Starting /dee2/code/volunteer_pipeline.sh SRR7171942 current disk space = 3112600035328 free memory = 1414297280 SRR7171942 SRAfilesize a928c3581b4bbc3716196ed2b9932195 SRR7171942.sra SRR7171942.sra file validated SRR7171942 is paired end SRR7171942 is conventional basespace SRR7171942 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171942_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.6955 32.0 25.0 33.0 18.0 33.0 2 31.87775 33.0 31.0 33.0 29.0 34.0 3 31.9195 33.0 31.0 33.0 29.0 34.0 4 32.54725 33.0 33.0 33.0 31.0 34.0 5 32.5455 33.0 33.0 33.0 32.0 34.0 6 36.9755 38.0 37.0 38.0 35.0 38.0 7 37.47575 38.0 38.0 38.0 37.0 38.0 8 37.47175 38.0 38.0 38.0 37.0 38.0 9 37.60025 38.0 38.0 38.0 38.0 38.0 10-14 37.630649999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.63335000000001 38.0 38.0 38.0 38.0 38.0 20-24 37.629599999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.58875 38.0 38.0 38.0 38.0 38.0 30-34 37.53575 38.0 38.0 38.0 38.0 38.0 35-39 37.51115 38.0 38.0 38.0 37.8 38.0 40-44 37.50574999999999 38.0 38.0 38.0 37.8 38.0 45-49 37.46515 38.0 38.0 38.0 37.2 38.0 50-54 37.40675 38.0 38.0 38.0 37.0 38.0 55-59 37.3232 38.0 38.0 38.0 37.0 38.0 60-64 37.30155 38.0 38.0 38.0 37.0 38.0 65-69 37.24215 38.0 38.0 38.0 36.6 38.0 70-74 37.1644 38.0 38.0 38.0 36.2 38.0 75-79 37.098349999999996 38.0 38.0 38.0 36.0 38.0 80-84 37.018049999999995 38.0 38.0 38.0 36.0 38.0 85-89 37.05655 38.0 38.0 38.0 36.0 38.0 90-94 36.92725 38.0 38.0 38.0 35.4 38.0 95-99 36.84565 38.0 38.0 38.0 35.2 38.0 100-104 36.7418 38.0 38.0 38.0 34.6 38.0 105-109 36.53525 38.0 38.0 38.0 34.2 38.0 110-114 36.461 38.0 38.0 38.0 34.0 38.0 115-119 36.29395000000001 38.0 37.6 38.0 34.0 38.0 120-124 36.16685 38.0 37.2 38.0 33.4 38.0 125-129 35.926399999999994 38.0 37.0 38.0 33.2 38.0 130-134 35.5364 38.0 36.0 38.0 31.0 38.0 135-139 35.299549999999996 38.0 36.0 38.0 30.4 38.0 140-144 34.99865 38.0 35.6 38.0 29.2 38.0 145-149 34.451449999999994 38.0 35.0 38.0 27.4 38.0 150-151 31.139875 36.5 31.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 1.0 17 1.0 18 0.0 19 3.0 20 2.0 21 5.0 22 3.0 23 11.0 24 9.0 25 6.0 26 17.0 27 12.0 28 15.0 29 15.0 30 26.0 31 36.0 32 53.0 33 80.0 34 136.0 35 280.0 36 687.0 37 2599.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.175000000000004 13.525 11.375 32.925 2 20.474999999999998 17.150000000000002 36.425000000000004 25.95 3 19.375 23.849999999999998 27.35 29.425 4 22.05 33.425 23.0 21.525 5 22.35 34.050000000000004 25.074999999999996 18.525 6 17.150000000000002 35.699999999999996 26.3 20.849999999999998 7 12.85 23.375 44.55 19.225 8 17.525 23.474999999999998 30.225 28.775000000000002 9 16.925 24.15 33.7 25.224999999999998 10-14 20.31 28.68 27.384999999999998 23.625 15-19 20.075000000000003 28.365000000000002 28.560000000000002 23.0 20-24 19.919999999999998 28.505000000000003 27.935 23.64 25-29 19.31 28.904999999999998 27.775 24.01 30-34 19.805 28.125 28.225 23.845 35-39 19.794999999999998 28.23 28.249999999999996 23.724999999999998 40-44 20.21 28.62 27.62 23.549999999999997 45-49 19.89 28.03 28.03 24.05 50-54 19.445 28.835 27.994999999999997 23.724999999999998 55-59 20.165 28.375 27.810000000000002 23.65 60-64 19.54 29.054999999999996 27.43 23.974999999999998 65-69 20.26 27.944999999999997 27.93 23.865 70-74 20.330000000000002 28.29 28.055000000000003 23.325000000000003 75-79 19.935 28.29 27.85 23.925 80-84 20.705000000000002 27.985 27.575 23.735 85-89 19.73 27.744999999999997 28.345 24.18 90-94 19.919999999999998 28.165000000000003 27.810000000000002 24.104999999999997 95-99 20.155 28.005000000000003 28.360000000000003 23.48 100-104 20.34 27.325 28.410000000000004 23.925 105-109 20.305 27.52 27.894999999999996 24.279999999999998 110-114 20.035 27.875 27.994999999999997 24.095 115-119 20.365 27.765 28.310000000000002 23.56 120-124 20.405 28.1 27.815 23.68 125-129 20.275000000000002 27.985 28.175 23.565 130-134 20.495 27.595 27.73 24.18 135-139 19.985 28.51 27.48 24.025 140-144 20.265 28.02 27.425 24.29 145-149 20.29 28.689999999999998 26.76 24.26 150-151 20.7875 28.15 27.5875 23.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 0.5 21 0.5 22 1.0 23 1.0 24 2.0 25 2.5 26 2.5 27 5.5 28 11.0 29 14.0 30 15.0 31 26.0 32 33.5 33 35.0 34 46.5 35 62.5 36 79.5 37 92.5 38 131.5 39 175.0 40 203.0 41 241.0 42 261.0 43 282.0 44 279.0 45 263.5 46 274.5 47 251.0 48 234.5 49 227.0 50 179.0 51 131.5 52 106.5 53 88.0 54 69.5 55 50.0 56 32.5 57 22.5 58 19.5 59 15.0 60 7.5 61 4.5 62 5.0 63 4.5 64 1.0 65 1.5 66 2.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.44999999999999996 0.0 0.0 0.0 0.0 106-107 0.55 0.0 0.0 0.0 0.0 108-109 0.6625000000000001 0.0 0.0 0.0 0.0 110-111 0.725 0.0 0.0 0.0 0.0 112-113 0.8125 0.0 0.0 0.0 0.0 114-115 0.925 0.0 0.0 0.0 0.0 116-117 1.0125 0.0 0.0 0.0 0.0 118-119 1.0625 0.0 0.0 0.0 0.0 120-121 1.2125 0.0 0.0 0.0 0.0 122-123 1.375 0.0 0.0 0.0 0.0 124-125 1.5499999999999998 0.0 0.0 0.0 0.0 126-127 1.6875 0.0 0.0 0.0 0.0 128-129 1.9375 0.0 0.0 0.0 0.0 130-131 2.15 0.0 0.0 0.0 0.0 132-133 2.425 0.0 0.0 0.0 0.0 134-135 2.7249999999999996 0.0 0.0 0.0 0.0 136-137 2.9875 0.0 0.0 0.0 0.0 138-139 3.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171942 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171942_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0335 33.0 33.0 34.0 32.0 34.0 2 33.09675 34.0 33.0 34.0 33.0 34.0 3 33.07175 34.0 33.0 34.0 33.0 34.0 4 33.033 34.0 33.0 34.0 33.0 34.0 5 33.02025 34.0 33.0 34.0 33.0 34.0 6 37.24275 38.0 38.0 38.0 37.0 38.0 7 37.23525 38.0 38.0 38.0 37.0 38.0 8 37.214 38.0 38.0 38.0 37.0 38.0 9 37.28475 38.0 38.0 38.0 37.0 38.0 10-14 37.2448 38.0 38.0 38.0 37.0 38.0 15-19 37.22515 38.0 38.0 38.0 37.0 38.0 20-24 37.1796 38.0 38.0 38.0 37.0 38.0 25-29 37.20405 38.0 38.0 38.0 37.0 38.0 30-34 37.049150000000004 38.0 38.0 38.0 36.8 38.0 35-39 36.794650000000004 38.0 38.0 38.0 36.6 38.0 40-44 36.763850000000005 38.0 38.0 38.0 36.4 38.0 45-49 37.058550000000004 38.0 38.0 38.0 36.8 38.0 50-54 37.00065 38.0 38.0 38.0 36.8 38.0 55-59 36.996500000000005 38.0 38.0 38.0 36.8 38.0 60-64 36.965250000000005 38.0 38.0 38.0 36.2 38.0 65-69 36.8948 38.0 38.0 38.0 36.2 38.0 70-74 36.8734 38.0 38.0 38.0 36.0 38.0 75-79 36.839999999999996 38.0 38.0 38.0 36.0 38.0 80-84 36.72845 38.0 38.0 38.0 35.8 38.0 85-89 36.629 38.0 38.0 38.0 35.2 38.0 90-94 36.50935 38.0 38.0 38.0 35.0 38.0 95-99 36.37165 38.0 38.0 38.0 34.4 38.0 100-104 36.36085 38.0 38.0 38.0 34.0 38.0 105-109 36.20385 38.0 38.0 38.0 34.0 38.0 110-114 36.1519 38.0 37.8 38.0 34.0 38.0 115-119 35.942150000000005 38.0 37.4 38.0 33.0 38.0 120-124 35.838499999999996 38.0 37.0 38.0 33.0 38.0 125-129 35.6082 38.0 36.8 38.0 32.0 38.0 130-134 35.314800000000005 38.0 36.2 38.0 30.0 38.0 135-139 35.09575 38.0 36.0 38.0 30.0 38.0 140-144 34.569849999999995 38.0 35.4 38.0 27.2 38.0 145-149 34.2218 38.0 35.0 38.0 25.8 38.0 150-151 31.173000000000002 36.5 31.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 8.0 4 2.0 5 2.0 6 3.0 7 2.0 8 3.0 9 2.0 10 0.0 11 0.0 12 0.0 13 3.0 14 0.0 15 2.0 16 1.0 17 4.0 18 3.0 19 1.0 20 3.0 21 5.0 22 12.0 23 9.0 24 13.0 25 9.0 26 7.0 27 14.0 28 14.0 29 29.0 30 31.0 31 42.0 32 57.0 33 65.0 34 140.0 35 254.0 36 621.0 37 2628.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.0 18.3 16.55 24.15 2 24.099999999999998 24.5 32.525 18.875 3 21.525 28.775000000000002 29.225 20.474999999999998 4 25.025 35.8 21.7 17.474999999999998 5 24.375 36.5 21.725 17.4 6 19.900000000000002 37.275000000000006 24.8 18.025 7 19.325 19.575 39.7 21.4 8 21.975 24.15 26.8 27.075 9 22.6 26.375 27.85 23.175 10-14 23.77 28.96 26.215 21.055 15-19 23.06 28.525 27.24 21.175 20-24 22.975 28.82 27.265 20.94 25-29 23.625 27.944999999999997 27.655 20.775 30-34 22.82205513784461 28.842105263157897 27.81453634085213 20.521303258145362 35-39 23.085835180334474 28.6167640539996 27.971992746322787 20.32540801934314 40-44 23.279035755711334 28.11538655504564 27.948963639114428 20.6566140501286 45-49 23.415 27.700000000000003 27.975 20.91 50-54 23.605 27.800000000000004 28.1 20.495 55-59 23.97 28.349999999999998 27.224999999999998 20.455000000000002 60-64 23.794999999999998 27.96 27.525 20.72 65-69 23.04 28.375 27.925 20.66 70-74 23.674999999999997 28.435 26.955000000000002 20.935000000000002 75-79 23.865 27.744999999999997 27.905 20.485 80-84 24.175 28.444999999999997 27.065 20.315 85-89 24.44 28.09 27.189999999999998 20.28 90-94 24.245 28.01 27.544999999999998 20.200000000000003 95-99 23.485 28.744999999999997 27.3 20.47 100-104 23.955000000000002 27.93 27.36 20.755000000000003 105-109 23.82 28.199999999999996 27.575 20.405 110-114 23.355 28.189999999999998 27.839999999999996 20.615 115-119 24.18 28.050000000000004 27.834999999999997 19.935 120-124 23.815 28.12 27.839999999999996 20.225 125-129 23.745 27.900000000000002 27.855 20.5 130-134 24.21 28.685 26.965 20.14 135-139 23.915 28.375 27.860000000000003 19.85 140-144 24.315 27.925 27.045 20.715 145-149 24.33 28.455000000000002 27.439999999999998 19.775000000000002 150-151 24.462500000000002 28.212500000000002 26.887499999999996 20.4375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 1.0 24 1.5 25 2.0 26 5.0 27 5.5 28 4.0 29 5.5 30 10.5 31 14.0 32 17.0 33 24.5 34 35.0 35 44.5 36 70.5 37 104.0 38 127.0 39 164.5 40 198.5 41 241.0 42 277.5 43 281.5 44 280.5 45 288.0 46 293.5 47 264.0 48 245.5 49 230.0 50 186.0 51 149.5 52 122.0 53 83.0 54 64.5 55 55.0 56 24.5 57 18.0 58 19.5 59 11.5 60 6.0 61 4.5 62 5.0 63 3.5 64 1.5 65 1.5 66 1.5 67 1.5 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.25 35-39 0.74 40-44 0.855 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5475113122172 99.0 2 0.3770739064856712 0.75 3 0.050276520864756154 0.15 4 0.025138260432378077 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.75 0.0 0.0 0.0 0.0 112-113 0.8375 0.0 0.0 0.0 0.0 114-115 0.95 0.0 0.0 0.0 0.0 116-117 1.025 0.0 0.0 0.0 0.0 118-119 1.0625 0.0 0.0 0.0 0.0 120-121 1.2374999999999998 0.0 0.0 0.0 0.0 122-123 1.4 0.0 0.0 0.0 0.0 124-125 1.5750000000000002 0.0 0.0 0.0 0.0 126-127 1.7375 0.0 0.0 0.0 0.0 128-129 1.9874999999999998 0.0 0.0 0.0 0.0 130-131 2.2375 0.0 0.0 0.0 0.0 132-133 2.5374999999999996 0.0 0.0 0.0 0.0 134-135 2.8499999999999996 0.0 0.0 0.0 0.0 136-137 3.1125 0.0 0.0 0.0 0.0 138-139 3.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 962953 spots for SRR7171942.sra Written 962953 spots for SRR7171942.sra Read 962953 spots for SRR7171942.sra Written 962953 spots for SRR7171942.sra Read 962953 spots for SRR7171942.sra Written 962953 spots for SRR7171942.sra Read 962953 spots for SRR7171942.sra Written 962953 spots for SRR7171942.sra Read 962953 spots for SRR7171942.sra Written 962953 spots for SRR7171942.sra Read 962953 spots for SRR7171942.sra Written 962953 spots for SRR7171942.sra Read 962953 spots for SRR7171942.sra Written 962953 spots for SRR7171942.sra Read 962953 spots for SRR7171942.sra Written 962953 spots for SRR7171942.sra Read 962953 spots for SRR7171942.sra Written 962953 spots for SRR7171942.sra Read 962953 spots for SRR7171942.sra Written 962953 spots for SRR7171942.sra Read 962953 spots for SRR7171942.sra Written 962953 spots for SRR7171942.sra Read 962953 spots for SRR7171942.sra Written 962953 spots for SRR7171942.sra Read 962953 spots for SRR7171942.sra Written 962953 spots for SRR7171942.sra Read 962953 spots for SRR7171942.sra Written 962953 spots for SRR7171942.sra Read 962953 spots for SRR7171942.sra Written 962953 spots for SRR7171942.sra Read 962953 spots for SRR7171942.sra Written 962953 spots for SRR7171942.sra Read 962953 spots for SRR7171942.sra Written 962953 spots for SRR7171942.sra Read 962958 spots for SRR7171942.sra Written 962958 spots for SRR7171942.sra Read 962953 spots for SRR7171942.sra Written 962953 spots for SRR7171942.sra Read 962953 spots for SRR7171942.sra Written 962953 spots for SRR7171942.sra SRR ids: ['SRR7171942.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pw8nu2jt SRR7171942.sra spots: 19259065 blocks: [[1, 962953], [962954, 1925906], [1925907, 2888859], [2888860, 3851812], [3851813, 4814765], [4814766, 5777718], [5777719, 6740671], [6740672, 7703624], [7703625, 8666577], [8666578, 9629530], [9629531, 10592483], [10592484, 11555436], [11555437, 12518389], [12518390, 13481342], [13481343, 14444295], [14444296, 15407248], [15407249, 16370201], [16370202, 17333154], [17333155, 18296107], [18296108, 19259065]] SRR7171942 file size 6504564 SRR7171942 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171942 SRR7171942_1.fastq SRR7171942_2.fastq Input file: SRR7171942_1.fastq Paired file: SRR7171942_2.fastq trimmed: SRR7171942-trimmed-pair1.fastq, SRR7171942-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 15:27:52 2025 >> started Fri Feb 14 15:28:17 2025 >> done (24.624s) 19259065 read pairs processed; of these: 38083 ( 0.20%) short read pairs filtered out after trimming by size control 27948 ( 0.15%) empty read pairs filtered out after trimming by size control 19193034 (99.66%) read pairs available; of these: 8249910 (42.98%) trimmed read pairs available after processing 10943124 (57.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 6 0.00% 20 5 0.00% 21 8 0.00% 22 5 0.00% 23 7 0.00% 24 4 0.00% 25 11 0.00% 26 12 0.00% 27 16 0.00% 28 13 0.00% 29 11 0.00% 30 10 0.00% 31 9 0.00% 32 6 0.00% 33 7 0.00% 34 4 0.00% 35 8 0.00% 36 5 0.00% 37 8 0.00% 38 10 0.00% 39 15 0.00% 40 16 0.00% 41 14 0.00% 42 7 0.00% 43 7 0.00% 44 19 0.00% 45 13 0.00% 46 20 0.00% 47 19 0.00% 48 27 0.00% 49 21 0.00% 50 30 0.00% 51 26 0.00% 52 41 0.00% 53 33 0.00% 54 49 0.00% 55 51 0.00% 56 44 0.00% 57 61 0.00% 58 70 0.00% 59 65 0.00% 60 75 0.00% 61 89 0.00% 62 76 0.00% 63 99 0.00% 64 104 0.00% 65 136 0.00% 66 159 0.00% 67 166 0.00% 68 176 0.00% 69 206 0.00% 70 258 0.00% 71 245 0.00% 72 287 0.00% 73 354 0.00% 74 403 0.00% 75 474 0.00% 76 570 0.00% 77 613 0.00% 78 642 0.00% 79 722 0.00% 80 873 0.00% 81 947 0.00% 82 1144 0.01% 83 1402 0.01% 84 2919 0.02% 85 3911 0.02% 86 4067 0.02% 87 4433 0.02% 88 4574 0.02% 89 4588 0.02% 90 4744 0.02% 91 4881 0.03% 92 5035 0.03% 93 5112 0.03% 94 5341 0.03% 95 5819 0.03% 96 6154 0.03% 97 6358 0.03% 98 6574 0.03% 99 7031 0.04% 100 7589 0.04% 101 8087 0.04% 102 8622 0.04% 103 9272 0.05% 104 9627 0.05% 105 10431 0.05% 106 10796 0.06% 107 11757 0.06% 108 11963 0.06% 109 12751 0.07% 110 13671 0.07% 111 14519 0.08% 112 15355 0.08% 113 16468 0.09% 114 17474 0.09% 115 18173 0.09% 116 18944 0.10% 117 19769 0.10% 118 22644 0.12% 119 19848 0.10% 120 22579 0.12% 121 23864 0.12% 122 25002 0.13% 123 26524 0.14% 124 27880 0.15% 125 29324 0.15% 126 31069 0.16% 127 32586 0.17% 128 34254 0.18% 129 36061 0.19% 130 38190 0.20% 131 40376 0.21% 132 43461 0.23% 133 46081 0.24% 134 50136 0.26% 135 49614 0.26% 136 53649 0.28% 137 58188 0.30% 138 63375 0.33% 139 68777 0.36% 140 75617 0.39% 141 84051 0.44% 142 95621 0.50% 143 109275 0.57% 144 129130 0.67% 145 155884 0.81% 146 203161 1.06% 147 283943 1.48% 148 450141 2.35% 149 938649 4.89% 150 4553112 23.72% 151 10943124 57.02% 19193034 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=27 prefix-density=0.54 prefix-fanout=2.0 sequence=CAGGTGCAGTTTGATCCACA criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=38.08 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=6.2 sequence=AACTCCAGCAGGTTGATAGAAAGTACTTTACAGGGCGAGCACAGTTCATGGTCTTCACTCTTCAAGGTAAAGTATAAGCTCCACACTTGTAGCCCACAGGACGATCAGCAATGTTGCATCGTTTGGGAATGGTCATTGCAATTTCTGGCTTGATTCCAGAGCTCTTAGCAGTGTTGGAAAGCATAACAGCACAAAGGCACGCTGGGTTCTGTCCAATTTTCTTCACCCGAGCGCAGCACTGGCTCGAAACTGAAGAATTCTCATCCTGTGCTGCTGATGCACAAGGAGCCATCTTGAAAGCCTCCATGTCAGGAGTGGTGTTTTTCCCACATTCACCAGCCCCGTCAACTTGATTGAGCCCAGCAATGCTGAGAATTGCAAGAA criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=25 prefix-density=0.64 prefix-fanout=2.1 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=201.48 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=13.8 sequence=GAAAAATGGCGACTCCAATGAAGTACATTTGCTTGTTTATGTTTCTTGCAATTCTCAGCATTGCTGGGCTCAATCAAGTTGACGGGGCTGGTGAATGTGGGAAAAACACCACTCCTGACATGGAGGCTTTCAAGATGGCTCCTTGTGCATCAGCAGCACAGGATGAGAATTCTTCAGTTTCGAGCCAGTGCTGCGCTCGGGTGAAGAAAATTGGACAGAACCCAGCGTGCCTTTGTGCTGTTATGCTTTCCAACACTGCTAAGAGCTCTGGAATCAAGCCAGAAATTGCAATGACCATTCCCAAACGATGCAACATTGCTGATCGTCCTGTGGGCTACAAGTGTGGAGCTTATACTTTACCTTGAAGAGTGAAGACCATGAACTGTGCTCGCCCTGTAAAGTACTTTCTATCAACCT SRR7171942 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 15:29:13 Started mapping on | Feb 14 15:29:32 Finished on | Feb 14 15:32:05 Mapping speed, Million of reads per hour | 451.60 Number of input reads | 19193034 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 17779377 Uniquely mapped reads % | 92.63% Average mapped length | 296.38 Number of splices: Total | 17137739 Number of splices: Annotated (sjdb) | 16780433 Number of splices: GT/AG | 16865394 Number of splices: GC/AG | 213867 Number of splices: AT/AC | 14116 Number of splices: Non-canonical | 44362 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 456516 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 42197 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.67% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 990703 990703 990703 N_multimapping 456516 456516 456516 N_noFeature 459407 17577653 564551 N_ambiguous 207821 1352 110395 UnstrandedReadsAssigned:17112149 PositiveStrandReadsAssigned:200372 NegativeStrandReadsAssigned:17104431 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171942 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171942-trimmed-pair1.fastq SRR7171942-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,193,034 reads, 16,971,064 reads pseudoaligned [quant] estimated average fragment length: 259.345 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,126 rounds 52401 SRR7171942.ke.tsv 34699 SRR7171942.se.tsv 87100 total ==> SRR7171942.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.66 1796 54.2782 Potri.005G024800.1.v4.1 1035 776.655 341 23.3492 Potri.004G059700.1.v4.1 961 702.667 47 3.55709 Potri.007G009000.2.v4.1 1416 1157.66 0 0 Potri.003G141000.2.v4.1 2943 2684.66 649 12.8559 Potri.016G087400.1.v4.1 270 69.1776 1166 896.355 Potri.015G069301.1.v4.1 564 310.919 0 0 Potri.010G195200.1.v4.1 1773 1514.66 242 8.49666 Potri.012G127500.1.v4.1 977 718.667 10435 772.167 ==> SRR7171942.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 97 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 401 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 703 SRR7171942 completed mapping pipeline successfully