Starting /dee2/code/volunteer_pipeline.sh SRR7171938 current disk space = 3088143183872 free memory = 1581751388 SRR7171938 SRAfilesize 77f402f3accc414b9dc5f4543ade1069 SRR7171938.sra SRR7171938.sra file validated SRR7171938 is paired end SRR7171938 is conventional basespace SRR7171938 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171938_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.66125 34.0 33.0 34.0 32.0 34.0 2 32.8975 34.0 33.0 34.0 31.0 34.0 3 32.7595 34.0 33.0 34.0 30.0 34.0 4 33.0725 34.0 33.0 34.0 32.0 34.0 5 33.18075 34.0 33.0 34.0 32.0 34.0 6 37.0005 38.0 37.0 38.0 35.0 38.0 7 37.337 38.0 38.0 38.0 36.0 38.0 8 37.532 38.0 38.0 38.0 37.0 38.0 9 37.53025 38.0 38.0 38.0 38.0 38.0 10-14 37.57325 38.0 38.0 38.0 37.8 38.0 15-19 37.5894 38.0 38.0 38.0 38.0 38.0 20-24 37.537099999999995 38.0 38.0 38.0 37.8 38.0 25-29 37.5219 38.0 38.0 38.0 37.8 38.0 30-34 37.5088 38.0 38.0 38.0 37.6 38.0 35-39 37.457600000000006 38.0 38.0 38.0 37.0 38.0 40-44 37.4557 38.0 38.0 38.0 37.2 38.0 45-49 37.427499999999995 38.0 38.0 38.0 37.0 38.0 50-54 37.368449999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.3438 38.0 38.0 38.0 37.0 38.0 60-64 37.33025 38.0 38.0 38.0 37.0 38.0 65-69 37.27465 38.0 38.0 38.0 36.8 38.0 70-74 37.20605 38.0 38.0 38.0 36.6 38.0 75-79 37.145500000000006 38.0 38.0 38.0 36.0 38.0 80-84 37.07875 38.0 38.0 38.0 36.0 38.0 85-89 37.089150000000004 38.0 38.0 38.0 36.0 38.0 90-94 36.98655 38.0 38.0 38.0 36.0 38.0 95-99 36.92635 38.0 38.0 38.0 35.8 38.0 100-104 36.8169 38.0 38.0 38.0 35.2 38.0 105-109 36.717600000000004 38.0 38.0 38.0 35.0 38.0 110-114 36.6144 38.0 38.0 38.0 34.6 38.0 115-119 36.5458 38.0 38.0 38.0 34.0 38.0 120-124 36.35645 38.0 38.0 38.0 34.0 38.0 125-129 36.1506 38.0 37.6 38.0 33.8 38.0 130-134 35.94355 38.0 37.2 38.0 33.0 38.0 135-139 35.9405 38.0 37.0 38.0 33.0 38.0 140-144 35.7199 38.0 36.2 38.0 32.4 38.0 145-149 35.384249999999994 38.0 36.0 38.0 31.8 38.0 150-151 32.498875 37.0 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 2.0 19 3.0 20 3.0 21 2.0 22 2.0 23 4.0 24 7.0 25 8.0 26 12.0 27 13.0 28 19.0 29 21.0 30 31.0 31 41.0 32 51.0 33 77.0 34 132.0 35 200.0 36 477.0 37 2893.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.10878112712975 16.644823066841415 8.230668414154653 36.01572739187418 2 18.025 21.675 32.425 27.875 3 18.425 25.025 26.8 29.75 4 21.25 32.95 23.7 22.1 5 21.9 34.825 24.275 19.0 6 17.825 36.8 24.5 20.875 7 13.3 22.85 43.75 20.1 8 18.025 25.275 28.549999999999997 28.15 9 17.125 24.675 32.125 26.075 10-14 19.79 30.255 26.68 23.275000000000002 15-19 19.045 28.92 27.93 24.104999999999997 20-24 19.470000000000002 28.48 28.22 23.830000000000002 25-29 19.715 29.18 27.555000000000003 23.549999999999997 30-34 19.665 28.325 27.944999999999997 24.065 35-39 20.07 28.49 27.58 23.86 40-44 19.955000000000002 28.48 27.275 24.29 45-49 20.09 28.189999999999998 28.134999999999998 23.585 50-54 20.02 28.565 27.845 23.57 55-59 19.63 28.43 27.77 24.169999999999998 60-64 20.349999999999998 27.700000000000003 27.715 24.235 65-69 20.175 28.444999999999997 27.48 23.9 70-74 19.645000000000003 28.355000000000004 27.77 24.23 75-79 20.07 28.655 27.67 23.605 80-84 20.115 28.355000000000004 27.525 24.005000000000003 85-89 19.939999999999998 27.73 28.294999999999998 24.035 90-94 20.03 28.365000000000002 27.634999999999998 23.97 95-99 20.23 28.735 27.27 23.765 100-104 20.115 28.16 27.74 23.985 105-109 20.125 27.955000000000002 27.82 24.099999999999998 110-114 20.125 28.67 27.655 23.549999999999997 115-119 20.275000000000002 28.08 27.529999999999998 24.115000000000002 120-124 20.105 27.525 28.084999999999997 24.285 125-129 20.755000000000003 27.92 27.29 24.035 130-134 20.515 28.29 27.87 23.325000000000003 135-139 20.125 28.02 27.884999999999998 23.97 140-144 21.005 27.575 27.544999999999998 23.875 145-149 21.115000000000002 27.884999999999998 27.235 23.765 150-151 20.837500000000002 28.4 26.4125 24.349999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 2.0 23 2.5 24 3.0 25 4.0 26 6.0 27 8.0 28 11.5 29 15.5 30 21.5 31 27.5 32 35.0 33 46.5 34 61.0 35 67.0 36 81.0 37 116.5 38 137.5 39 158.5 40 174.0 41 211.5 42 251.0 43 261.0 44 269.5 45 268.5 46 277.5 47 265.5 48 231.0 49 200.0 50 165.5 51 131.5 52 110.0 53 93.0 54 69.5 55 53.5 56 39.5 57 30.5 58 27.5 59 18.0 60 8.0 61 7.0 62 8.0 63 6.5 64 4.5 65 1.5 66 2.0 67 2.0 68 0.5 69 0.0 70 1.0 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.425 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.5375000000000001 0.0 0.0 0.0 0.0 108-109 0.6125 0.0 0.0 0.0 0.0 110-111 0.725 0.0 0.0 0.0 0.0 112-113 0.8 0.0 0.0 0.0 0.0 114-115 0.9125 0.0 0.0 0.0 0.0 116-117 0.975 0.0 0.0 0.0 0.0 118-119 1.125 0.0 0.0 0.0 0.0 120-121 1.2 0.0 0.0 0.0 0.0 122-123 1.3375 0.0 0.0 0.0 0.0 124-125 1.5375 0.0 0.0 0.0 0.0 126-127 1.7625 0.0 0.0 0.0 0.0 128-129 1.9625 0.0 0.0 0.0 0.0 130-131 2.0875 0.0 0.0 0.0 0.0 132-133 2.4125 0.0 0.0 0.0 0.0 134-135 2.7 0.0 0.0 0.0 0.0 136-137 2.9875 0.0 0.0 0.0 0.0 138-139 3.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCATAAG 10 0.0068343505 144.975 6 >>END_MODULE SRR7171938 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171938_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7095 33.0 33.0 34.0 32.0 34.0 2 32.76475 33.0 33.0 34.0 32.0 34.0 3 32.79875 34.0 33.0 34.0 32.0 34.0 4 32.6955 34.0 33.0 34.0 32.0 34.0 5 32.73875 34.0 33.0 34.0 32.0 34.0 6 36.88075 38.0 38.0 38.0 37.0 38.0 7 36.79625 38.0 38.0 38.0 36.0 38.0 8 36.86525 38.0 38.0 38.0 36.0 38.0 9 36.86375 38.0 38.0 38.0 37.0 38.0 10-14 36.823299999999996 38.0 38.0 38.0 36.4 38.0 15-19 36.704899999999995 38.0 38.0 38.0 36.2 38.0 20-24 36.65255 38.0 38.0 38.0 36.0 38.0 25-29 36.65955 38.0 38.0 38.0 36.0 38.0 30-34 36.579499999999996 38.0 38.0 38.0 36.0 38.0 35-39 36.4553 38.0 38.0 38.0 36.0 38.0 40-44 36.4462 38.0 38.0 38.0 36.0 38.0 45-49 36.56085 38.0 38.0 38.0 36.0 38.0 50-54 36.537099999999995 38.0 38.0 38.0 35.8 38.0 55-59 36.53405 38.0 38.0 38.0 35.8 38.0 60-64 36.5356 38.0 38.0 38.0 35.4 38.0 65-69 36.39495 38.0 38.0 38.0 35.0 38.0 70-74 36.3563 38.0 38.0 38.0 35.0 38.0 75-79 36.32985 38.0 38.0 38.0 34.8 38.0 80-84 36.30219999999999 38.0 38.0 38.0 34.4 38.0 85-89 36.16615 38.0 38.0 38.0 34.0 38.0 90-94 36.03679999999999 38.0 38.0 38.0 34.0 38.0 95-99 35.9756 38.0 38.0 38.0 34.0 38.0 100-104 35.76225 38.0 37.4 38.0 33.2 38.0 105-109 35.63195 38.0 37.0 38.0 32.2 38.0 110-114 35.63420000000001 38.0 37.0 38.0 32.4 38.0 115-119 35.399649999999994 38.0 37.0 38.0 31.0 38.0 120-124 35.274649999999994 38.0 36.8 38.0 30.4 38.0 125-129 35.055600000000005 38.0 36.2 38.0 29.0 38.0 130-134 34.795 38.0 36.0 38.0 28.0 38.0 135-139 34.4315 38.0 35.2 38.0 25.4 38.0 140-144 33.9723 38.0 35.0 38.0 22.8 38.0 145-149 33.4246 38.0 35.0 38.0 18.2 38.0 150-151 30.077624999999998 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 28.0 3 15.0 4 4.0 5 3.0 6 5.0 7 2.0 8 1.0 9 4.0 10 1.0 11 1.0 12 2.0 13 3.0 14 0.0 15 3.0 16 7.0 17 3.0 18 10.0 19 2.0 20 7.0 21 8.0 22 7.0 23 13.0 24 12.0 25 14.0 26 15.0 27 19.0 28 23.0 29 38.0 30 33.0 31 50.0 32 78.0 33 99.0 34 123.0 35 237.0 36 559.0 37 2571.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.893893893893896 19.96996996996997 14.28928928928929 21.846846846846844 2 25.64423317488116 24.993745308981737 31.098323742807104 18.263697773329998 3 21.66624968726545 27.920940705529144 31.623717788341253 18.789091818864147 4 24.143107330497873 34.10057543157368 22.842131598699027 18.914185639229423 5 24.06805103827871 36.45233925444083 21.441080810607957 18.038528896672503 6 20.0 37.95 23.575 18.475 7 19.325 19.6 39.175 21.9 8 20.875 23.474999999999998 27.150000000000002 28.499999999999996 9 22.175 26.974999999999998 27.250000000000004 23.599999999999998 10-14 23.3 28.32 26.419999999999998 21.959999999999997 15-19 23.14041318593367 28.362763243459554 27.88754939722875 20.60927417337802 20-24 23.664580725907385 28.570713391739677 27.038798498122652 20.72590738423029 25-29 23.629896803927462 28.138463079851718 27.572387536319003 20.659252579901814 30-34 22.70221509471785 28.966623233436906 27.683672446627245 20.647489225218003 35-39 23.509352590140917 28.37871721578657 27.22531467830099 20.886615515771524 40-44 23.311776206948416 28.440366972477065 27.4326966461122 20.815160174462324 45-49 23.447274911165607 28.0966918572644 27.486111806215906 20.969921425354087 50-54 23.489093456073647 28.362017210326197 27.596557934760856 20.552331398839303 55-59 23.230453704166877 28.522835275874144 27.772497623930768 20.47421339602821 60-64 23.544708941788357 27.945589117823566 27.985597119423883 20.524104820964194 65-69 24.03860579086863 28.189228384257635 27.114067110066507 20.65809871480722 70-74 23.77 28.165000000000003 27.905 20.16 75-79 24.165 27.295 28.189999999999998 20.349999999999998 80-84 23.555 28.51 27.49 20.445 85-89 24.23 27.655 27.775 20.34 90-94 23.515 28.804999999999996 27.584999999999997 20.095 95-99 23.93 27.625 27.62 20.825 100-104 24.04 28.24 27.24 20.48 105-109 24.025 27.415 28.610000000000003 19.950000000000003 110-114 23.595 28.15 27.235 21.02 115-119 24.69 27.97 27.54 19.8 120-124 23.375 28.384999999999998 27.750000000000004 20.49 125-129 24.279999999999998 27.595 28.1 20.025000000000002 130-134 24.185000000000002 27.865000000000002 27.395000000000003 20.555 135-139 23.965 28.105000000000004 27.265 20.665 140-144 24.375 28.384999999999998 27.105 20.135 145-149 24.560000000000002 27.894999999999996 27.12 20.424999999999997 150-151 24.4 27.8125 28.212500000000002 19.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 1.0 18 2.0 19 1.5 20 1.0 21 2.5 22 3.5 23 4.0 24 3.5 25 2.5 26 3.0 27 6.5 28 10.0 29 11.0 30 12.5 31 13.5 32 20.5 33 29.0 34 35.5 35 51.0 36 68.0 37 79.0 38 118.0 39 163.0 40 193.5 41 227.0 42 255.5 43 292.5 44 307.0 45 287.5 46 281.0 47 267.0 48 243.0 49 212.5 50 168.5 51 144.5 52 126.0 53 86.5 54 61.0 55 54.0 56 40.5 57 30.0 58 19.5 59 12.5 60 8.0 61 8.5 62 7.5 63 4.0 64 3.5 65 2.0 66 2.5 67 3.0 68 2.0 69 1.5 70 1.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.075 3 0.075 4 0.075 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.045 20-24 0.125 25-29 0.19 30-34 0.22999999999999998 35-39 0.295 40-44 0.265 45-49 0.095 50-54 0.06 55-59 0.045 60-64 0.02 65-69 0.015 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72396486825596 99.35000000000001 2 0.2258469259723965 0.44999999999999996 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.02509410288582183 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTAGGCTTGAGCAGATTCATTCGCCAACTAACCCTTTAATTTATCCTAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.45 0.0 0.0 0.0 0.0 104-105 0.4875 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.6125 0.0 0.0 0.0 0.0 110-111 0.725 0.0 0.0 0.0 0.0 112-113 0.8 0.0 0.0 0.0 0.0 114-115 0.9125 0.0 0.0 0.0 0.0 116-117 0.975 0.0 0.0 0.0 0.0 118-119 1.1125 0.0 0.0 0.0 0.0 120-121 1.175 0.0 0.0 0.0 0.0 122-123 1.3125 0.0 0.0 0.0 0.0 124-125 1.5375 0.0 0.0 0.0 0.0 126-127 1.7625 0.0 0.0 0.0 0.0 128-129 1.9625 0.0 0.0 0.0 0.0 130-131 2.0875 0.0 0.0 0.0 0.0 132-133 2.375 0.0 0.0 0.0 0.0 134-135 2.675 0.0 0.0 0.0 0.0 136-137 2.9375 0.0 0.0 0.0 0.0 138-139 3.2125000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 750557 spots for SRR7171938.sra Written 750557 spots for SRR7171938.sra Read 750557 spots for SRR7171938.sra Written 750557 spots for SRR7171938.sra Read 750557 spots for SRR7171938.sra Written 750557 spots for SRR7171938.sra Read 750557 spots for SRR7171938.sra Written 750557 spots for SRR7171938.sra Read 750557 spots for SRR7171938.sra Written 750557 spots for SRR7171938.sra Read 750557 spots for SRR7171938.sra Written 750557 spots for SRR7171938.sra Read 750557 spots for SRR7171938.sra Written 750557 spots for SRR7171938.sra Read 750557 spots for SRR7171938.sra Written 750557 spots for SRR7171938.sra Read 750557 spots for SRR7171938.sra Written 750557 spots for SRR7171938.sra Read 750557 spots for SRR7171938.sra Written 750557 spots for SRR7171938.sra Read 750557 spots for SRR7171938.sra Written 750557 spots for SRR7171938.sra Read 750557 spots for SRR7171938.sra Written 750557 spots for SRR7171938.sra Read 750557 spots for SRR7171938.sra Written 750557 spots for SRR7171938.sra Read 750557 spots for SRR7171938.sra Written 750557 spots for SRR7171938.sra Read 750557 spots for SRR7171938.sra Written 750557 spots for SRR7171938.sra Read 750557 spots for SRR7171938.sra Written 750557 spots for SRR7171938.sra Read 750557 spots for SRR7171938.sra Written 750557 spots for SRR7171938.sra Read 750557 spots for SRR7171938.sra Written 750557 spots for SRR7171938.sra Read 750564 spots for SRR7171938.sra Written 750564 spots for SRR7171938.sra Read 750557 spots for SRR7171938.sra Written 750557 spots for SRR7171938.sra SRR ids: ['SRR7171938.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g_h5_k9s SRR7171938.sra spots: 15011147 blocks: [[1, 750557], [750558, 1501114], [1501115, 2251671], [2251672, 3002228], [3002229, 3752785], [3752786, 4503342], [4503343, 5253899], [5253900, 6004456], [6004457, 6755013], [6755014, 7505570], [7505571, 8256127], [8256128, 9006684], [9006685, 9757241], [9757242, 10507798], [10507799, 11258355], [11258356, 12008912], [12008913, 12759469], [12759470, 13510026], [13510027, 14260583], [14260584, 15011147]] SRR7171938 file size 5065084 SRR7171938 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171938 SRR7171938_1.fastq SRR7171938_2.fastq Input file: SRR7171938_1.fastq Paired file: SRR7171938_2.fastq trimmed: SRR7171938-trimmed-pair1.fastq, SRR7171938-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 03:41:10 2025 >> started Fri Feb 14 03:41:30 2025 >> done (20.066s) 15011147 read pairs processed; of these: 41517 ( 0.28%) short read pairs filtered out after trimming by size control 32448 ( 0.22%) empty read pairs filtered out after trimming by size control 14937182 (99.51%) read pairs available; of these: 5141939 (34.42%) trimmed read pairs available after processing 9795243 (65.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 8 0.00% 21 3 0.00% 22 9 0.00% 23 3 0.00% 24 8 0.00% 25 7 0.00% 26 19 0.00% 27 12 0.00% 28 7 0.00% 29 9 0.00% 30 7 0.00% 31 8 0.00% 32 8 0.00% 33 9 0.00% 34 7 0.00% 35 6 0.00% 36 8 0.00% 37 9 0.00% 38 14 0.00% 39 16 0.00% 40 12 0.00% 41 17 0.00% 42 13 0.00% 43 37 0.00% 44 25 0.00% 45 33 0.00% 46 26 0.00% 47 87 0.00% 48 123 0.00% 49 37 0.00% 50 41 0.00% 51 38 0.00% 52 116 0.00% 53 123 0.00% 54 97 0.00% 55 69 0.00% 56 88 0.00% 57 131 0.00% 58 138 0.00% 59 96 0.00% 60 91 0.00% 61 135 0.00% 62 118 0.00% 63 95 0.00% 64 124 0.00% 65 135 0.00% 66 172 0.00% 67 145 0.00% 68 192 0.00% 69 212 0.00% 70 242 0.00% 71 239 0.00% 72 337 0.00% 73 391 0.00% 74 432 0.00% 75 534 0.00% 76 663 0.00% 77 745 0.00% 78 741 0.00% 79 778 0.01% 80 851 0.01% 81 957 0.01% 82 1177 0.01% 83 1352 0.01% 84 3157 0.02% 85 4379 0.03% 86 4394 0.03% 87 4563 0.03% 88 4559 0.03% 89 4651 0.03% 90 4880 0.03% 91 5017 0.03% 92 5173 0.03% 93 5266 0.04% 94 5656 0.04% 95 5688 0.04% 96 6043 0.04% 97 6180 0.04% 98 6520 0.04% 99 6655 0.04% 100 6981 0.05% 101 7489 0.05% 102 8110 0.05% 103 8300 0.06% 104 8951 0.06% 105 9476 0.06% 106 9744 0.07% 107 10302 0.07% 108 10869 0.07% 109 11072 0.07% 110 12070 0.08% 111 12818 0.09% 112 13493 0.09% 113 14403 0.10% 114 15440 0.10% 115 16057 0.11% 116 16518 0.11% 117 17089 0.11% 118 17431 0.12% 119 18929 0.13% 120 20126 0.13% 121 20318 0.14% 122 21067 0.14% 123 22174 0.15% 124 23270 0.16% 125 24502 0.16% 126 25400 0.17% 127 26517 0.18% 128 27305 0.18% 129 28209 0.19% 130 29664 0.20% 131 30973 0.21% 132 33049 0.22% 133 35252 0.24% 134 37551 0.25% 135 39837 0.27% 136 41750 0.28% 137 44452 0.30% 138 47092 0.32% 139 50139 0.34% 140 53608 0.36% 141 58393 0.39% 142 63998 0.43% 143 72299 0.48% 144 83607 0.56% 145 98217 0.66% 146 118344 0.79% 147 157128 1.05% 148 233923 1.57% 149 461274 3.09% 150 2771786 18.56% 151 9795243 65.58% 14937182 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=5.57 fanout-score-rank=14 prefix-density=0.83 prefix-fanout=3.2 sequence=TTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=55.58 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.5 sequence=AAGAGGAGCGGGCCTAACCAGGCTAAAAACAGGGCAGTTAAACCAACATTAATACCACAACTATCTTAATTGCCACTGACTAGCAATAACAACACCCATTTCTAAAGAAAATATCTTATTCTGCAAATCTCAGACTCTTCTCCCTCGTTGTAAACAAGGAAGAGAAGTACTTGAGTTTGACATGTAGCAAATCAAAGTTTCTAGTGGTGCTTGTTTGCAACAGTGCACTGCTTTCTGATCTCACCCTTGGTACCGGTGAGTGGGTTGTTCTCAGAAAGAATGGTGATAGCCCTAGAAAACTCCTTAAAGAAGTAATCCTGACTCTTGGCCATTTTCTTCACGTAAGGCTT criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=3.53 fanout-score-rank=21 prefix-density=0.64 prefix-fanout=3.0 sequence=TGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATT criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=108.65 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=11.0 sequence=AGTGAAGAAAAACAAAAAAGAAATGGATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGCATTAGCAGAAAATGAAGAAGACCCTGGTCTTGTTATGAACTTTTACAAGGATACATGCCCTCAAGCTGAGGACATTGTCAAAGAACAAGTTAGACTCCTTTACAAGAGACACAAAAACACTGCATTTTCTTGGCTAAGAAACATCTTCCATGACTGTGCTGTTCAGTCATGTGATGCTTCACTGCTGCTGGACTCAACAAGGAGGACCTTGTCCGAGAAGGAGACAGACAGGAGCTTTGGCCTCAGGAACTTTAGATACTTTGACGATATCAAAGAAGCTGTTGAAAGAGAGTGTCCTGGAGTCGTTTCCTGTGCTGATATTCTTGTCCTGTCTGCTAGAGATGGCATTGTTTCGCTAGGAGGACCTCATATCCCTCTCAAAACTGGAAGAAGGGATGGCAGGAAGAGCAGAGCAGATGTGATC SRR7171938 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 03:42:14 Started mapping on | Feb 14 03:42:15 Finished on | Feb 14 03:44:30 Mapping speed, Million of reads per hour | 398.32 Number of input reads | 14937182 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13806653 Uniquely mapped reads % | 92.43% Average mapped length | 296.27 Number of splices: Total | 13352958 Number of splices: Annotated (sjdb) | 13073252 Number of splices: GT/AG | 13127350 Number of splices: GC/AG | 175144 Number of splices: AT/AC | 11381 Number of splices: Non-canonical | 39083 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 336848 % of reads mapped to multiple loci | 2.26% Number of reads mapped to too many loci | 40575 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.97% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 829271 829271 829271 N_multimapping 336848 336848 336848 N_noFeature 388663 13637591 473306 N_ambiguous 160221 975 75192 UnstrandedReadsAssigned:13257769 PositiveStrandReadsAssigned:168087 NegativeStrandReadsAssigned:13258155 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171938 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171938-trimmed-pair1.fastq SRR7171938-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,937,182 reads, 13,165,223 reads pseudoaligned [quant] estimated average fragment length: 255.127 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,169 rounds 52401 SRR7171938.ke.tsv 34699 SRR7171938.se.tsv 87100 total ==> SRR7171938.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.87 1188.51 47.1336 Potri.005G024800.1.v4.1 1035 780.873 331 29.6513 Potri.004G059700.1.v4.1 961 706.899 26 2.57283 Potri.007G009000.2.v4.1 1416 1161.87 0 0 Potri.003G141000.2.v4.1 2943 2688.87 503.179 13.0903 Potri.016G087400.1.v4.1 270 71.2121 942 925.322 Potri.015G069301.1.v4.1 564 315.076 0 0 Potri.010G195200.1.v4.1 1773 1518.87 413 19.0206 Potri.012G127500.1.v4.1 977 722.894 9165 886.857 ==> SRR7171938.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 209 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 501 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 233 SRR7171938 completed mapping pipeline successfully