Starting /dee2/code/volunteer_pipeline.sh SRR7172072 current disk space = 3088012689408 free memory = 1446388472 SRR7172072 SRAfilesize efa27c2fbe14fa2e1228c55b7c96c243 SRR7172072.sra SRR7172072.sra file validated SRR7172072 is paired end SRR7172072 is conventional basespace SRR7172072 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172072_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.305 33.0 33.0 34.0 32.0 34.0 2 32.88525 34.0 33.0 34.0 31.0 34.0 3 32.02575 33.0 32.0 33.0 30.0 34.0 4 32.45825 33.0 33.0 33.0 32.0 34.0 5 32.881 33.0 33.0 33.0 32.0 34.0 6 36.8565 38.0 37.0 38.0 35.0 38.0 7 37.423 38.0 38.0 38.0 37.0 38.0 8 37.59925 38.0 38.0 38.0 37.0 38.0 9 37.62875 38.0 38.0 38.0 38.0 38.0 10-14 37.64684999999999 38.0 38.0 38.0 38.0 38.0 15-19 37.69665 38.0 38.0 38.0 38.0 38.0 20-24 37.6648 38.0 38.0 38.0 38.0 38.0 25-29 37.648 38.0 38.0 38.0 38.0 38.0 30-34 37.6162 38.0 38.0 38.0 38.0 38.0 35-39 37.60055 38.0 38.0 38.0 38.0 38.0 40-44 37.5566 38.0 38.0 38.0 38.0 38.0 45-49 37.52005 38.0 38.0 38.0 37.4 38.0 50-54 37.45195 38.0 38.0 38.0 37.0 38.0 55-59 37.358399999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.342349999999996 38.0 38.0 38.0 37.0 38.0 65-69 37.248799999999996 38.0 38.0 38.0 36.4 38.0 70-74 37.21355 38.0 38.0 38.0 36.2 38.0 75-79 37.17875 38.0 38.0 38.0 36.0 38.0 80-84 37.123000000000005 38.0 38.0 38.0 36.0 38.0 85-89 36.9867 38.0 38.0 38.0 36.0 38.0 90-94 36.830349999999996 38.0 38.0 38.0 35.0 38.0 95-99 36.741699999999994 38.0 38.0 38.0 34.8 38.0 100-104 36.6214 38.0 38.0 38.0 34.2 38.0 105-109 36.397800000000004 38.0 37.6 38.0 33.8 38.0 110-114 36.3278 38.0 37.6 38.0 33.8 38.0 115-119 36.12595 38.0 37.0 38.0 33.4 38.0 120-124 36.007999999999996 38.0 37.0 38.0 33.0 38.0 125-129 35.82315 38.0 36.6 38.0 32.4 38.0 130-134 35.4822 38.0 36.0 38.0 30.4 38.0 135-139 34.9934 38.0 35.2 38.0 28.2 38.0 140-144 34.80309999999999 38.0 35.2 38.0 27.8 38.0 145-149 34.2067 38.0 35.0 38.0 25.8 38.0 150-151 30.7945 36.5 30.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 1.0 18 2.0 19 2.0 20 5.0 21 2.0 22 6.0 23 4.0 24 11.0 25 10.0 26 6.0 27 15.0 28 18.0 29 11.0 30 24.0 31 47.0 32 41.0 33 82.0 34 144.0 35 274.0 36 768.0 37 2524.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.108764519535377 17.344244984160508 16.050686378035902 40.49630411826822 2 18.929732433108278 23.980995248812203 39.38484621155289 17.704426106526633 3 18.85 29.475 26.525 25.15 4 21.0 36.85 20.724999999999998 21.425 5 19.950000000000003 37.175000000000004 24.075 18.8 6 16.325 36.5 25.45 21.725 7 12.775 20.95 45.925 20.349999999999998 8 19.15 20.225 30.275000000000002 30.349999999999998 9 18.3 22.35 32.0 27.35 10-14 19.400000000000002 30.18 26.715 23.705000000000002 15-19 19.945 28.82 28.035 23.200000000000003 20-24 19.650000000000002 29.235 27.985 23.13 25-29 19.81 29.134999999999998 28.000000000000004 23.055 30-34 19.765 28.77 28.34 23.125 35-39 19.54 29.270000000000003 27.744999999999997 23.445 40-44 19.89 29.29 27.21 23.61 45-49 20.4 29.145 27.405 23.05 50-54 20.169999999999998 28.365000000000002 27.565 23.9 55-59 20.11 28.78 28.025 23.085 60-64 19.575 28.939999999999998 27.939999999999998 23.544999999999998 65-69 20.4 28.725 27.43 23.445 70-74 20.43 28.33 27.955000000000002 23.285 75-79 20.21 28.63 27.665 23.494999999999997 80-84 20.115 28.525 27.889999999999997 23.47 85-89 20.285 28.575 27.560000000000002 23.580000000000002 90-94 20.4 28.144999999999996 27.445000000000004 24.01 95-99 20.165 28.255000000000003 27.950000000000003 23.630000000000003 100-104 20.255000000000003 29.049999999999997 27.73 22.965 105-109 20.435 29.21 27.065 23.29 110-114 20.415 28.84 27.175 23.57 115-119 20.345 29.275000000000002 27.115000000000002 23.265 120-124 20.549999999999997 28.705000000000002 27.79 22.955000000000002 125-129 21.01 28.425 27.18 23.385 130-134 21.105 28.57 27.35 22.975 135-139 20.560000000000002 28.494999999999997 27.084999999999997 23.86 140-144 20.925 28.895 27.305 22.875 145-149 20.66 28.9 27.005000000000003 23.435 150-151 21.15 27.675 27.0875 24.087500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 1.0 21 0.0 22 1.0 23 2.0 24 2.0 25 2.0 26 4.5 27 7.5 28 10.0 29 15.5 30 22.0 31 31.5 32 42.5 33 53.0 34 65.5 35 77.5 36 104.5 37 134.5 38 153.0 39 179.0 40 193.5 41 223.0 42 252.0 43 259.5 44 268.5 45 273.5 46 267.5 47 239.5 48 221.0 49 184.0 50 145.0 51 128.5 52 106.0 53 79.5 54 64.5 55 56.5 56 37.0 57 19.5 58 11.5 59 11.0 60 11.0 61 11.0 62 7.0 63 4.0 64 4.0 65 2.5 66 1.5 67 0.5 68 1.5 69 1.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.3 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.8125 0.0 0.0 0.0 0.0 110-111 0.925 0.0 0.0 0.0 0.0 112-113 1.0875 0.0 0.0 0.0 0.0 114-115 1.275 0.0 0.0 0.0 0.0 116-117 1.375 0.0 0.0 0.0 0.0 118-119 1.475 0.0 0.0 0.0 0.0 120-121 1.6124999999999998 0.0 0.0 0.0 0.0 122-123 1.9125 0.0 0.0 0.0 0.0 124-125 2.25 0.0 0.0 0.0 0.0 126-127 2.625 0.0 0.0 0.0 0.0 128-129 2.9000000000000004 0.0 0.0 0.0 0.0 130-131 3.1125 0.0 0.0 0.0 0.0 132-133 3.35 0.0 0.0 0.0 0.0 134-135 3.575 0.0 0.0 0.0 0.0 136-137 3.9125 0.0 0.0 0.0 0.0 138-139 4.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172072 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172072_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3065 34.0 33.0 34.0 33.0 34.0 2 33.4025 34.0 33.0 34.0 33.0 34.0 3 33.38325 34.0 33.0 34.0 33.0 34.0 4 33.38275 34.0 33.0 34.0 33.0 34.0 5 33.419 34.0 33.0 34.0 33.0 34.0 6 37.55525 38.0 38.0 38.0 38.0 38.0 7 37.59175 38.0 38.0 38.0 38.0 38.0 8 37.59775 38.0 38.0 38.0 38.0 38.0 9 37.5955 38.0 38.0 38.0 38.0 38.0 10-14 37.6009 38.0 38.0 38.0 38.0 38.0 15-19 37.59095000000001 38.0 38.0 38.0 38.0 38.0 20-24 37.5207 38.0 38.0 38.0 38.0 38.0 25-29 37.525400000000005 38.0 38.0 38.0 38.0 38.0 30-34 37.479549999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.458800000000004 38.0 38.0 38.0 38.0 38.0 40-44 37.44904999999999 38.0 38.0 38.0 37.8 38.0 45-49 37.450300000000006 38.0 38.0 38.0 37.8 38.0 50-54 37.42215 38.0 38.0 38.0 37.6 38.0 55-59 37.368 38.0 38.0 38.0 37.0 38.0 60-64 37.26965 38.0 38.0 38.0 37.0 38.0 65-69 37.21145 38.0 38.0 38.0 37.0 38.0 70-74 37.144200000000005 38.0 38.0 38.0 36.2 38.0 75-79 37.0679 38.0 38.0 38.0 36.4 38.0 80-84 37.01915 38.0 38.0 38.0 36.0 38.0 85-89 36.88065 38.0 38.0 38.0 35.8 38.0 90-94 36.830499999999994 38.0 38.0 38.0 35.6 38.0 95-99 36.76715 38.0 38.0 38.0 35.0 38.0 100-104 36.7244 38.0 38.0 38.0 35.0 38.0 105-109 36.56825 38.0 38.0 38.0 34.6 38.0 110-114 36.30970000000001 38.0 38.0 38.0 34.0 38.0 115-119 36.205200000000005 38.0 37.6 38.0 34.0 38.0 120-124 35.995400000000004 38.0 37.2 38.0 33.2 38.0 125-129 35.6348 38.0 36.6 38.0 31.0 38.0 130-134 35.34910000000001 38.0 36.0 38.0 30.6 38.0 135-139 35.1108 38.0 36.0 38.0 29.0 38.0 140-144 34.78535 38.0 35.2 38.0 28.0 38.0 145-149 34.058350000000004 38.0 34.4 38.0 25.4 38.0 150-151 30.313625000000002 36.0 29.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 2.0 11 0.0 12 1.0 13 1.0 14 1.0 15 1.0 16 1.0 17 5.0 18 2.0 19 4.0 20 2.0 21 7.0 22 6.0 23 6.0 24 6.0 25 9.0 26 9.0 27 18.0 28 14.0 29 24.0 30 35.0 31 35.0 32 47.0 33 76.0 34 131.0 35 214.0 36 627.0 37 2712.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.775 12.950000000000001 19.425 35.85 2 23.175 21.099999999999998 38.7 17.025000000000002 3 19.75 25.275 31.85 23.125 4 23.400000000000002 33.425 22.225 20.95 5 22.6 36.975 23.125 17.299999999999997 6 16.35 38.35 25.2 20.1 7 15.55 15.35 46.7 22.400000000000002 8 18.45 22.075 29.025000000000002 30.45 9 22.6 22.8 29.45 25.15 10-14 22.535 28.860000000000003 26.825 21.78 15-19 22.470000000000002 28.03 28.105000000000004 21.395 20-24 22.869999999999997 27.810000000000002 27.965 21.355 25-29 22.17 28.435 27.800000000000004 21.595 30-34 22.59 27.97 28.425 21.015 35-39 22.264999999999997 28.065 28.73 20.94 40-44 22.79 28.275 28.035 20.9 45-49 22.85 27.189999999999998 28.845 21.115000000000002 50-54 22.535 27.88 28.64 20.945 55-59 22.685 27.834999999999997 28.125 21.355 60-64 23.54 28.384999999999998 27.38 20.695 65-69 23.169999999999998 27.800000000000004 28.050000000000004 20.979999999999997 70-74 22.945 28.415000000000003 28.355000000000004 20.285 75-79 23.23 28.28 28.04 20.45 80-84 23.085 28.02 28.044999999999998 20.849999999999998 85-89 23.27 28.125 28.09 20.515 90-94 23.34 28.194999999999997 27.825 20.64 95-99 23.380000000000003 27.894999999999996 28.34 20.385 100-104 23.14 27.715 28.59 20.555 105-109 23.66 28.1 27.655 20.585 110-114 23.03 27.97 28.48 20.52 115-119 23.599999999999998 27.675 28.139999999999997 20.585 120-124 22.695 28.22 28.275 20.810000000000002 125-129 24.115000000000002 27.495000000000005 28.205000000000002 20.185 130-134 23.630000000000003 27.839999999999996 28.225 20.305 135-139 23.75 27.57 28.83 19.85 140-144 24.415 27.55 28.015 20.02 145-149 24.19 27.765 28.325 19.72 150-151 24.1875 27.537499999999998 27.712500000000002 20.5625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 1.5 23 1.5 24 1.0 25 2.5 26 5.0 27 5.0 28 9.5 29 14.0 30 17.5 31 22.5 32 25.0 33 27.0 34 38.5 35 67.0 36 87.5 37 102.0 38 136.5 39 180.5 40 214.0 41 234.5 42 280.5 43 305.5 44 284.5 45 263.0 46 260.5 47 261.0 48 219.5 49 181.5 50 169.0 51 134.5 52 95.0 53 86.5 54 70.5 55 46.5 56 32.0 57 24.5 58 23.5 59 18.0 60 12.5 61 7.5 62 7.0 63 7.0 64 5.0 65 2.5 66 0.5 67 2.5 68 2.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72410333584149 99.4 2 0.2508151492350138 0.5 3 0.0 0.0 4 0.025081514923501375 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.6625 0.0 0.0 0.0 0.0 108-109 0.8125 0.0 0.0 0.0 0.0 110-111 0.95 0.0 0.0 0.0 0.0 112-113 1.1125 0.0 0.0 0.0 0.0 114-115 1.2999999999999998 0.0 0.0 0.0 0.0 116-117 1.4375 0.0 0.0 0.0 0.0 118-119 1.5499999999999998 0.0 0.0 0.0 0.0 120-121 1.6875 0.0 0.0 0.0 0.0 122-123 1.9625000000000001 0.0 0.0 0.0 0.0 124-125 2.3 0.0 0.0 0.0 0.0 126-127 2.675 0.0 0.0 0.0 0.0 128-129 2.975 0.0 0.0 0.0 0.0 130-131 3.2125 0.0 0.0 0.0 0.0 132-133 3.45 0.0 0.0 0.0 0.0 134-135 3.6625 0.0 0.0 0.0 0.0 136-137 3.9875 0.0 0.0 0.0 0.0 138-139 4.362500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAATAG 10 0.006830828 145.0 8 >>END_MODULE Read 467474 spots for SRR7172072.sra Written 467474 spots for SRR7172072.sra Read 467474 spots for SRR7172072.sra Written 467474 spots for SRR7172072.sra Read 467474 spots for SRR7172072.sra Written 467474 spots for SRR7172072.sra Read 467474 spots for SRR7172072.sra Written 467474 spots for SRR7172072.sra Read 467474 spots for SRR7172072.sra Written 467474 spots for SRR7172072.sra Read 467474 spots for SRR7172072.sra Written 467474 spots for SRR7172072.sra Read 467474 spots for SRR7172072.sra Written 467474 spots for SRR7172072.sra Read 467474 spots for SRR7172072.sra Written 467474 spots for SRR7172072.sra Read 467474 spots for SRR7172072.sra Written 467474 spots for SRR7172072.sra Read 467474 spots for SRR7172072.sra Written 467474 spots for SRR7172072.sra Read 467474 spots for SRR7172072.sra Written 467474 spots for SRR7172072.sra Read 467474 spots for SRR7172072.sra Written 467474 spots for SRR7172072.sra Read 467474 spots for SRR7172072.sra Written 467474 spots for SRR7172072.sra Read 467474 spots for SRR7172072.sra Written 467474 spots for SRR7172072.sra Read 467491 spots for SRR7172072.sra Written 467491 spots for SRR7172072.sra Read 467474 spots for SRR7172072.sra Written 467474 spots for SRR7172072.sra Read 467474 spots for SRR7172072.sra Written 467474 spots for SRR7172072.sra Read 467474 spots for SRR7172072.sra Written 467474 spots for SRR7172072.sra Read 467474 spots for SRR7172072.sra Written 467474 spots for SRR7172072.sra Read 467474 spots for SRR7172072.sra Written 467474 spots for SRR7172072.sra SRR ids: ['SRR7172072.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bvzr_rbw SRR7172072.sra spots: 9349497 blocks: [[1, 467474], [467475, 934948], [934949, 1402422], [1402423, 1869896], [1869897, 2337370], [2337371, 2804844], [2804845, 3272318], [3272319, 3739792], [3739793, 4207266], [4207267, 4674740], [4674741, 5142214], [5142215, 5609688], [5609689, 6077162], [6077163, 6544636], [6544637, 7012110], [7012111, 7479584], [7479585, 7947058], [7947059, 8414532], [8414533, 8882006], [8882007, 9349497]] SRR7172072 file size 3147807 SRR7172072 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172072 SRR7172072_1.fastq SRR7172072_2.fastq Input file: SRR7172072_1.fastq Paired file: SRR7172072_2.fastq trimmed: SRR7172072-trimmed-pair1.fastq, SRR7172072-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 02:59:08 2025 >> started Fri Feb 14 02:59:23 2025 >> done (14.984s) 9349497 read pairs processed; of these: 2900 ( 0.03%) short read pairs filtered out after trimming by size control 2894 ( 0.03%) empty read pairs filtered out after trimming by size control 9343703 (99.94%) read pairs available; of these: 4591412 (49.14%) trimmed read pairs available after processing 4752291 (50.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 2 0.00% 21 1 0.00% 22 0 0.00% 23 3 0.00% 24 1 0.00% 25 1 0.00% 26 2 0.00% 27 0 0.00% 28 2 0.00% 29 2 0.00% 30 3 0.00% 31 2 0.00% 32 1 0.00% 33 0 0.00% 34 3 0.00% 35 1 0.00% 36 3 0.00% 37 3 0.00% 38 4 0.00% 39 4 0.00% 40 6 0.00% 41 3 0.00% 42 3 0.00% 43 4 0.00% 44 5 0.00% 45 3 0.00% 46 3 0.00% 47 8 0.00% 48 4 0.00% 49 9 0.00% 50 5 0.00% 51 17 0.00% 52 7 0.00% 53 9 0.00% 54 13 0.00% 55 15 0.00% 56 19 0.00% 57 21 0.00% 58 15 0.00% 59 26 0.00% 60 32 0.00% 61 31 0.00% 62 31 0.00% 63 35 0.00% 64 48 0.00% 65 60 0.00% 66 77 0.00% 67 71 0.00% 68 88 0.00% 69 98 0.00% 70 94 0.00% 71 120 0.00% 72 133 0.00% 73 149 0.00% 74 183 0.00% 75 227 0.00% 76 301 0.00% 77 301 0.00% 78 302 0.00% 79 367 0.00% 80 379 0.00% 81 466 0.00% 82 519 0.01% 83 600 0.01% 84 840 0.01% 85 1001 0.01% 86 1137 0.01% 87 1305 0.01% 88 1445 0.02% 89 1565 0.02% 90 1729 0.02% 91 1884 0.02% 92 2006 0.02% 93 2083 0.02% 94 2435 0.03% 95 2547 0.03% 96 2779 0.03% 97 3095 0.03% 98 3324 0.04% 99 3575 0.04% 100 3784 0.04% 101 4085 0.04% 102 4409 0.05% 103 4721 0.05% 104 5046 0.05% 105 5447 0.06% 106 5869 0.06% 107 6363 0.07% 108 6921 0.07% 109 7225 0.08% 110 7481 0.08% 111 8084 0.09% 112 8525 0.09% 113 9237 0.10% 114 9803 0.10% 115 10251 0.11% 116 10655 0.11% 117 11244 0.12% 118 11962 0.13% 119 12246 0.13% 120 13258 0.14% 121 13793 0.15% 122 14575 0.16% 123 15440 0.17% 124 16007 0.17% 125 17180 0.18% 126 18103 0.19% 127 19328 0.21% 128 20424 0.22% 129 21328 0.23% 130 22772 0.24% 131 24168 0.26% 132 25685 0.27% 133 27383 0.29% 134 29076 0.31% 135 30262 0.32% 136 32792 0.35% 137 35310 0.38% 138 37850 0.41% 139 41325 0.44% 140 45480 0.49% 141 50029 0.54% 142 56334 0.60% 143 64461 0.69% 144 76275 0.82% 145 94286 1.01% 146 122169 1.31% 147 175225 1.88% 148 286598 3.07% 149 592568 6.34% 150 2360875 25.27% 151 4752291 50.86% 9343703 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.46 fanout-score-rank=31 prefix-density=0.26 prefix-fanout=2.3 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=141.22 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=11.8 sequence=CAAAACTTGAAGAGAGGAGAAAATAAAATCAAACAGGCAGAGAAGCAGACATAAACTAGGCTAAACTGTAACTAAGCAAACACTTCACTTTTTCTTTACTGCGGACTTGGTGACCTTGGCACCAGATGGATCCTTCTTCTCAACACTCTTAATGACACCAACCGCCACGGTCTGACGCATGTCCCTCACTGCAAAACGACCAAGAGGAGGATAGGCAGAAAAGGTCTCAACAACCATAGGCTTGGTGGGAATCATCTTCACAAACCCAGCATCACCATTCTTCAAGAACTTGGGCTCCTTCTC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=28 prefix-density=0.35 prefix-fanout=2.4 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=106.14 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=14.4 sequence=TCTTCCTCTCTATAATTTTCTAGGGTTTAGCAATGTCTGCCGAGGTTGAGTACAGGTGCTTTGTTGG SRR7172072 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 03:00:09 Started mapping on | Feb 14 03:00:09 Finished on | Feb 14 03:01:53 Mapping speed, Million of reads per hour | 323.44 Number of input reads | 9343703 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 8644626 Uniquely mapped reads % | 92.52% Average mapped length | 295.88 Number of splices: Total | 8277717 Number of splices: Annotated (sjdb) | 8110597 Number of splices: GT/AG | 8136609 Number of splices: GC/AG | 111116 Number of splices: AT/AC | 6315 Number of splices: Non-canonical | 23677 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.04% Deletion average length | 2.30 Insertion rate per base | 0.03% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 252967 % of reads mapped to multiple loci | 2.71% Number of reads mapped to too many loci | 22299 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.46% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 449734 449734 449734 N_multimapping 252967 252967 252967 N_noFeature 325060 8567541 360293 N_ambiguous 91312 511 49169 UnstrandedReadsAssigned:8228254 PositiveStrandReadsAssigned:76574 NegativeStrandReadsAssigned:8235164 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172072 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172072-trimmed-pair1.fastq SRR7172072-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,343,703 reads, 8,162,872 reads pseudoaligned [quant] estimated average fragment length: 255.324 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,081 rounds 52401 SRR7172072.ke.tsv 34699 SRR7172072.se.tsv 87100 total ==> SRR7172072.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.68 1093 78.8488 Potri.005G024800.1.v4.1 1035 780.676 184 29.9875 Potri.004G059700.1.v4.1 961 706.715 10 1.80032 Potri.007G009000.2.v4.1 1416 1161.68 0 0 Potri.003G141000.2.v4.1 2943 2688.68 342.455 16.2054 Potri.016G087400.1.v4.1 270 73.9192 427.494 735.811 Potri.015G069301.1.v4.1 564 315.557 0 0 Potri.010G195200.1.v4.1 1773 1518.68 582 48.7586 Potri.012G127500.1.v4.1 977 722.699 7884 1387.98 ==> SRR7172072.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 243 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 254 SRR7172072 completed mapping pipeline successfully