Starting /dee2/code/volunteer_pipeline.sh SRR7171941 current disk space = 3111723925504 free memory = 1571277316 SRR7171941 SRAfilesize 69395f18f51bb07968ae1503f975df0e SRR7171941.sra SRR7171941.sra file validated SRR7171941 is paired end SRR7171941 is conventional basespace SRR7171941 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171941_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.62925 32.0 18.0 33.0 18.0 33.0 2 32.0215 33.0 32.0 33.0 28.0 34.0 3 29.853 31.0 29.0 33.0 25.0 33.0 4 32.192 33.0 33.0 33.0 31.0 33.0 5 32.53875 33.0 33.0 33.0 32.0 34.0 6 36.45925 38.0 36.0 38.0 34.0 38.0 7 37.34875 38.0 38.0 38.0 36.0 38.0 8 37.52625 38.0 38.0 38.0 37.0 38.0 9 37.65225 38.0 38.0 38.0 38.0 38.0 10-14 37.61545 38.0 38.0 38.0 38.0 38.0 15-19 37.6097 38.0 38.0 38.0 38.0 38.0 20-24 37.62405 38.0 38.0 38.0 38.0 38.0 25-29 37.59905 38.0 38.0 38.0 38.0 38.0 30-34 37.5409 38.0 38.0 38.0 38.0 38.0 35-39 37.519949999999994 38.0 38.0 38.0 37.8 38.0 40-44 37.48805 38.0 38.0 38.0 37.0 38.0 45-49 37.4624 38.0 38.0 38.0 37.4 38.0 50-54 37.40325 38.0 38.0 38.0 37.0 38.0 55-59 37.3081 38.0 38.0 38.0 36.8 38.0 60-64 37.28145 38.0 38.0 38.0 36.8 38.0 65-69 37.21205 38.0 38.0 38.0 36.4 38.0 70-74 37.16760000000001 38.0 38.0 38.0 36.0 38.0 75-79 37.1168 38.0 38.0 38.0 36.0 38.0 80-84 37.040299999999995 38.0 38.0 38.0 36.0 38.0 85-89 36.960100000000004 38.0 38.0 38.0 35.8 38.0 90-94 36.84085 38.0 38.0 38.0 35.2 38.0 95-99 36.777 38.0 38.0 38.0 35.0 38.0 100-104 36.68875 38.0 38.0 38.0 34.8 38.0 105-109 36.522000000000006 38.0 38.0 38.0 34.2 38.0 110-114 36.420300000000005 38.0 38.0 38.0 34.0 38.0 115-119 36.222699999999996 38.0 37.0 38.0 33.6 38.0 120-124 36.15355 38.0 37.0 38.0 33.6 38.0 125-129 35.91955 38.0 36.6 38.0 32.8 38.0 130-134 35.662499999999994 38.0 36.2 38.0 31.4 38.0 135-139 35.3802 38.0 36.0 38.0 30.6 38.0 140-144 35.0304 38.0 35.4 38.0 28.6 38.0 145-149 34.6716 38.0 35.0 38.0 28.0 38.0 150-151 31.40275 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 0.0 11 1.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 1.0 18 1.0 19 5.0 20 1.0 21 5.0 22 4.0 23 7.0 24 4.0 25 5.0 26 7.0 27 19.0 28 14.0 29 23.0 30 22.0 31 29.0 32 54.0 33 98.0 34 152.0 35 253.0 36 757.0 37 2534.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.199999999999996 13.775 12.45 31.574999999999996 2 21.50537634408602 17.37934483620905 36.209052263065765 24.90622655663916 3 19.25 23.3 27.675 29.775000000000002 4 22.325 30.7 24.099999999999998 22.875 5 23.200000000000003 33.2 24.725 18.875 6 19.650000000000002 33.550000000000004 26.55 20.25 7 14.575 23.825 42.199999999999996 19.400000000000002 8 17.974999999999998 24.224999999999998 31.924999999999997 25.874999999999996 9 17.349999999999998 24.575 33.0 25.074999999999996 10-14 19.915 30.29 27.644999999999996 22.15 15-19 19.82 28.675 27.955000000000002 23.549999999999997 20-24 20.075000000000003 29.375 27.93 22.62 25-29 20.080000000000002 28.73 27.560000000000002 23.630000000000003 30-34 19.71 29.01 27.744999999999997 23.535 35-39 20.59 28.549999999999997 27.42 23.44 40-44 19.8 28.95 27.74 23.51 45-49 19.939999999999998 28.605000000000004 27.66 23.794999999999998 50-54 19.885 28.439999999999998 27.965 23.71 55-59 20.175 28.605000000000004 26.705000000000002 24.515 60-64 19.35 29.020000000000003 27.85 23.78 65-69 19.865 28.015 28.310000000000002 23.810000000000002 70-74 20.145 28.64 27.589999999999996 23.625 75-79 20.375 27.994999999999997 27.825 23.805 80-84 20.22 28.044999999999998 27.555000000000003 24.18 85-89 20.794999999999998 28.4 27.189999999999998 23.615 90-94 20.16 28.595 27.229999999999997 24.015 95-99 20.44 28.194999999999997 27.68 23.685000000000002 100-104 20.57 28.845 27.555000000000003 23.03 105-109 20.419999999999998 27.88 27.755000000000003 23.945 110-114 21.25 27.92 27.200000000000003 23.630000000000003 115-119 20.625 28.055000000000003 27.68 23.64 120-124 21.005 28.310000000000002 27.139999999999997 23.544999999999998 125-129 21.26 28.105000000000004 27.439999999999998 23.195 130-134 20.915 28.24 26.56 24.285 135-139 21.790000000000003 27.87 26.810000000000002 23.53 140-144 21.37 27.91 27.060000000000002 23.66 145-149 20.86 28.34 26.61 24.19 150-151 21.2625 27.325 27.187499999999996 24.224999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.5 18 1.0 19 1.0 20 0.5 21 0.5 22 1.5 23 2.5 24 5.0 25 7.0 26 6.5 27 10.5 28 14.0 29 13.5 30 18.5 31 30.5 32 47.5 33 58.5 34 67.5 35 82.0 36 97.0 37 106.0 38 108.5 39 137.0 40 176.0 41 212.0 42 245.0 43 243.5 44 254.5 45 282.0 46 269.5 47 246.5 48 233.0 49 198.0 50 162.5 51 150.0 52 119.0 53 81.0 54 67.0 55 56.0 56 42.5 57 34.5 58 28.5 59 17.0 60 14.5 61 14.5 62 9.0 63 5.5 64 3.0 65 3.0 66 3.0 67 2.5 68 3.0 69 2.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8246492985972 99.625 2 0.15030060120240482 0.3 3 0.0250501002004008 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.5874999999999999 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.825 0.0 0.0 0.0 0.0 106-107 0.95 0.0 0.0 0.0 0.0 108-109 1.0625 0.0 0.0 0.0 0.0 110-111 1.2374999999999998 0.0 0.0 0.0 0.0 112-113 1.3875000000000002 0.0 0.0 0.0 0.0 114-115 1.5625 0.0 0.0 0.0 0.0 116-117 1.6875 0.0 0.0 0.0 0.0 118-119 1.875 0.0 0.0 0.0 0.0 120-121 2.075 0.0 0.0 0.0 0.0 122-123 2.275 0.0 0.0 0.0 0.0 124-125 2.4749999999999996 0.0 0.0 0.0 0.0 126-127 2.8125 0.0 0.0 0.0 0.0 128-129 3.25 0.0 0.0 0.0 0.0 130-131 3.5125 0.0 0.0 0.0 0.0 132-133 3.8625 0.0 0.0 0.0 0.0 134-135 4.2 0.0 0.0 0.0 0.0 136-137 4.425 0.0 0.0 0.0 0.0 138-139 4.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171941 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171941_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.08125 33.0 33.0 34.0 32.0 34.0 2 33.15025 34.0 33.0 34.0 33.0 34.0 3 33.20775 34.0 33.0 34.0 33.0 34.0 4 33.1395 34.0 33.0 34.0 33.0 34.0 5 33.197 34.0 33.0 34.0 33.0 34.0 6 37.325 38.0 38.0 38.0 37.0 38.0 7 37.3305 38.0 38.0 38.0 37.0 38.0 8 37.36375 38.0 38.0 38.0 38.0 38.0 9 37.2965 38.0 38.0 38.0 37.0 38.0 10-14 37.334500000000006 38.0 38.0 38.0 37.6 38.0 15-19 37.27105 38.0 38.0 38.0 37.0 38.0 20-24 37.249900000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.2702 38.0 38.0 38.0 37.0 38.0 30-34 37.2395 38.0 38.0 38.0 37.0 38.0 35-39 37.18475 38.0 38.0 38.0 37.0 38.0 40-44 36.98395000000001 38.0 38.0 38.0 36.8 38.0 45-49 37.182 38.0 38.0 38.0 37.0 38.0 50-54 37.10949999999999 38.0 38.0 38.0 37.0 38.0 55-59 37.1263 38.0 38.0 38.0 37.0 38.0 60-64 37.01215 38.0 38.0 38.0 36.6 38.0 65-69 36.9657 38.0 38.0 38.0 36.0 38.0 70-74 36.928700000000006 38.0 38.0 38.0 36.0 38.0 75-79 36.881099999999996 38.0 38.0 38.0 36.0 38.0 80-84 36.790800000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.744749999999996 38.0 38.0 38.0 35.6 38.0 90-94 36.59855 38.0 38.0 38.0 34.8 38.0 95-99 36.53015 38.0 38.0 38.0 34.6 38.0 100-104 36.336600000000004 38.0 38.0 38.0 34.0 38.0 105-109 36.2179 38.0 38.0 38.0 34.0 38.0 110-114 36.1552 38.0 38.0 38.0 33.8 38.0 115-119 35.939800000000005 38.0 37.2 38.0 33.4 38.0 120-124 35.801050000000004 38.0 37.2 38.0 33.0 38.0 125-129 35.5644 38.0 36.8 38.0 31.4 38.0 130-134 35.146300000000004 38.0 36.0 38.0 29.4 38.0 135-139 34.987500000000004 38.0 35.8 38.0 28.6 38.0 140-144 34.6649 38.0 35.2 38.0 27.8 38.0 145-149 34.141650000000006 38.0 35.0 38.0 24.6 38.0 150-151 30.552875 36.5 29.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 6.0 4 2.0 5 1.0 6 3.0 7 1.0 8 2.0 9 2.0 10 0.0 11 1.0 12 2.0 13 3.0 14 0.0 15 6.0 16 0.0 17 6.0 18 5.0 19 5.0 20 3.0 21 5.0 22 7.0 23 11.0 24 5.0 25 8.0 26 15.0 27 11.0 28 18.0 29 20.0 30 28.0 31 49.0 32 38.0 33 75.0 34 143.0 35 248.0 36 648.0 37 2619.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.925 18.15 15.5 26.424999999999997 2 24.9 24.025 32.775 18.3 3 22.925 27.575 27.875 21.625 4 24.925 35.175 21.325 18.575 5 23.7 36.1 22.675 17.525 6 19.05 35.699999999999996 24.825 20.424999999999997 7 19.35 19.15 39.800000000000004 21.7 8 22.5 22.475 27.55 27.474999999999998 9 22.95 24.7 28.175 24.175 10-14 23.14 28.575 26.26 22.025 15-19 23.325000000000003 27.905 27.52 21.25 20-24 23.53 28.405 26.950000000000003 21.115000000000002 25-29 24.275 28.54 26.205000000000002 20.979999999999997 30-34 23.24 28.310000000000002 27.105 21.345 35-39 23.21044470011505 28.252713721174526 27.18223200440198 21.35460957430844 40-44 23.72260943689515 27.172441458155745 27.292784435641575 21.812164669307528 45-49 23.64 28.07 27.455000000000002 20.835 50-54 24.044999999999998 28.075 26.865 21.015 55-59 23.555 27.875 27.365000000000002 21.205 60-64 23.825 27.735 27.6 20.84 65-69 23.990000000000002 27.800000000000004 27.029999999999998 21.18 70-74 24.29 28.665000000000003 26.195 20.849999999999998 75-79 24.365000000000002 27.82 27.42 20.395 80-84 23.65 28.425 26.729999999999997 21.195 85-89 23.61 28.03 27.26 21.099999999999998 90-94 24.02 27.73 26.77 21.48 95-99 23.77 27.169999999999998 27.85 21.21 100-104 23.580000000000002 27.775 27.435 21.21 105-109 24.015 26.915 27.595 21.475 110-114 23.57 28.395 26.96 21.075 115-119 24.315 27.794999999999998 27.155 20.735 120-124 23.74 27.875 27.57 20.815 125-129 23.84 27.639999999999997 27.310000000000002 21.21 130-134 24.2 27.955000000000002 27.295 20.549999999999997 135-139 24.404999999999998 27.6 27.42 20.575 140-144 24.775 27.74 27.21 20.275000000000002 145-149 24.94 27.150000000000002 27.73 20.18 150-151 25.4375 26.8 26.887499999999996 20.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 1.0 15 0.5 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.0 22 0.0 23 1.0 24 2.0 25 2.5 26 3.0 27 2.0 28 2.5 29 4.0 30 5.5 31 12.5 32 18.0 33 21.5 34 34.5 35 53.0 36 68.5 37 87.0 38 107.0 39 135.5 40 176.0 41 212.5 42 249.0 43 246.0 44 268.0 45 305.0 46 267.0 47 262.5 48 263.0 49 231.0 50 206.0 51 164.5 52 124.0 53 105.5 54 89.5 55 63.5 56 51.5 57 41.0 58 27.0 59 23.0 60 20.0 61 13.0 62 7.5 63 6.5 64 4.0 65 3.0 66 3.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.045 40-44 0.28500000000000003 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.6625000000000001 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 0.925 0.0 0.0 0.0 0.0 108-109 1.0375 0.0 0.0 0.0 0.0 110-111 1.2 0.0 0.0 0.0 0.0 112-113 1.3375 0.0 0.0 0.0 0.0 114-115 1.5375 0.0 0.0 0.0 0.0 116-117 1.6625 0.0 0.0 0.0 0.0 118-119 1.85 0.0 0.0 0.0 0.0 120-121 2.05 0.0 0.0 0.0 0.0 122-123 2.25 0.0 0.0 0.0 0.0 124-125 2.4875 0.0 0.0 0.0 0.0 126-127 2.8375 0.0 0.0 0.0 0.0 128-129 3.3499999999999996 0.0 0.0 0.0 0.0 130-131 3.6500000000000004 0.0 0.0 0.0 0.0 132-133 4.025 0.0 0.0 0.0 0.0 134-135 4.375 0.0 0.0 0.0 0.0 136-137 4.637499999999999 0.0 0.0 0.0 0.0 138-139 4.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCCAA 10 0.006830828 145.0 9 ATAGCCT 10 0.006830828 145.0 9 GGAAACT 10 0.006830828 145.0 1 >>END_MODULE Read 669838 spots for SRR7171941.sra Written 669838 spots for SRR7171941.sra Read 669838 spots for SRR7171941.sra Written 669838 spots for SRR7171941.sra Read 669838 spots for SRR7171941.sra Written 669838 spots for SRR7171941.sra Read 669838 spots for SRR7171941.sra Written 669838 spots for SRR7171941.sra Read 669838 spots for SRR7171941.sra Written 669838 spots for SRR7171941.sra Read 669838 spots for SRR7171941.sra Written 669838 spots for SRR7171941.sra Read 669838 spots for SRR7171941.sra Written 669838 spots for SRR7171941.sra Read 669838 spots for SRR7171941.sra Written 669838 spots for SRR7171941.sra Read 669838 spots for SRR7171941.sra Written 669838 spots for SRR7171941.sra Read 669838 spots for SRR7171941.sra Written 669838 spots for SRR7171941.sra Read 669838 spots for SRR7171941.sra Written 669838 spots for SRR7171941.sra Read 669838 spots for SRR7171941.sra Written 669838 spots for SRR7171941.sra Read 669842 spots for SRR7171941.sra Written 669842 spots for SRR7171941.sra Read 669838 spots for SRR7171941.sra Written 669838 spots for SRR7171941.sra Read 669838 spots for SRR7171941.sra Written 669838 spots for SRR7171941.sra Read 669838 spots for SRR7171941.sra Written 669838 spots for SRR7171941.sra Read 669838 spots for SRR7171941.sra Written 669838 spots for SRR7171941.sra Read 669838 spots for SRR7171941.sra Written 669838 spots for SRR7171941.sra Read 669838 spots for SRR7171941.sra Written 669838 spots for SRR7171941.sra Read 669838 spots for SRR7171941.sra Written 669838 spots for SRR7171941.sra SRR ids: ['SRR7171941.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4rmcm9x9 SRR7171941.sra spots: 13396764 blocks: [[1, 669838], [669839, 1339676], [1339677, 2009514], [2009515, 2679352], [2679353, 3349190], [3349191, 4019028], [4019029, 4688866], [4688867, 5358704], [5358705, 6028542], [6028543, 6698380], [6698381, 7368218], [7368219, 8038056], [8038057, 8707894], [8707895, 9377732], [9377733, 10047570], [10047571, 10717408], [10717409, 11387246], [11387247, 12057084], [12057085, 12726922], [12726923, 13396764]] SRR7171941 file size 4518023 SRR7171941 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171941 SRR7171941_1.fastq SRR7171941_2.fastq Input file: SRR7171941_1.fastq Paired file: SRR7171941_2.fastq trimmed: SRR7171941-trimmed-pair1.fastq, SRR7171941-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 16:48:54 2025 >> started Fri Feb 14 16:49:10 2025 >> done (15.768s) 13396764 read pairs processed; of these: 19118 ( 0.14%) short read pairs filtered out after trimming by size control 17689 ( 0.13%) empty read pairs filtered out after trimming by size control 13359957 (99.73%) read pairs available; of these: 5475327 (40.98%) trimmed read pairs available after processing 7884630 (59.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 2 0.00% 21 5 0.00% 22 9 0.00% 23 9 0.00% 24 5 0.00% 25 5 0.00% 26 7 0.00% 27 5 0.00% 28 9 0.00% 29 4 0.00% 30 9 0.00% 31 5 0.00% 32 8 0.00% 33 6 0.00% 34 8 0.00% 35 8 0.00% 36 14 0.00% 37 12 0.00% 38 12 0.00% 39 12 0.00% 40 10 0.00% 41 16 0.00% 42 15 0.00% 43 19 0.00% 44 24 0.00% 45 23 0.00% 46 25 0.00% 47 21 0.00% 48 27 0.00% 49 33 0.00% 50 39 0.00% 51 47 0.00% 52 48 0.00% 53 46 0.00% 54 57 0.00% 55 65 0.00% 56 69 0.00% 57 84 0.00% 58 100 0.00% 59 110 0.00% 60 139 0.00% 61 128 0.00% 62 127 0.00% 63 170 0.00% 64 172 0.00% 65 205 0.00% 66 235 0.00% 67 234 0.00% 68 281 0.00% 69 316 0.00% 70 328 0.00% 71 427 0.00% 72 465 0.00% 73 494 0.00% 74 533 0.00% 75 637 0.00% 76 951 0.01% 77 902 0.01% 78 896 0.01% 79 1041 0.01% 80 1177 0.01% 81 1231 0.01% 82 1535 0.01% 83 1702 0.01% 84 2613 0.02% 85 3241 0.02% 86 3412 0.03% 87 3947 0.03% 88 4275 0.03% 89 4333 0.03% 90 4503 0.03% 91 4789 0.04% 92 5033 0.04% 93 5211 0.04% 94 5445 0.04% 95 5872 0.04% 96 6115 0.05% 97 6425 0.05% 98 6778 0.05% 99 7230 0.05% 100 7676 0.06% 101 8275 0.06% 102 8802 0.07% 103 9350 0.07% 104 9840 0.07% 105 10538 0.08% 106 11046 0.08% 107 11652 0.09% 108 12014 0.09% 109 12669 0.09% 110 13525 0.10% 111 14130 0.11% 112 14952 0.11% 113 15849 0.12% 114 16627 0.12% 115 17562 0.13% 116 18258 0.14% 117 19038 0.14% 118 19759 0.15% 119 20360 0.15% 120 21206 0.16% 121 22241 0.17% 122 22868 0.17% 123 23980 0.18% 124 25132 0.19% 125 26115 0.20% 126 27005 0.20% 127 28404 0.21% 128 29100 0.22% 129 30294 0.23% 130 31939 0.24% 131 33763 0.25% 132 35016 0.26% 133 37008 0.28% 134 38691 0.29% 135 40987 0.31% 136 43226 0.32% 137 45908 0.34% 138 48680 0.36% 139 51738 0.39% 140 55434 0.41% 141 60881 0.46% 142 66647 0.50% 143 74848 0.56% 144 86270 0.65% 145 102768 0.77% 146 128128 0.96% 147 173945 1.30% 148 269676 2.02% 149 550375 4.12% 150 2876546 21.53% 151 7884630 59.02% 13359957 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=5.14 fanout-score-rank=19 prefix-density=0.30 prefix-fanout=4.1 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.11 sequence-density-rank=13 fanout-score=290.15 fanout-score-rank=1 prefix-density=1.06 prefix-fanout=30.1 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=31 prefix-density=0.33 prefix-fanout=2.1 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.11 sequence-density-rank=19 fanout-score=229.39 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=26.3 sequence=GAAGAAGAAGAA SRR7171941 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 16:50:24 Started mapping on | Feb 14 16:50:27 Finished on | Feb 14 16:52:28 Mapping speed, Million of reads per hour | 397.49 Number of input reads | 13359957 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 12249605 Uniquely mapped reads % | 91.69% Average mapped length | 295.42 Number of splices: Total | 11454640 Number of splices: Annotated (sjdb) | 11227723 Number of splices: GT/AG | 11266682 Number of splices: GC/AG | 143015 Number of splices: AT/AC | 9114 Number of splices: Non-canonical | 35829 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 361574 % of reads mapped to multiple loci | 2.71% Number of reads mapped to too many loci | 57083 % of reads mapped to too many loci | 0.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.07% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 767448 767448 767448 N_multimapping 361574 361574 361574 N_noFeature 300938 12119642 359293 N_ambiguous 142377 770 70314 UnstrandedReadsAssigned:11806290 PositiveStrandReadsAssigned:129193 NegativeStrandReadsAssigned:11819998 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171941 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171941-trimmed-pair1.fastq SRR7171941-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,359,957 reads, 11,755,113 reads pseudoaligned [quant] estimated average fragment length: 241.091 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,082 rounds 52401 SRR7171941.ke.tsv 34699 SRR7171941.se.tsv 87100 total ==> SRR7171941.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.91 628 24.4762 Potri.005G024800.1.v4.1 1035 794.909 152 13.2501 Potri.004G059700.1.v4.1 961 720.919 29 2.78744 Potri.007G009000.2.v4.1 1416 1175.91 0 0 Potri.003G141000.2.v4.1 2943 2702.91 334 8.56267 Potri.016G087400.1.v4.1 270 74.7382 1227.45 1138.04 Potri.015G069301.1.v4.1 564 326.654 0 0 Potri.010G195200.1.v4.1 1773 1532.91 121 5.4697 Potri.012G127500.1.v4.1 977 736.909 2324 218.533 ==> SRR7171941.se.tsv <== Potri.001G166300.v4.1 3 Potri.001G448400.v4.1 22 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 281 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 122 SRR7171941 completed mapping pipeline successfully