Starting /dee2/code/volunteer_pipeline.sh SRR7171939 current disk space = 3088265142272 free memory = 1570544260 SRR7171939 SRAfilesize 8df517ebeae21cd3478066d4f0f130b3 SRR7171939.sra SRR7171939.sra file validated SRR7171939 is paired end SRR7171939 is conventional basespace SRR7171939 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171939_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.79425 33.0 33.0 34.0 32.0 34.0 2 32.819 34.0 33.0 34.0 32.0 34.0 3 32.71075 33.0 33.0 34.0 31.0 34.0 4 32.419 33.0 33.0 33.0 31.0 34.0 5 32.54575 33.0 33.0 33.0 31.0 34.0 6 36.73875 38.0 37.0 38.0 34.0 38.0 7 36.9175 38.0 37.0 38.0 35.0 38.0 8 37.34675 38.0 38.0 38.0 36.0 38.0 9 37.50675 38.0 38.0 38.0 37.0 38.0 10-14 37.51905 38.0 38.0 38.0 37.8 38.0 15-19 37.4892 38.0 38.0 38.0 37.4 38.0 20-24 37.4647 38.0 38.0 38.0 37.2 38.0 25-29 37.4551 38.0 38.0 38.0 37.2 38.0 30-34 37.43095 38.0 38.0 38.0 37.0 38.0 35-39 37.4279 38.0 38.0 38.0 37.0 38.0 40-44 37.3988 38.0 38.0 38.0 37.0 38.0 45-49 37.32915 38.0 38.0 38.0 37.0 38.0 50-54 37.3352 38.0 38.0 38.0 37.0 38.0 55-59 37.281800000000004 38.0 38.0 38.0 36.8 38.0 60-64 37.2552 38.0 38.0 38.0 37.0 38.0 65-69 37.17535 38.0 38.0 38.0 36.4 38.0 70-74 37.12795 38.0 38.0 38.0 36.2 38.0 75-79 37.133449999999996 38.0 38.0 38.0 36.0 38.0 80-84 37.0756 38.0 38.0 38.0 36.0 38.0 85-89 37.0707 38.0 38.0 38.0 36.0 38.0 90-94 37.02335 38.0 38.0 38.0 36.0 38.0 95-99 36.847649999999994 38.0 38.0 38.0 35.0 38.0 100-104 36.772949999999994 38.0 38.0 38.0 35.0 38.0 105-109 36.72255 38.0 38.0 38.0 35.0 38.0 110-114 36.54785 38.0 38.0 38.0 34.2 38.0 115-119 36.44055 38.0 38.0 38.0 34.0 38.0 120-124 36.37795 38.0 38.0 38.0 34.0 38.0 125-129 36.0387 38.0 37.4 38.0 32.8 38.0 130-134 35.85685 38.0 37.0 38.0 32.0 38.0 135-139 35.8912 38.0 36.8 38.0 33.0 38.0 140-144 35.70205000000001 38.0 36.0 38.0 32.0 38.0 145-149 35.333749999999995 38.0 36.0 38.0 31.0 38.0 150-151 32.372625 36.5 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 2.0 13 0.0 14 0.0 15 1.0 16 0.0 17 2.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 2.0 24 7.0 25 7.0 26 18.0 27 17.0 28 18.0 29 28.0 30 35.0 31 39.0 32 55.0 33 93.0 34 125.0 35 211.0 36 517.0 37 2818.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.154345006485084 16.2905317769131 10.298313878080414 42.2568093385214 2 17.2 22.45 34.849999999999994 25.5 3 18.825 26.3 25.45 29.425 4 23.3 32.7 21.25 22.75 5 21.099999999999998 36.425000000000004 23.025000000000002 19.45 6 18.15 36.575 24.925 20.349999999999998 7 12.625 22.125 45.1 20.150000000000002 8 19.2 22.275 29.25 29.275000000000002 9 17.2 23.625 33.35 25.825 10-14 19.49 29.415000000000003 26.729999999999997 24.365000000000002 15-19 19.425 29.015 27.575 23.985 20-24 19.86 28.57 27.565 24.005000000000003 25-29 19.7 28.395 27.91 23.995 30-34 19.830000000000002 28.575 27.650000000000002 23.945 35-39 20.06 28.194999999999997 27.715 24.03 40-44 19.91 28.325 28.075 23.69 45-49 20.29 28.185 27.85 23.674999999999997 50-54 19.605 28.660000000000004 28.1 23.635 55-59 20.525 28.24 27.639999999999997 23.595 60-64 20.615 28.110000000000003 27.04 24.235 65-69 19.89 28.634999999999998 27.744999999999997 23.73 70-74 20.32 28.389999999999997 27.900000000000002 23.39 75-79 20.52 28.65 27.345000000000002 23.485 80-84 20.044999999999998 28.29 27.889999999999997 23.775 85-89 20.805 27.955000000000002 27.675 23.565 90-94 20.635 28.499999999999996 27.485 23.380000000000003 95-99 20.525 28.055000000000003 27.87 23.549999999999997 100-104 20.665 27.644999999999996 27.435 24.255 105-109 20.39 28.235 27.634999999999998 23.74 110-114 20.45 27.88 27.584999999999997 24.085 115-119 20.41 28.51 27.51 23.57 120-124 20.97 27.584999999999997 27.875 23.57 125-129 20.805 28.000000000000004 27.779999999999998 23.415 130-134 20.375 27.855 27.79 23.98 135-139 20.46 27.900000000000002 27.765 23.875 140-144 20.445 28.82 27.644999999999996 23.09 145-149 20.97 27.925 27.255000000000003 23.849999999999998 150-151 20.9125 28.8625 27.05 23.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 1.0 25 0.5 26 3.5 27 5.0 28 4.5 29 9.0 30 15.0 31 24.0 32 37.0 33 41.5 34 46.5 35 64.5 36 75.5 37 96.5 38 139.0 39 180.0 40 202.0 41 222.5 42 246.5 43 252.0 44 263.5 45 283.0 46 291.0 47 281.0 48 260.0 49 227.0 50 169.0 51 129.0 52 111.0 53 86.0 54 64.0 55 43.0 56 30.0 57 21.0 58 19.0 59 19.0 60 11.0 61 4.5 62 3.0 63 3.0 64 2.5 65 2.0 66 1.5 67 1.0 68 0.5 69 1.5 70 1.0 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.6249999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0125 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.025 0.0 0.0 0.025 0.0 72-73 0.025 0.0 0.0 0.025 0.0 74-75 0.025 0.0 0.0 0.025 0.0 76-77 0.0625 0.0 0.0 0.025 0.0 78-79 0.075 0.0 0.0 0.025 0.0 80-81 0.075 0.0 0.0 0.025 0.0 82-83 0.075 0.0 0.0 0.025 0.0 84-85 0.1 0.0 0.0 0.025 0.0 86-87 0.1 0.0 0.0 0.025 0.0 88-89 0.1 0.0 0.0 0.025 0.0 90-91 0.1 0.0 0.0 0.025 0.0 92-93 0.1125 0.0 0.0 0.025 0.0 94-95 0.125 0.0 0.0 0.025 0.0 96-97 0.125 0.0 0.0 0.025 0.0 98-99 0.15 0.0 0.0 0.025 0.0 100-101 0.15 0.0 0.0 0.025 0.0 102-103 0.15 0.0 0.0 0.025 0.0 104-105 0.175 0.0 0.0 0.025 0.0 106-107 0.2375 0.0 0.0 0.025 0.0 108-109 0.275 0.0 0.0 0.025 0.0 110-111 0.3 0.0 0.0 0.025 0.0 112-113 0.325 0.0 0.0 0.025 0.0 114-115 0.4125 0.0 0.0 0.025 0.0 116-117 0.55 0.0 0.0 0.025 0.0 118-119 0.6375 0.0 0.0 0.025 0.0 120-121 0.7250000000000001 0.0 0.0 0.025 0.0 122-123 0.8374999999999999 0.0 0.0 0.025 0.0 124-125 0.9125 0.0 0.0 0.025 0.0 126-127 1.0375 0.0 0.0 0.025 0.0 128-129 1.225 0.0 0.0 0.025 0.0 130-131 1.4125 0.0 0.0 0.025 0.0 132-133 1.5 0.0 0.0 0.025 0.0 134-135 1.6375000000000002 0.0 0.0 0.025 0.0 136-137 1.7625000000000002 0.0 0.0 0.025 0.0 138-139 2.0375 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171939 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171939_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8475 33.0 33.0 34.0 32.0 34.0 2 32.96025 33.0 33.0 34.0 32.0 34.0 3 33.0245 34.0 33.0 34.0 32.0 34.0 4 32.9995 34.0 33.0 34.0 32.0 34.0 5 32.96825 34.0 33.0 34.0 32.0 34.0 6 37.1275 38.0 38.0 38.0 37.0 38.0 7 37.12725 38.0 38.0 38.0 37.0 38.0 8 37.114 38.0 38.0 38.0 36.0 38.0 9 37.1585 38.0 38.0 38.0 37.0 38.0 10-14 37.0789 38.0 38.0 38.0 36.8 38.0 15-19 37.007099999999994 38.0 38.0 38.0 36.4 38.0 20-24 36.96315 38.0 38.0 38.0 36.2 38.0 25-29 36.9331 38.0 38.0 38.0 36.0 38.0 30-34 36.9767 38.0 38.0 38.0 36.2 38.0 35-39 36.84974999999999 38.0 38.0 38.0 36.0 38.0 40-44 36.812749999999994 38.0 38.0 38.0 36.0 38.0 45-49 36.84340000000001 38.0 38.0 38.0 36.0 38.0 50-54 36.80925 38.0 38.0 38.0 35.8 38.0 55-59 36.823750000000004 38.0 38.0 38.0 36.0 38.0 60-64 36.74145 38.0 38.0 38.0 35.4 38.0 65-69 36.675349999999995 38.0 38.0 38.0 35.0 38.0 70-74 36.647600000000004 38.0 38.0 38.0 35.0 38.0 75-79 36.55765 38.0 38.0 38.0 34.4 38.0 80-84 36.5361 38.0 38.0 38.0 34.2 38.0 85-89 36.42715 38.0 38.0 38.0 34.0 38.0 90-94 36.26165 38.0 38.0 38.0 33.8 38.0 95-99 36.1888 38.0 38.0 38.0 33.8 38.0 100-104 36.03060000000001 38.0 37.4 38.0 33.6 38.0 105-109 35.8517 38.0 37.0 38.0 32.6 38.0 110-114 35.8581 38.0 37.0 38.0 32.6 38.0 115-119 35.6939 38.0 37.0 38.0 31.4 38.0 120-124 35.4914 38.0 36.6 38.0 31.0 38.0 125-129 35.3495 38.0 36.0 38.0 30.6 38.0 130-134 34.977050000000006 38.0 36.0 38.0 28.0 38.0 135-139 34.6058 38.0 35.4 38.0 27.0 38.0 140-144 34.16165 38.0 35.0 38.0 23.6 38.0 145-149 33.641 38.0 34.8 38.0 20.6 38.0 150-151 30.26925 36.5 29.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 5.0 4 1.0 5 1.0 6 2.0 7 3.0 8 1.0 9 1.0 10 0.0 11 3.0 12 2.0 13 3.0 14 4.0 15 1.0 16 4.0 17 1.0 18 5.0 19 6.0 20 6.0 21 10.0 22 4.0 23 12.0 24 8.0 25 16.0 26 17.0 27 18.0 28 36.0 29 45.0 30 49.0 31 69.0 32 78.0 33 115.0 34 133.0 35 248.0 36 639.0 37 2451.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.1285964473355 17.988491368526393 15.586690017513135 28.29622216662497 2 24.668501376032022 23.692769577182887 35.5266449837378 16.112084063047284 3 20.185092546273136 28.114057028514257 31.240620310155077 20.460230115057527 4 22.586293146573286 35.617808904452225 23.51175587793897 18.284142071035518 5 23.411705852926463 36.84342171085543 22.511255627813906 17.2336168084042 6 19.225 37.6 23.825 19.35 7 17.974999999999998 17.299999999999997 43.075 21.65 8 21.15 22.55 28.425 27.875 9 21.575 23.875 29.325000000000003 25.224999999999998 10-14 22.521126056302815 29.316465823291164 26.206310315515775 21.956097804890245 15-19 22.996899069720918 28.243473041912576 27.53826147844353 21.221366409922975 20-24 22.576932699524644 28.30622967225419 27.52564423317488 21.591193395046286 25-29 22.560456616432184 28.353276923847194 27.437040004005407 21.649226455715215 30-34 22.409216128224394 28.054094665664913 28.01402454295016 21.522664663160533 35-39 22.48007618665731 27.78306851786878 28.1489649641622 21.587890331311712 40-44 23.771354140574118 27.573768849256048 27.784179149341213 20.870697860828617 45-49 22.641981486114584 27.47060295221416 28.331248436327243 21.556167125344007 50-54 23.010354659596818 27.727477364814167 28.247711470161573 21.014456505427443 55-59 23.649459783913564 27.77110844337735 27.96618647458984 20.61324529811925 60-64 22.974594918983797 28.110622124424882 27.775555111022204 21.139227845569113 65-69 22.96229622962296 28.052805280528055 27.907790779077907 21.077107710771077 70-74 23.705000000000002 27.689999999999998 27.98 20.625 75-79 23.94 27.955000000000002 27.85 20.255000000000003 80-84 22.975 28.044999999999998 27.85 21.13 85-89 22.95 28.13 27.900000000000002 21.02 90-94 23.93 28.075 27.615000000000002 20.380000000000003 95-99 23.96 27.944999999999997 27.1 20.995 100-104 23.810000000000002 27.944999999999997 27.755000000000003 20.49 105-109 23.18 27.68 28.084999999999997 21.055 110-114 23.315 28.375 27.689999999999998 20.62 115-119 23.905 28.035 27.6 20.46 120-124 23.580000000000002 28.09 27.639999999999997 20.69 125-129 23.455000000000002 28.415000000000003 27.744999999999997 20.385 130-134 24.279999999999998 27.12 27.52 21.08 135-139 24.04 28.025 27.32 20.615 140-144 24.265 27.41 28.095 20.23 145-149 24.05 28.01 27.305 20.635 150-151 23.6875 28.1625 27.725 20.424999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.5 25 2.5 26 2.5 27 3.0 28 5.0 29 6.0 30 9.0 31 15.0 32 19.5 33 32.5 34 43.5 35 55.5 36 69.0 37 98.0 38 137.5 39 171.5 40 200.0 41 229.5 42 261.5 43 284.0 44 294.0 45 286.5 46 298.5 47 270.0 48 222.5 49 210.5 50 177.5 51 142.5 52 114.0 53 87.5 54 69.5 55 51.0 56 37.5 57 27.5 58 17.0 59 10.5 60 10.5 61 8.0 62 6.0 63 5.5 64 2.0 65 0.5 66 0.5 67 0.5 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.075 3 0.05 4 0.05 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.03 20-24 0.075 25-29 0.135 30-34 0.17500000000000002 35-39 0.245 40-44 0.19499999999999998 45-49 0.075 50-54 0.045 55-59 0.04 60-64 0.02 65-69 0.01 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62339944765253 99.2 2 0.3263871453678132 0.65 3 0.05021340697966357 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.3 0.0 0.0 0.0 0.0 112-113 0.325 0.0 0.0 0.0 0.0 114-115 0.4125 0.0 0.0 0.0 0.0 116-117 0.55 0.0 0.0 0.0 0.0 118-119 0.6375 0.0 0.0 0.0 0.0 120-121 0.7250000000000001 0.0 0.0 0.0 0.0 122-123 0.8374999999999999 0.0 0.0 0.0 0.0 124-125 0.925 0.0 0.0 0.0 0.0 126-127 1.0625 0.0 0.0 0.0 0.0 128-129 1.225 0.0 0.0 0.0 0.0 130-131 1.4125 0.0 0.0 0.0 0.0 132-133 1.4875 0.0 0.0 0.0 0.0 134-135 1.6124999999999998 0.0 0.0 0.0 0.0 136-137 1.7374999999999998 0.0 0.0 0.0 0.0 138-139 2.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGTGTT 10 0.006830828 145.0 145 >>END_MODULE Read 702947 spots for SRR7171939.sra Written 702947 spots for SRR7171939.sra Read 702947 spots for SRR7171939.sra Written 702947 spots for SRR7171939.sra Read 702947 spots for SRR7171939.sra Written 702947 spots for SRR7171939.sra Read 702947 spots for SRR7171939.sra Written 702947 spots for SRR7171939.sra Read 702947 spots for SRR7171939.sra Written 702947 spots for SRR7171939.sra Read 702947 spots for SRR7171939.sra Written 702947 spots for SRR7171939.sra Read 702947 spots for SRR7171939.sra Written 702947 spots for SRR7171939.sra Read 702947 spots for SRR7171939.sra Written 702947 spots for SRR7171939.sra Read 702947 spots for SRR7171939.sra Written 702947 spots for SRR7171939.sra Read 702955 spots for SRR7171939.sra Written 702955 spots for SRR7171939.sra Read 702947 spots for SRR7171939.sra Written 702947 spots for SRR7171939.sra Read 702947 spots for SRR7171939.sra Written 702947 spots for SRR7171939.sra Read 702947 spots for SRR7171939.sra Written 702947 spots for SRR7171939.sra Read 702947 spots for SRR7171939.sra Written 702947 spots for SRR7171939.sra Read 702947 spots for SRR7171939.sra Written 702947 spots for SRR7171939.sra Read 702947 spots for SRR7171939.sra Written 702947 spots for SRR7171939.sra Read 702947 spots for SRR7171939.sra Written 702947 spots for SRR7171939.sra Read 702947 spots for SRR7171939.sra Written 702947 spots for SRR7171939.sra Read 702947 spots for SRR7171939.sra Written 702947 spots for SRR7171939.sra Read 702947 spots for SRR7171939.sra Written 702947 spots for SRR7171939.sra SRR ids: ['SRR7171939.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_siypbt3y SRR7171939.sra spots: 14058948 blocks: [[1, 702947], [702948, 1405894], [1405895, 2108841], [2108842, 2811788], [2811789, 3514735], [3514736, 4217682], [4217683, 4920629], [4920630, 5623576], [5623577, 6326523], [6326524, 7029470], [7029471, 7732417], [7732418, 8435364], [8435365, 9138311], [9138312, 9841258], [9841259, 10544205], [10544206, 11247152], [11247153, 11950099], [11950100, 12653046], [12653047, 13355993], [13355994, 14058948]] SRR7171939 file size 4742415 SRR7171939 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171939 SRR7171939_1.fastq SRR7171939_2.fastq Input file: SRR7171939_1.fastq Paired file: SRR7171939_2.fastq trimmed: SRR7171939-trimmed-pair1.fastq, SRR7171939-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 03:35:47 2025 >> started Fri Feb 14 03:36:02 2025 >> done (14.934s) 14058948 read pairs processed; of these: 13111 ( 0.09%) short read pairs filtered out after trimming by size control 12729 ( 0.09%) empty read pairs filtered out after trimming by size control 14033108 (99.82%) read pairs available; of these: 4674476 (33.31%) trimmed read pairs available after processing 9358632 (66.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 2 0.00% 21 2 0.00% 22 1 0.00% 23 3 0.00% 24 2 0.00% 25 0 0.00% 26 2 0.00% 27 4 0.00% 28 2 0.00% 29 2 0.00% 30 1 0.00% 31 2 0.00% 32 4 0.00% 33 3 0.00% 34 2 0.00% 35 2 0.00% 36 2 0.00% 37 4 0.00% 38 12 0.00% 39 8 0.00% 40 4 0.00% 41 6 0.00% 42 13 0.00% 43 35 0.00% 44 18 0.00% 45 13 0.00% 46 11 0.00% 47 86 0.00% 48 111 0.00% 49 16 0.00% 50 13 0.00% 51 19 0.00% 52 97 0.00% 53 84 0.00% 54 69 0.00% 55 37 0.00% 56 56 0.00% 57 70 0.00% 58 94 0.00% 59 52 0.00% 60 33 0.00% 61 77 0.00% 62 60 0.00% 63 49 0.00% 64 48 0.00% 65 65 0.00% 66 54 0.00% 67 74 0.00% 68 56 0.00% 69 105 0.00% 70 127 0.00% 71 126 0.00% 72 150 0.00% 73 139 0.00% 74 254 0.00% 75 247 0.00% 76 316 0.00% 77 318 0.00% 78 344 0.00% 79 421 0.00% 80 368 0.00% 81 407 0.00% 82 495 0.00% 83 609 0.00% 84 1149 0.01% 85 1587 0.01% 86 1748 0.01% 87 1885 0.01% 88 1975 0.01% 89 2030 0.01% 90 2150 0.02% 91 2165 0.02% 92 2363 0.02% 93 2478 0.02% 94 2580 0.02% 95 2714 0.02% 96 2967 0.02% 97 2990 0.02% 98 3225 0.02% 99 3396 0.02% 100 3762 0.03% 101 3962 0.03% 102 4258 0.03% 103 4690 0.03% 104 4881 0.03% 105 5396 0.04% 106 5706 0.04% 107 5981 0.04% 108 6263 0.04% 109 6681 0.05% 110 7486 0.05% 111 7811 0.06% 112 8168 0.06% 113 8537 0.06% 114 9358 0.07% 115 9827 0.07% 116 10441 0.07% 117 10821 0.08% 118 11728 0.08% 119 12586 0.09% 120 13584 0.10% 121 13804 0.10% 122 14321 0.10% 123 14841 0.11% 124 15844 0.11% 125 16622 0.12% 126 17711 0.13% 127 18575 0.13% 128 19197 0.14% 129 20648 0.15% 130 21942 0.16% 131 22903 0.16% 132 24794 0.18% 133 26727 0.19% 134 28618 0.20% 135 30350 0.22% 136 32220 0.23% 137 35286 0.25% 138 37744 0.27% 139 41033 0.29% 140 44336 0.32% 141 48973 0.35% 142 55079 0.39% 143 62724 0.45% 144 72799 0.52% 145 87061 0.62% 146 108357 0.77% 147 147446 1.05% 148 227357 1.62% 149 457456 3.26% 150 2704469 19.27% 151 9358632 66.69% 14033108 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=31 prefix-density=0.21 prefix-fanout=2.2 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.09 sequence-density-rank=23 fanout-score=409.09 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=36.0 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=5.70 fanout-score-rank=17 prefix-density=0.39 prefix-fanout=3.8 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=26 fanout-score=211.74 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=20.8 sequence=AGAAGAAGAGAGG SRR7171939 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 03:36:45 Started mapping on | Feb 14 03:36:45 Finished on | Feb 14 03:38:19 Mapping speed, Million of reads per hour | 537.44 Number of input reads | 14033108 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 13272244 Uniquely mapped reads % | 94.58% Average mapped length | 297.72 Number of splices: Total | 14165510 Number of splices: Annotated (sjdb) | 13959029 Number of splices: GT/AG | 13948460 Number of splices: GC/AG | 177653 Number of splices: AT/AC | 11037 Number of splices: Non-canonical | 28360 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 342240 % of reads mapped to multiple loci | 2.44% Number of reads mapped to too many loci | 35666 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.68% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 430892 430892 430892 N_multimapping 342240 342240 342240 N_noFeature 245304 13161909 300910 N_ambiguous 125529 851 70137 UnstrandedReadsAssigned:12901411 PositiveStrandReadsAssigned:109484 NegativeStrandReadsAssigned:12901197 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171939 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171939-trimmed-pair1.fastq SRR7171939-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,033,108 reads, 12,767,330 reads pseudoaligned [quant] estimated average fragment length: 272.259 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,035 rounds 52401 SRR7171939.ke.tsv 34699 SRR7171939.se.tsv 87100 total ==> SRR7171939.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1746.74 596 25.2299 Potri.005G024800.1.v4.1 1035 763.741 169 16.3621 Potri.004G059700.1.v4.1 961 689.764 14 1.50081 Potri.007G009000.2.v4.1 1416 1144.74 0 0 Potri.003G141000.2.v4.1 2943 2671.74 460 12.731 Potri.016G087400.1.v4.1 270 65.569 990 1116.44 Potri.015G069301.1.v4.1 564 299.949 0 0 Potri.010G195200.1.v4.1 1773 1501.74 73 3.59439 Potri.012G127500.1.v4.1 977 705.758 2100 220.019 ==> SRR7171939.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 28 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 257 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 124 SRR7171939 completed mapping pipeline successfully