035 775.629 280 25.9748 Potri.004G059700.1.v4.1 961 701.651 11 1.12803 Potri.007G009000.2.v4.1 1416 1156.63 1 0.062209 Potri.003G141000.2.v4.1 2943 2683.63 841.711 22.5677 Potri.016G087400.1.v4.1 270 69.9766 952 978.884 Potri.015G069301.1.v4.1 564 310.207 0 0 Potri.010G195200.1.v4.1 1773 1513.63 341 16.21 Potri.012G127500.1.v4.1 977 717.64 4203 421.405 ==> SRR7171937.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 73 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 345 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 211 SRR7171937 completed mapping pipeline successfully