Starting /dee2/code/volunteer_pipeline.sh SRR7171940 current disk space = 3088259293184 free memory = 1534645900 SRR7171940 SRAfilesize 51947becae178aba0efe74a759ff6162 SRR7171940.sra SRR7171940.sra file validated SRR7171940 is paired end SRR7171940 is conventional basespace SRR7171940 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171940_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6255 33.0 33.0 34.0 31.0 34.0 2 32.80325 34.0 33.0 34.0 31.0 34.0 3 32.64075 33.0 33.0 34.0 31.0 34.0 4 32.31525 33.0 33.0 33.0 31.0 34.0 5 32.903 33.0 33.0 34.0 32.0 34.0 6 36.9165 38.0 37.0 38.0 35.0 38.0 7 37.193 38.0 38.0 38.0 36.0 38.0 8 36.97725 38.0 38.0 38.0 35.0 38.0 9 37.3585 38.0 38.0 38.0 37.0 38.0 10-14 37.5218 38.0 38.0 38.0 37.2 38.0 15-19 37.55015 38.0 38.0 38.0 37.8 38.0 20-24 37.5066 38.0 38.0 38.0 37.2 38.0 25-29 37.484449999999995 38.0 38.0 38.0 37.6 38.0 30-34 37.4568 38.0 38.0 38.0 37.2 38.0 35-39 37.42 38.0 38.0 38.0 37.2 38.0 40-44 37.4206 38.0 38.0 38.0 37.0 38.0 45-49 37.37595 38.0 38.0 38.0 37.0 38.0 50-54 37.337 38.0 38.0 38.0 37.0 38.0 55-59 37.24705 38.0 38.0 38.0 36.8 38.0 60-64 37.2724 38.0 38.0 38.0 37.0 38.0 65-69 37.173950000000005 38.0 38.0 38.0 36.4 38.0 70-74 37.1269 38.0 38.0 38.0 36.0 38.0 75-79 37.082100000000004 38.0 38.0 38.0 36.0 38.0 80-84 37.0582 38.0 38.0 38.0 36.0 38.0 85-89 37.00985 38.0 38.0 38.0 36.0 38.0 90-94 36.921800000000005 38.0 38.0 38.0 36.0 38.0 95-99 36.8799 38.0 38.0 38.0 35.2 38.0 100-104 36.814949999999996 38.0 38.0 38.0 35.2 38.0 105-109 36.6577 38.0 38.0 38.0 34.8 38.0 110-114 36.52869999999999 38.0 38.0 38.0 34.0 38.0 115-119 36.50475 38.0 38.0 38.0 34.0 38.0 120-124 36.35355 38.0 38.0 38.0 33.8 38.0 125-129 36.0493 38.0 37.4 38.0 33.0 38.0 130-134 35.91295 38.0 37.0 38.0 32.6 38.0 135-139 35.872550000000004 38.0 37.0 38.0 33.0 38.0 140-144 35.6292 38.0 36.0 38.0 31.4 38.0 145-149 35.270450000000004 38.0 36.0 38.0 31.8 38.0 150-151 32.2365 36.5 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 3.0 15 0.0 16 0.0 17 1.0 18 1.0 19 2.0 20 4.0 21 1.0 22 2.0 23 5.0 24 8.0 25 11.0 26 14.0 27 12.0 28 21.0 29 31.0 30 25.0 31 41.0 32 60.0 33 80.0 34 109.0 35 210.0 36 519.0 37 2838.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.54279749478079 16.518789144050107 9.18580375782881 38.7526096033403 2 18.725 21.349999999999998 30.2 29.725 3 18.9 26.525 25.275 29.299999999999997 4 21.475 34.25 22.7 21.575 5 22.5 35.4 23.5 18.6 6 17.474999999999998 35.9 25.3 21.325 7 13.875000000000002 23.175 42.675000000000004 20.275000000000002 8 18.075 23.325000000000003 30.475 28.125 9 17.7 23.799999999999997 31.775 26.724999999999998 10-14 19.27 30.264999999999997 27.060000000000002 23.405 15-19 20.085 28.515 27.775 23.625 20-24 19.375 29.604999999999997 27.54 23.48 25-29 19.735 29.675 27.49 23.1 30-34 19.96 29.15 27.915 22.975 35-39 20.080000000000002 28.384999999999998 27.845 23.69 40-44 19.814999999999998 28.910000000000004 27.644999999999996 23.630000000000003 45-49 20.044999999999998 29.43 27.415 23.11 50-54 20.1 29.154999999999998 27.139999999999997 23.605 55-59 19.875 28.694999999999997 27.96 23.47 60-64 19.375 29.07 27.68 23.875 65-69 19.605 28.7 27.950000000000003 23.745 70-74 19.455 28.255000000000003 28.499999999999996 23.79 75-79 19.99 27.935 28.27 23.805 80-84 20.155 28.360000000000003 27.935 23.549999999999997 85-89 20.015 28.42 27.88 23.685000000000002 90-94 20.195 28.29 27.73 23.785 95-99 20.669999999999998 28.1 27.389999999999997 23.84 100-104 19.97 28.525 27.765 23.74 105-109 20.035 27.994999999999997 27.875 24.095 110-114 20.61 28.365000000000002 27.700000000000003 23.325000000000003 115-119 20.055 28.935 26.85 24.16 120-124 20.06 27.96 27.755000000000003 24.224999999999998 125-129 20.59 27.650000000000002 27.534999999999997 24.224999999999998 130-134 20.275000000000002 27.834999999999997 28.395 23.494999999999997 135-139 19.875 28.34 27.415 24.37 140-144 20.71 27.865000000000002 27.6 23.825 145-149 20.599999999999998 28.044999999999998 27.495000000000005 23.86 150-151 20.6375 28.449999999999996 27.400000000000002 23.5125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 1.5 25 4.5 26 6.0 27 9.0 28 12.0 29 13.5 30 21.5 31 32.5 32 40.5 33 46.5 34 51.5 35 65.0 36 91.0 37 120.0 38 148.0 39 174.5 40 195.0 41 221.0 42 246.0 43 250.5 44 259.0 45 278.0 46 273.0 47 252.0 48 257.5 49 225.0 50 159.5 51 127.0 52 105.0 53 92.0 54 62.5 55 35.5 56 29.0 57 21.0 58 18.0 59 13.0 60 8.0 61 6.5 62 6.5 63 7.0 64 4.0 65 1.5 66 0.5 67 1.0 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.4375 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.5625 0.0 0.0 0.0 0.0 116-117 0.7 0.0 0.0 0.0 0.0 118-119 0.85 0.0 0.0 0.0 0.0 120-121 1.0 0.0 0.0 0.0 0.0 122-123 1.1875 0.0 0.0 0.0 0.0 124-125 1.35 0.0 0.0 0.0 0.0 126-127 1.4874999999999998 0.0 0.0 0.0 0.0 128-129 1.75 0.0 0.0 0.0 0.0 130-131 1.9375 0.0 0.0 0.0 0.0 132-133 2.175 0.0 0.0 0.0 0.0 134-135 2.3625 0.0 0.0 0.0 0.0 136-137 2.5875 0.0 0.0 0.0 0.0 138-139 2.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171940 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171940_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.85825 33.0 33.0 34.0 32.0 34.0 2 32.94325 34.0 33.0 34.0 32.0 34.0 3 32.94775 34.0 33.0 34.0 32.0 34.0 4 32.8995 34.0 33.0 34.0 32.0 34.0 5 32.89025 34.0 33.0 34.0 32.0 34.0 6 37.052 38.0 38.0 38.0 37.0 38.0 7 37.07375 38.0 38.0 38.0 37.0 38.0 8 36.9695 38.0 38.0 38.0 36.0 38.0 9 37.05725 38.0 38.0 38.0 37.0 38.0 10-14 37.0552 38.0 38.0 38.0 37.0 38.0 15-19 36.981700000000004 38.0 38.0 38.0 36.8 38.0 20-24 36.940250000000006 38.0 38.0 38.0 36.4 38.0 25-29 36.922399999999996 38.0 38.0 38.0 36.4 38.0 30-34 36.8495 38.0 38.0 38.0 36.2 38.0 35-39 36.8495 38.0 38.0 38.0 36.4 38.0 40-44 36.802499999999995 38.0 38.0 38.0 36.0 38.0 45-49 36.838849999999994 38.0 38.0 38.0 36.0 38.0 50-54 36.7907 38.0 38.0 38.0 36.0 38.0 55-59 36.8322 38.0 38.0 38.0 36.0 38.0 60-64 36.745349999999995 38.0 38.0 38.0 35.8 38.0 65-69 36.665350000000004 38.0 38.0 38.0 35.6 38.0 70-74 36.58135 38.0 38.0 38.0 35.2 38.0 75-79 36.60445 38.0 38.0 38.0 35.2 38.0 80-84 36.5207 38.0 38.0 38.0 34.8 38.0 85-89 36.4574 38.0 38.0 38.0 34.6 38.0 90-94 36.35549999999999 38.0 38.0 38.0 34.0 38.0 95-99 36.27845 38.0 38.0 38.0 34.0 38.0 100-104 36.1286 38.0 38.0 38.0 33.6 38.0 105-109 35.98559999999999 38.0 37.8 38.0 33.2 38.0 110-114 36.00275 38.0 37.6 38.0 33.2 38.0 115-119 35.79055 38.0 37.0 38.0 32.2 38.0 120-124 35.579750000000004 38.0 37.0 38.0 31.0 38.0 125-129 35.487350000000006 38.0 36.4 38.0 31.0 38.0 130-134 35.2543 38.0 36.0 38.0 30.0 38.0 135-139 34.888999999999996 38.0 36.0 38.0 28.2 38.0 140-144 34.43915 38.0 35.0 38.0 26.4 38.0 145-149 33.95085 38.0 35.0 38.0 23.2 38.0 150-151 30.793 36.5 31.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 5.0 4 2.0 5 3.0 6 2.0 7 2.0 8 1.0 9 0.0 10 5.0 11 0.0 12 0.0 13 2.0 14 2.0 15 3.0 16 5.0 17 0.0 18 7.0 19 4.0 20 9.0 21 7.0 22 8.0 23 5.0 24 14.0 25 16.0 26 21.0 27 26.0 28 22.0 29 30.0 30 42.0 31 60.0 32 78.0 33 74.0 34 129.0 35 206.0 36 543.0 37 2655.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.778473091364205 17.94743429286608 16.14518147684606 23.128911138923655 2 25.04378283712785 24.96872654490868 30.848136102076555 19.139354515886914 3 21.68584292146073 27.863931965982992 29.539769884942473 20.910455227613806 4 23.88694347173587 34.592296148074034 22.936468234117058 18.584292146073036 5 24.087043521760883 36.01800900450225 21.785892946473236 18.10905452726363 6 19.825 35.4 24.575 20.200000000000003 7 19.275000000000002 18.175 40.699999999999996 21.85 8 21.925 22.0 27.725 28.349999999999998 9 21.325 25.775 28.4 24.5 10-14 23.051152557627884 29.12645632281614 26.351317565878297 21.471073553677684 15-19 23.39052573658146 28.037616927617425 27.487369316192282 21.084488019608823 20-24 23.48788303625075 29.035649909873822 27.032845984378127 20.443621069497297 25-29 23.31580265464563 28.314550463310795 27.2526922113699 21.116954670673678 30-34 23.489630297565377 28.293758140466885 27.582406572487727 20.63420498948001 35-39 22.839815557337612 27.87690457097033 27.84683239775461 21.436447473937452 40-44 22.964373402816054 28.53134238613018 27.62940321691637 20.874880994137396 45-49 23.641005105616177 27.740514566022622 28.180999099008908 20.437481229352287 50-54 23.6168084042021 27.86893446723362 27.458729364682345 21.05552776388194 55-59 24.108437953283648 27.91977192017206 27.499624868704046 20.472165257840246 60-64 24.001000250062514 28.037009252313077 28.072018004501125 19.88997249312328 65-69 23.817381738173818 28.237823782378236 27.42774277427743 20.517051705170516 70-74 23.585 28.939999999999998 26.950000000000003 20.525 75-79 24.18 27.915 27.48 20.424999999999997 80-84 24.13 27.85 27.905 20.115 85-89 23.91 27.68 27.750000000000004 20.66 90-94 23.585 28.660000000000004 27.565 20.19 95-99 23.775 28.110000000000003 27.785 20.330000000000002 100-104 23.849999999999998 28.99 26.96 20.200000000000003 105-109 23.7 27.794999999999998 28.315 20.19 110-114 24.625 27.85 26.974999999999998 20.549999999999997 115-119 24.345 27.67 27.26 20.724999999999998 120-124 23.799999999999997 27.994999999999997 27.905 20.3 125-129 23.705000000000002 27.955000000000002 28.189999999999998 20.150000000000002 130-134 23.905 28.144999999999996 27.67 20.28 135-139 23.775 27.655 28.435 20.135 140-144 23.98 28.04 27.855 20.125 145-149 23.695 28.88 27.525 19.900000000000002 150-151 23.9125 27.737499999999997 28.050000000000004 20.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 2.0 21 1.5 22 0.0 23 0.5 24 1.0 25 1.0 26 2.5 27 3.5 28 5.0 29 7.5 30 9.5 31 10.5 32 18.5 33 29.0 34 31.5 35 46.0 36 65.5 37 97.0 38 138.0 39 164.0 40 195.5 41 231.0 42 271.5 43 293.0 44 296.0 45 302.0 46 291.5 47 265.0 48 232.5 49 202.0 50 174.0 51 144.0 52 119.0 53 91.0 54 68.5 55 50.5 56 33.5 57 28.0 58 21.5 59 14.5 60 7.0 61 7.0 62 8.5 63 4.0 64 3.0 65 4.5 66 2.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.075 3 0.05 4 0.05 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.045 20-24 0.13999999999999999 25-29 0.17500000000000002 30-34 0.19 35-39 0.24 40-44 0.215 45-49 0.11 50-54 0.05 55-59 0.034999999999999996 60-64 0.025 65-69 0.01 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59768669851647 99.02499999999999 2 0.3017349761126477 0.6 3 0.07543374402816193 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.025144581342720643 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTTAATTTGAGACAGAAAACATGAAATCCTCCTACACTTTCTTCATTCT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.4375 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.5625 0.0 0.0 0.0 0.0 116-117 0.7 0.0 0.0 0.0 0.0 118-119 0.85 0.0 0.0 0.0 0.0 120-121 1.0 0.0 0.0 0.0 0.0 122-123 1.1875 0.0 0.0 0.0 0.0 124-125 1.35 0.0 0.0 0.0 0.0 126-127 1.4874999999999998 0.0 0.0 0.0 0.0 128-129 1.75 0.0 0.0 0.0 0.0 130-131 1.9375 0.0 0.0 0.0 0.0 132-133 2.1500000000000004 0.0 0.0 0.0 0.0 134-135 2.3499999999999996 0.0 0.0 0.0 0.0 136-137 2.5875 0.0 0.0 0.0 0.0 138-139 2.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGAAGA 10 0.006830828 145.0 5 >>END_MODULE Read 798352 spots for SRR7171940.sra Written 798352 spots for SRR7171940.sra Read 798352 spots for SRR7171940.sra Written 798352 spots for SRR7171940.sra Read 798352 spots for SRR7171940.sra Written 798352 spots for SRR7171940.sra Read 798352 spots for SRR7171940.sra Written 798352 spots for SRR7171940.sra Read 798352 spots for SRR7171940.sra Written 798352 spots for SRR7171940.sra Read 798352 spots for SRR7171940.sra Read 798352 spots for SRR7171940.sra Written 798352 spots for SRR7171940.sra Written 798352 spots for SRR7171940.sra Read 798352 spots for SRR7171940.sra Written 798352 spots for SRR7171940.sra Read 798352 spots for SRR7171940.sra Written 798352 spots for SRR7171940.sra Read 798352 spots for SRR7171940.sra Written 798352 spots for SRR7171940.sra Read 798352 spots for SRR7171940.sra Written 798352 spots for SRR7171940.sra Read 798352 spots for SRR7171940.sra Written 798352 spots for SRR7171940.sra Read 798352 spots for SRR7171940.sra Written 798352 spots for SRR7171940.sra Read 798352 spots for SRR7171940.sra Written 798352 spots for SRR7171940.sra Read 798352 spots for SRR7171940.sra Written 798352 spots for SRR7171940.sra Read 798352 spots for SRR7171940.sra Written 798352 spots for SRR7171940.sra Read 798352 spots for SRR7171940.sra Written 798352 spots for SRR7171940.sra Read 798353 spots for SRR7171940.sra Written 798353 spots for SRR7171940.sra Read 798352 spots for SRR7171940.sra Written 798352 spots for SRR7171940.sra Read 798352 spots for SRR7171940.sra Written 798352 spots for SRR7171940.sra SRR ids: ['SRR7171940.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_aqgaiub0 SRR7171940.sra spots: 15967041 blocks: [[1, 798352], [798353, 1596704], [1596705, 2395056], [2395057, 3193408], [3193409, 3991760], [3991761, 4790112], [4790113, 5588464], [5588465, 6386816], [6386817, 7185168], [7185169, 7983520], [7983521, 8781872], [8781873, 9580224], [9580225, 10378576], [10378577, 11176928], [11176929, 11975280], [11975281, 12773632], [12773633, 13571984], [13571985, 14370336], [14370337, 15168688], [15168689, 15967041]] SRR7171940 file size 5389005 SRR7171940 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171940 SRR7171940_1.fastq SRR7171940_2.fastq Input file: SRR7171940_1.fastq Paired file: SRR7171940_2.fastq trimmed: SRR7171940-trimmed-pair1.fastq, SRR7171940-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 03:31:56 2025 >> started Fri Feb 14 03:32:13 2025 >> done (16.633s) 15967041 read pairs processed; of these: 31299 ( 0.20%) short read pairs filtered out after trimming by size control 32152 ( 0.20%) empty read pairs filtered out after trimming by size control 15903590 (99.60%) read pairs available; of these: 5349368 (33.64%) trimmed read pairs available after processing 10554222 (66.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 5 0.00% 21 3 0.00% 22 3 0.00% 23 1 0.00% 24 4 0.00% 25 6 0.00% 26 4 0.00% 27 5 0.00% 28 8 0.00% 29 9 0.00% 30 5 0.00% 31 10 0.00% 32 10 0.00% 33 4 0.00% 34 6 0.00% 35 5 0.00% 36 8 0.00% 37 8 0.00% 38 7 0.00% 39 13 0.00% 40 12 0.00% 41 12 0.00% 42 20 0.00% 43 40 0.00% 44 17 0.00% 45 28 0.00% 46 23 0.00% 47 77 0.00% 48 126 0.00% 49 33 0.00% 50 27 0.00% 51 41 0.00% 52 106 0.00% 53 127 0.00% 54 104 0.00% 55 73 0.00% 56 88 0.00% 57 101 0.00% 58 147 0.00% 59 77 0.00% 60 93 0.00% 61 115 0.00% 62 116 0.00% 63 102 0.00% 64 120 0.00% 65 129 0.00% 66 168 0.00% 67 157 0.00% 68 201 0.00% 69 245 0.00% 70 279 0.00% 71 300 0.00% 72 338 0.00% 73 383 0.00% 74 490 0.00% 75 546 0.00% 76 690 0.00% 77 734 0.00% 78 683 0.00% 79 917 0.01% 80 889 0.01% 81 1065 0.01% 82 1098 0.01% 83 1408 0.01% 84 2736 0.02% 85 3673 0.02% 86 3722 0.02% 87 4062 0.03% 88 4149 0.03% 89 4280 0.03% 90 4251 0.03% 91 4490 0.03% 92 4716 0.03% 93 4801 0.03% 94 5162 0.03% 95 5498 0.03% 96 5474 0.03% 97 5802 0.04% 98 6153 0.04% 99 6602 0.04% 100 6928 0.04% 101 7370 0.05% 102 7663 0.05% 103 8135 0.05% 104 8646 0.05% 105 9295 0.06% 106 9635 0.06% 107 10001 0.06% 108 10522 0.07% 109 11137 0.07% 110 11839 0.07% 111 12449 0.08% 112 13112 0.08% 113 13387 0.08% 114 14613 0.09% 115 15184 0.10% 116 16076 0.10% 117 16710 0.11% 118 17129 0.11% 119 18245 0.11% 120 19933 0.13% 121 19790 0.12% 122 20017 0.13% 123 21678 0.14% 124 22602 0.14% 125 22984 0.14% 126 24226 0.15% 127 25268 0.16% 128 26368 0.17% 129 27216 0.17% 130 28721 0.18% 131 29960 0.19% 132 31830 0.20% 133 33454 0.21% 134 36229 0.23% 135 38264 0.24% 136 40424 0.25% 137 43120 0.27% 138 46206 0.29% 139 49167 0.31% 140 52570 0.33% 141 57290 0.36% 142 63845 0.40% 143 72048 0.45% 144 83378 0.52% 145 98634 0.62% 146 121502 0.76% 147 161261 1.01% 148 244280 1.54% 149 491352 3.09% 150 2969432 18.67% 151 10554222 66.36% 15903590 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=26 prefix-density=0.46 prefix-fanout=2.0 sequence=CAGGTGCAGTTTGATCCACACTTGCA criterion=fanout-score sequence-density=0.12 sequence-density-rank=17 fanout-score=10.36 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=6.1 sequence=GTGATGGTCTTTCC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=26 prefix-density=0.60 prefix-fanout=2.1 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=63.78 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=4.5 sequence=AGAAGGATCTGTTTAATTTGAGACAGAAAACATGAAATCCTCCTACACTTTCTTCATTCTTTTCTCACTCTTTTCGTTTGCTAACGTGATCGGTGCTAGAAAAGACACTGGAGAGTATTGGAGAGCTGTCATGAAAGATCAGCCCATGCCAGAAGCAATACA SRR7171940 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 03:32:56 Started mapping on | Feb 14 03:32:56 Finished on | Feb 14 03:34:25 Mapping speed, Million of reads per hour | 643.29 Number of input reads | 15903590 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14981292 Uniquely mapped reads % | 94.20% Average mapped length | 296.69 Number of splices: Total | 14866750 Number of splices: Annotated (sjdb) | 14602405 Number of splices: GT/AG | 14629523 Number of splices: GC/AG | 188417 Number of splices: AT/AC | 12018 Number of splices: Non-canonical | 36792 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 381149 % of reads mapped to multiple loci | 2.40% Number of reads mapped to too many loci | 33277 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.14% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 569173 569173 569173 N_multimapping 381149 381149 381149 N_noFeature 339539 14809556 428217 N_ambiguous 173594 1267 89726 UnstrandedReadsAssigned:14468159 PositiveStrandReadsAssigned:170469 NegativeStrandReadsAssigned:14463349 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7171940 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171940-trimmed-pair1.fastq SRR7171940-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,903,590 reads, 14,307,640 reads pseudoaligned [quant] estimated average fragment length: 263.803 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,111 rounds 52401 SRR7171940.ke.tsv 34699 SRR7171940.se.tsv 87100 total ==> SRR7171940.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1755.2 1155 40.7847 Potri.005G024800.1.v4.1 1035 772.197 119 9.55124 Potri.004G059700.1.v4.1 961 698.218 38 3.37313 Potri.007G009000.2.v4.1 1416 1153.2 0 0 Potri.003G141000.2.v4.1 2943 2680.2 578.177 13.3701 Potri.016G087400.1.v4.1 270 69.1357 1242 1113.42 Potri.015G069301.1.v4.1 564 306.748 0 0 Potri.010G195200.1.v4.1 1773 1510.2 212.891 8.73704 Potri.012G127500.1.v4.1 977 714.208 4000 347.117 ==> SRR7171940.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 80 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 395 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 168 SRR7171940 completed mapping pipeline successfully