Starting /dee2/code/volunteer_pipeline.sh SRR7171943 current disk space = 3088036040704 free memory = 1450141172 SRR7171943 SRAfilesize 1bbfda3a20a81006221a205f8f22124f SRR7171943.sra SRR7171943.sra file validated SRR7171943 is paired end SRR7171943 is conventional basespace SRR7171943 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171943_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.263 32.0 18.0 33.0 18.0 34.0 2 32.26625 33.0 32.0 33.0 32.0 34.0 3 32.253 33.0 33.0 33.0 29.0 34.0 4 32.88375 33.0 33.0 34.0 31.0 34.0 5 33.10225 33.0 33.0 34.0 33.0 34.0 6 37.04575 38.0 37.0 38.0 36.0 38.0 7 37.464 38.0 38.0 38.0 37.0 38.0 8 37.55125 38.0 38.0 38.0 38.0 38.0 9 37.643 38.0 38.0 38.0 38.0 38.0 10-14 37.6242 38.0 38.0 38.0 38.0 38.0 15-19 37.6126 38.0 38.0 38.0 38.0 38.0 20-24 37.60340000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.5403 38.0 38.0 38.0 38.0 38.0 30-34 37.49835 38.0 38.0 38.0 37.8 38.0 35-39 37.48845 38.0 38.0 38.0 38.0 38.0 40-44 37.44815 38.0 38.0 38.0 37.2 38.0 45-49 37.45 38.0 38.0 38.0 37.0 38.0 50-54 37.3846 38.0 38.0 38.0 37.0 38.0 55-59 37.3538 38.0 38.0 38.0 37.0 38.0 60-64 37.23785 38.0 38.0 38.0 37.0 38.0 65-69 37.16969999999999 38.0 38.0 38.0 36.2 38.0 70-74 37.153850000000006 38.0 38.0 38.0 36.0 38.0 75-79 37.109449999999995 38.0 38.0 38.0 36.0 38.0 80-84 37.03255 38.0 38.0 38.0 36.0 38.0 85-89 36.997049999999994 38.0 38.0 38.0 35.8 38.0 90-94 36.8344 38.0 38.0 38.0 35.0 38.0 95-99 36.78375 38.0 38.0 38.0 35.0 38.0 100-104 36.65995 38.0 38.0 38.0 34.6 38.0 105-109 36.43415 38.0 38.0 38.0 34.0 38.0 110-114 36.3969 38.0 38.0 38.0 34.0 38.0 115-119 36.25165 38.0 37.6 38.0 33.6 38.0 120-124 36.1707 38.0 37.0 38.0 33.6 38.0 125-129 35.9212 38.0 37.0 38.0 32.6 38.0 130-134 35.6626 38.0 36.2 38.0 31.4 38.0 135-139 35.44195 38.0 36.0 38.0 31.2 38.0 140-144 35.04675 38.0 35.8 38.0 28.8 38.0 145-149 34.62335 38.0 35.0 38.0 28.0 38.0 150-151 31.259375 36.5 31.5 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 1.0 14 0.0 15 0.0 16 2.0 17 4.0 18 0.0 19 3.0 20 2.0 21 3.0 22 9.0 23 3.0 24 8.0 25 13.0 26 14.0 27 18.0 28 19.0 29 19.0 30 31.0 31 36.0 32 53.0 33 76.0 34 121.0 35 233.0 36 675.0 37 2656.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.75 14.524999999999999 11.875 33.85 2 19.61961961961962 20.32032032032032 37.06206206206206 22.997997997998 3 19.1 27.725 25.974999999999998 27.200000000000003 4 22.400000000000002 35.225 21.175 21.2 5 21.875 34.9 24.2 19.025 6 19.225 35.4 24.875 20.5 7 13.25 21.95 45.550000000000004 19.25 8 18.099999999999998 21.7 30.9 29.299999999999997 9 18.65 23.275000000000002 31.674999999999997 26.400000000000002 10-14 19.830000000000002 29.439999999999998 26.484999999999996 24.245 15-19 20.169999999999998 27.950000000000003 28.315 23.565 20-24 20.4 28.000000000000004 28.315 23.285 25-29 20.485 28.525 27.694999999999997 23.294999999999998 30-34 20.285 28.804999999999996 27.589999999999996 23.32 35-39 19.794999999999998 28.48 28.060000000000002 23.665 40-44 20.369999999999997 28.310000000000002 27.675 23.645 45-49 20.62 27.589999999999996 28.04 23.75 50-54 20.265 28.57 27.68 23.485 55-59 20.244999999999997 28.694999999999997 27.705000000000002 23.355 60-64 20.335 28.17 27.38 24.115000000000002 65-69 21.14 27.744999999999997 27.74 23.375 70-74 20.65 28.249999999999996 27.92 23.18 75-79 20.75 27.99 27.894999999999996 23.365 80-84 20.685000000000002 28.185 27.650000000000002 23.48 85-89 20.855 28.1 27.334999999999997 23.71 90-94 20.985 28.310000000000002 27.334999999999997 23.369999999999997 95-99 20.97 27.794999999999998 27.994999999999997 23.24 100-104 20.555 27.755000000000003 28.044999999999998 23.645 105-109 20.565 27.96 28.165000000000003 23.31 110-114 20.955 28.17 27.525 23.35 115-119 21.12 28.28 27.065 23.535 120-124 21.065 27.905 27.36 23.669999999999998 125-129 21.365000000000002 27.675 27.310000000000002 23.65 130-134 20.79 27.560000000000002 27.96 23.69 135-139 20.895 27.794999999999998 27.6 23.71 140-144 21.085 28.065 27.185 23.665 145-149 20.785 28.275 27.52 23.419999999999998 150-151 20.599999999999998 28.4125 26.5875 24.4 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 1.5 24 1.0 25 3.0 26 5.0 27 7.0 28 10.0 29 12.0 30 14.0 31 19.0 32 31.0 33 42.0 34 49.0 35 65.5 36 95.5 37 115.0 38 125.5 39 141.0 40 174.0 41 213.0 42 240.5 43 263.5 44 289.0 45 307.5 46 273.5 47 242.0 48 231.0 49 208.0 50 193.0 51 157.5 52 117.5 53 93.0 54 65.0 55 44.5 56 34.5 57 32.5 58 25.0 59 15.5 60 11.5 61 7.5 62 6.0 63 5.5 64 4.0 65 2.0 66 1.0 67 0.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77443609022556 99.52499999999999 2 0.20050125313283207 0.4 3 0.02506265664160401 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.475 0.0 0.0 0.0 0.0 114-115 0.5375 0.0 0.0 0.0 0.0 116-117 0.65 0.0 0.0 0.0 0.0 118-119 0.7124999999999999 0.0 0.0 0.0 0.0 120-121 0.775 0.0 0.0 0.0 0.0 122-123 0.875 0.0 0.0 0.0 0.0 124-125 0.975 0.0 0.0 0.0 0.0 126-127 1.1875 0.0 0.0 0.0 0.0 128-129 1.3625 0.0 0.0 0.0 0.0 130-131 1.4875 0.0 0.0 0.0 0.0 132-133 1.7125 0.0 0.0 0.0 0.0 134-135 1.85 0.0 0.0 0.0 0.0 136-137 2.0375 0.0 0.0 0.0 0.0 138-139 2.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171943 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171943_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.11475 34.0 33.0 34.0 32.0 34.0 2 33.14475 34.0 33.0 34.0 32.0 34.0 3 33.1565 34.0 33.0 34.0 33.0 34.0 4 33.12075 34.0 33.0 34.0 33.0 34.0 5 33.199 34.0 33.0 34.0 33.0 34.0 6 37.35325 38.0 38.0 38.0 37.0 38.0 7 37.33275 38.0 38.0 38.0 37.0 38.0 8 37.3865 38.0 38.0 38.0 38.0 38.0 9 37.252 38.0 38.0 38.0 37.0 38.0 10-14 37.372249999999994 38.0 38.0 38.0 37.6 38.0 15-19 37.29185 38.0 38.0 38.0 37.0 38.0 20-24 37.2879 38.0 38.0 38.0 37.2 38.0 25-29 37.266549999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.25605 38.0 38.0 38.0 37.2 38.0 35-39 37.19735 38.0 38.0 38.0 37.0 38.0 40-44 36.979099999999995 38.0 38.0 38.0 37.0 38.0 45-49 37.15725 38.0 38.0 38.0 37.0 38.0 50-54 37.15795 38.0 38.0 38.0 37.0 38.0 55-59 37.12335 38.0 38.0 38.0 37.0 38.0 60-64 37.04825 38.0 38.0 38.0 36.2 38.0 65-69 36.9918 38.0 38.0 38.0 36.0 38.0 70-74 36.92020000000001 38.0 38.0 38.0 36.0 38.0 75-79 36.86265 38.0 38.0 38.0 36.0 38.0 80-84 36.8493 38.0 38.0 38.0 36.0 38.0 85-89 36.704899999999995 38.0 38.0 38.0 35.6 38.0 90-94 36.56035 38.0 38.0 38.0 34.6 38.0 95-99 36.43095 38.0 38.0 38.0 34.4 38.0 100-104 36.35765 38.0 38.0 38.0 34.0 38.0 105-109 36.1173 38.0 37.8 38.0 33.4 38.0 110-114 36.0945 38.0 38.0 38.0 33.2 38.0 115-119 35.9245 38.0 37.2 38.0 33.0 38.0 120-124 35.836 38.0 37.2 38.0 32.8 38.0 125-129 35.662800000000004 38.0 36.4 38.0 31.4 38.0 130-134 35.16695 38.0 36.0 38.0 29.2 38.0 135-139 34.9202 38.0 35.6 38.0 28.0 38.0 140-144 34.697199999999995 38.0 35.0 38.0 27.8 38.0 145-149 34.07505 38.0 35.0 38.0 25.0 38.0 150-151 30.377 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 3.0 4 2.0 5 3.0 6 2.0 7 0.0 8 2.0 9 0.0 10 2.0 11 1.0 12 0.0 13 1.0 14 4.0 15 1.0 16 2.0 17 1.0 18 5.0 19 3.0 20 3.0 21 8.0 22 11.0 23 11.0 24 8.0 25 15.0 26 12.0 27 19.0 28 16.0 29 35.0 30 38.0 31 43.0 32 53.0 33 68.0 34 125.0 35 226.0 36 646.0 37 2628.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.824999999999996 16.475 17.05 27.650000000000002 2 24.5 24.9 32.7 17.9 3 21.075 27.700000000000003 30.95 20.275000000000002 4 23.974999999999998 34.050000000000004 21.675 20.3 5 21.975 36.525 22.3 19.2 6 18.55 36.449999999999996 23.9 21.099999999999998 7 18.675 18.3 41.325 21.7 8 21.15 23.45 26.724999999999998 28.675 9 21.475 25.85 27.825 24.85 10-14 22.735 28.549999999999997 26.51 22.205 15-19 22.41 28.494999999999997 27.605 21.490000000000002 20-24 22.705000000000002 28.439999999999998 27.35 21.505 25-29 22.61 29.24 27.025 21.125 30-34 22.625 28.7 27.495000000000005 21.18 35-39 23.466733366683343 27.86893446723362 27.408704352176088 21.25562781390695 40-44 22.789507999398165 28.30633431967501 27.48382566828828 21.42033201263855 45-49 22.6 27.884999999999998 28.15 21.365000000000002 50-54 22.61 28.044999999999998 28.07 21.275 55-59 23.39 28.055000000000003 27.47 21.085 60-64 23.085 27.834999999999997 27.935 21.145 65-69 23.1 28.199999999999996 28.115000000000002 20.585 70-74 23.375 27.875 27.66 21.09 75-79 23.765 27.694999999999997 27.775 20.765 80-84 23.64 28.084999999999997 27.029999999999998 21.245 85-89 24.095 28.199999999999996 26.865 20.84 90-94 23.34 27.944999999999997 27.365000000000002 21.349999999999998 95-99 24.11 28.38 27.0 20.51 100-104 24.085 28.93 26.375 20.61 105-109 23.65 27.515 27.694999999999997 21.14 110-114 23.674999999999997 27.91 27.544999999999998 20.87 115-119 23.445 27.644999999999996 28.22 20.69 120-124 23.175 28.01 28.33 20.485 125-129 24.385 27.985 27.465 20.165 130-134 24.215 27.794999999999998 27.505000000000003 20.485 135-139 24.005000000000003 28.395 26.650000000000002 20.95 140-144 24.435000000000002 27.165 27.79 20.61 145-149 23.945 28.015 27.26 20.78 150-151 24.6625 28.625 26.987499999999997 19.725 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 1.0 22 0.0 23 0.0 24 0.0 25 0.5 26 2.0 27 3.5 28 3.0 29 2.0 30 4.0 31 9.0 32 13.0 33 22.5 34 36.5 35 53.0 36 79.5 37 105.0 38 124.5 39 156.0 40 201.0 41 237.5 42 264.5 43 289.5 44 295.0 45 294.0 46 296.0 47 280.5 48 244.5 49 196.5 50 174.0 51 156.0 52 119.0 53 94.0 54 66.5 55 42.0 56 37.0 57 27.5 58 19.0 59 12.0 60 5.0 61 6.5 62 7.5 63 5.0 64 2.0 65 2.5 66 2.0 67 1.5 68 1.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.05 40-44 0.305 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67320261437908 99.125 2 0.2765208647561589 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.025138260432378077 0.15 7 0.025138260432378077 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCT 7 0.17500000000000002 No Hit GCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.3 0.0 0.0 0.0 0.0 108-109 0.3875 0.0 0.0 0.0 0.0 110-111 0.45 0.0 0.0 0.0 0.0 112-113 0.5125 0.0 0.0 0.0 0.0 114-115 0.5625 0.0 0.0 0.0 0.0 116-117 0.6875 0.0 0.0 0.0 0.0 118-119 0.7625 0.0 0.0 0.0 0.0 120-121 0.8375 0.0 0.0 0.0 0.0 122-123 0.975 0.0 0.0 0.0 0.0 124-125 1.0750000000000002 0.0 0.0 0.0 0.0 126-127 1.2875 0.0 0.0 0.0 0.0 128-129 1.4875 0.0 0.0 0.0 0.0 130-131 1.6125 0.0 0.0 0.0 0.0 132-133 1.8624999999999998 0.0 0.0 0.0 0.0 134-135 2.0250000000000004 0.0 0.0 0.0 0.0 136-137 2.2125 0.0 0.0 0.0 0.0 138-139 2.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGAGTA 10 0.006830828 145.0 3 TGAGAGT 10 0.006830828 145.0 2 >>END_MODULE Read 822475 spots for SRR7171943.sra Written 822475 spots for SRR7171943.sra Read 822475 spots for SRR7171943.sra Written 822475 spots for SRR7171943.sra Read 822475 spots for SRR7171943.sra Written 822475 spots for SRR7171943.sra Read 822475 spots for SRR7171943.sra Written 822475 spots for SRR7171943.sra Read 822475 spots for SRR7171943.sra Written 822475 spots for SRR7171943.sra Read 822475 spots for SRR7171943.sra Written 822475 spots for SRR7171943.sra Read 822475 spots for SRR7171943.sra Written 822475 spots for SRR7171943.sra Read 822475 spots for SRR7171943.sra Written 822475 spots for SRR7171943.sra Read 822475 spots for SRR7171943.sra Written 822475 spots for SRR7171943.sra Read 822475 spots for SRR7171943.sra Written 822475 spots for SRR7171943.sra Read 822475 spots for SRR7171943.sra Written 822475 spots for SRR7171943.sra Read 822475 spots for SRR7171943.sra Written 822475 spots for SRR7171943.sra Read 822475 spots for SRR7171943.sra Written 822475 spots for SRR7171943.sra Read 822475 spots for SRR7171943.sra Written 822475 spots for SRR7171943.sra Read 822475 spots for SRR7171943.sra Written 822475 spots for SRR7171943.sra Read 822488 spots for SRR7171943.sra Written 822488 spots for SRR7171943.sra Read 822475 spots for SRR7171943.sra Written 822475 spots for SRR7171943.sra Read 822475 spots for SRR7171943.sra Written 822475 spots for SRR7171943.sra Read 822475 spots for SRR7171943.sra Written 822475 spots for SRR7171943.sra Read 822475 spots for SRR7171943.sra Written 822475 spots for SRR7171943.sra SRR ids: ['SRR7171943.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r4e_7ao0 SRR7171943.sra spots: 16449513 blocks: [[1, 822475], [822476, 1644950], [1644951, 2467425], [2467426, 3289900], [3289901, 4112375], [4112376, 4934850], [4934851, 5757325], [5757326, 6579800], [6579801, 7402275], [7402276, 8224750], [8224751, 9047225], [9047226, 9869700], [9869701, 10692175], [10692176, 11514650], [11514651, 12337125], [12337126, 13159600], [13159601, 13982075], [13982076, 14804550], [14804551, 15627025], [15627026, 16449513]] SRR7171943 file size 5552499 SRR7171943 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171943 SRR7171943_1.fastq SRR7171943_2.fastq Input file: SRR7171943_1.fastq Paired file: SRR7171943_2.fastq trimmed: SRR7171943-trimmed-pair1.fastq, SRR7171943-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 03:02:48 2025 >> started Fri Feb 14 03:03:07 2025 >> done (18.933s) 16449513 read pairs processed; of these: 12857 ( 0.08%) short read pairs filtered out after trimming by size control 8796 ( 0.05%) empty read pairs filtered out after trimming by size control 16427860 (99.87%) read pairs available; of these: 6191689 (37.69%) trimmed read pairs available after processing 10236171 (62.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 0 0.00% 20 4 0.00% 21 3 0.00% 22 0 0.00% 23 6 0.00% 24 8 0.00% 25 5 0.00% 26 1 0.00% 27 5 0.00% 28 3 0.00% 29 2 0.00% 30 1 0.00% 31 5 0.00% 32 5 0.00% 33 1 0.00% 34 7 0.00% 35 5 0.00% 36 5 0.00% 37 3 0.00% 38 6 0.00% 39 3 0.00% 40 10 0.00% 41 6 0.00% 42 5 0.00% 43 4 0.00% 44 11 0.00% 45 5 0.00% 46 7 0.00% 47 12 0.00% 48 7 0.00% 49 16 0.00% 50 12 0.00% 51 14 0.00% 52 26 0.00% 53 19 0.00% 54 31 0.00% 55 20 0.00% 56 29 0.00% 57 36 0.00% 58 40 0.00% 59 39 0.00% 60 48 0.00% 61 58 0.00% 62 61 0.00% 63 60 0.00% 64 72 0.00% 65 98 0.00% 66 111 0.00% 67 130 0.00% 68 133 0.00% 69 140 0.00% 70 146 0.00% 71 164 0.00% 72 242 0.00% 73 258 0.00% 74 278 0.00% 75 310 0.00% 76 374 0.00% 77 426 0.00% 78 465 0.00% 79 549 0.00% 80 619 0.00% 81 718 0.00% 82 815 0.00% 83 934 0.01% 84 1675 0.01% 85 2003 0.01% 86 2209 0.01% 87 2470 0.02% 88 2656 0.02% 89 2690 0.02% 90 2820 0.02% 91 3026 0.02% 92 3186 0.02% 93 3386 0.02% 94 3602 0.02% 95 3827 0.02% 96 3977 0.02% 97 4312 0.03% 98 4513 0.03% 99 4906 0.03% 100 5229 0.03% 101 5670 0.03% 102 6059 0.04% 103 6458 0.04% 104 6774 0.04% 105 7231 0.04% 106 7727 0.05% 107 8184 0.05% 108 8653 0.05% 109 9236 0.06% 110 9538 0.06% 111 10282 0.06% 112 10762 0.07% 113 11475 0.07% 114 12305 0.07% 115 13062 0.08% 116 13723 0.08% 117 14417 0.09% 118 14868 0.09% 119 15806 0.10% 120 16426 0.10% 121 17201 0.10% 122 18366 0.11% 123 19211 0.12% 124 20463 0.12% 125 21421 0.13% 126 22469 0.14% 127 23448 0.14% 128 24748 0.15% 129 26395 0.16% 130 27788 0.17% 131 29047 0.18% 132 31077 0.19% 133 33447 0.20% 134 35809 0.22% 135 37874 0.23% 136 40974 0.25% 137 43954 0.27% 138 46867 0.29% 139 51360 0.31% 140 55274 0.34% 141 61854 0.38% 142 69017 0.42% 143 79403 0.48% 144 92766 0.56% 145 112127 0.68% 146 143261 0.87% 147 196680 1.20% 148 314677 1.92% 149 654734 3.99% 150 3567195 21.71% 151 10236171 62.31% 16427860 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=3.81 fanout-score-rank=26 prefix-density=0.43 prefix-fanout=3.2 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.06 sequence-density-rank=35 fanout-score=70.74 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=14.8 sequence=TTCTTGATAAAGTCACGATGTCCAGGGGCATCAATGACAGTGCAGTAGTACCTGGTGGTCTCAAACTTCCACAGGGCAATATCAATGGTAATTCCACGCTCGCGCTCAGCCTTGAGCTTGTCGAGCACCCAGGCATACTTGAATGACCTCTTGTTCATCTCAGCAGCTTCCTTCTCGAACCTCTCAATGACACGCTT criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=4.07 fanout-score-rank=22 prefix-density=0.52 prefix-fanout=3.3 sequence=TGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.14 sequence-density-rank=14 fanout-score=16.70 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=7.2 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7171943 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 03:03:57 Started mapping on | Feb 14 03:03:57 Finished on | Feb 14 03:05:51 Mapping speed, Million of reads per hour | 518.77 Number of input reads | 16427860 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 15399713 Uniquely mapped reads % | 93.74% Average mapped length | 297.27 Number of splices: Total | 16029466 Number of splices: Annotated (sjdb) | 15769110 Number of splices: GT/AG | 15778547 Number of splices: GC/AG | 200195 Number of splices: AT/AC | 11750 Number of splices: Non-canonical | 38974 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.45 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 407442 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 43805 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.46% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 634627 634627 634627 N_multimapping 407442 407442 407442 N_noFeature 318636 15252480 390188 N_ambiguous 153696 1317 77024 UnstrandedReadsAssigned:14927381 PositiveStrandReadsAssigned:145916 NegativeStrandReadsAssigned:14932501 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171943 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171943-trimmed-pair1.fastq SRR7171943-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,427,860 reads, 14,752,361 reads pseudoaligned [quant] estimated average fragment length: 265.105 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,053 rounds 52401 SRR7171943.ke.tsv 34699 SRR7171943.se.tsv 87100 total ==> SRR7171943.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1753.9 988.496 34.3644 Potri.005G024800.1.v4.1 1035 770.895 154 12.1805 Potri.004G059700.1.v4.1 961 696.913 13 1.13737 Potri.007G009000.2.v4.1 1416 1151.9 0 0 Potri.003G141000.2.v4.1 2943 2678.9 471 10.7202 Potri.016G087400.1.v4.1 270 66.7204 966.087 882.868 Potri.015G069301.1.v4.1 564 304.684 0 0 Potri.010G195200.1.v4.1 1773 1508.9 250 10.1023 Potri.012G127500.1.v4.1 977 712.895 4433 379.149 ==> SRR7171943.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 61 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 360 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 402 SRR7171943 completed mapping pipeline successfully