Starting /dee2/code/volunteer_pipeline.sh SRR7172073 current disk space = 3088009207808 free memory = 1438059976 SRR7172073 SRAfilesize c791f4cc7c2b3a7c39168a89273f9429 SRR7172073.sra SRR7172073.sra file validated SRR7172073 is paired end SRR7172073 is conventional basespace SRR7172073 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172073_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94125 33.0 33.0 34.0 32.0 34.0 2 32.94625 34.0 33.0 34.0 31.0 34.0 3 31.99425 33.0 31.0 33.0 29.0 34.0 4 32.8285 33.0 33.0 34.0 32.0 34.0 5 32.9245 33.0 33.0 34.0 32.0 34.0 6 36.6475 38.0 37.0 38.0 34.0 38.0 7 37.181 38.0 38.0 38.0 36.0 38.0 8 37.069 38.0 38.0 38.0 36.0 38.0 9 37.4155 38.0 38.0 38.0 37.0 38.0 10-14 37.50275 38.0 38.0 38.0 37.6 38.0 15-19 37.54225 38.0 38.0 38.0 37.8 38.0 20-24 37.451350000000005 38.0 38.0 38.0 37.4 38.0 25-29 37.30475 38.0 38.0 38.0 37.0 38.0 30-34 37.02855 38.0 38.0 38.0 36.0 38.0 35-39 36.7418 38.0 37.8 38.0 34.4 38.0 40-44 36.96715 38.0 38.0 38.0 36.0 38.0 45-49 37.11815 38.0 38.0 38.0 36.2 38.0 50-54 37.2541 38.0 38.0 38.0 36.8 38.0 55-59 37.279199999999996 38.0 38.0 38.0 36.8 38.0 60-64 37.2906 38.0 38.0 38.0 37.0 38.0 65-69 37.3086 38.0 38.0 38.0 37.0 38.0 70-74 37.2025 38.0 38.0 38.0 36.4 38.0 75-79 37.06245 38.0 38.0 38.0 36.0 38.0 80-84 36.8193 38.0 38.0 38.0 35.4 38.0 85-89 36.755649999999996 38.0 38.0 38.0 34.8 38.0 90-94 36.59415 38.0 38.0 38.0 34.4 38.0 95-99 36.66725 38.0 38.0 38.0 34.6 38.0 100-104 36.6135 38.0 38.0 38.0 34.2 38.0 105-109 36.5303 38.0 38.0 38.0 34.0 38.0 110-114 36.41375 38.0 38.0 38.0 34.0 38.0 115-119 36.209199999999996 38.0 37.2 38.0 34.0 38.0 120-124 36.13275 38.0 37.2 38.0 33.4 38.0 125-129 35.7327 38.0 37.0 38.0 31.8 38.0 130-134 35.40285 38.0 36.0 38.0 31.0 38.0 135-139 35.075599999999994 38.0 35.8 38.0 30.0 38.0 140-144 34.330000000000005 38.0 34.2 38.0 26.4 38.0 145-149 33.6263 38.0 33.6 38.0 21.4 38.0 150-151 28.751375 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 3.0 18 0.0 19 2.0 20 3.0 21 2.0 22 5.0 23 6.0 24 5.0 25 13.0 26 19.0 27 19.0 28 24.0 29 34.0 30 51.0 31 60.0 32 83.0 33 96.0 34 152.0 35 283.0 36 682.0 37 2454.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.425 15.975 15.45 39.15 2 19.275000000000002 25.650000000000002 38.05 17.025000000000002 3 17.599999999999998 30.2 26.125 26.075 4 20.625 36.525 22.475 20.375 5 20.175 37.225 23.799999999999997 18.8 6 15.675 36.925000000000004 25.4 22.0 7 12.1 19.5 46.875 21.525 8 18.35 20.674999999999997 29.175 31.8 9 17.925 21.975 32.65 27.450000000000003 10-14 19.01760704281713 29.831932773109244 26.795718287314923 24.354741896758703 15-19 19.620981049052453 28.33641682084104 28.036401820091005 24.0062003100155 20-24 19.515 29.54 27.77 23.175 25-29 19.139999999999997 29.115000000000002 28.294999999999998 23.45 30-34 20.145 28.794999999999998 27.66 23.400000000000002 35-39 19.86 28.65 28.044999999999998 23.445 40-44 19.725 28.799999999999997 27.505000000000003 23.97 45-49 19.564999999999998 29.01 27.61 23.815 50-54 19.689999999999998 28.494999999999997 27.975 23.84 55-59 19.935 28.735 27.725 23.605 60-64 20.315 29.095 27.445000000000004 23.145 65-69 19.935 28.775000000000002 27.88 23.41 70-74 19.555 29.09 27.775 23.580000000000002 75-79 19.555 29.29 27.6 23.555 80-84 20.62 27.755000000000003 27.83 23.794999999999998 85-89 19.99 28.83 28.205000000000002 22.975 90-94 20.02 29.165000000000003 27.744999999999997 23.07 95-99 20.095 28.235 28.13 23.54 100-104 20.36 28.95 26.99 23.7 105-109 19.99 28.799999999999997 27.825 23.385 110-114 19.902985447817173 28.58928839325899 27.889183377506626 23.61854278141721 115-119 20.768115217282592 28.929339400910138 27.45411811771766 22.84842726408961 120-124 20.166049814944483 28.608582574772434 27.598279483845158 23.627088126437933 125-129 20.660287560743452 28.445468663894598 27.608837232603577 23.28540654275838 130-134 20.585 28.82 26.815 23.78 135-139 21.195 28.46 27.255000000000003 23.09 140-144 20.595 28.595 27.229999999999997 23.580000000000002 145-149 20.560000000000002 28.88 27.165 23.395 150-151 21.25 28.325 27.487499999999997 22.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.5 18 1.0 19 0.5 20 0.5 21 0.5 22 0.5 23 1.5 24 2.5 25 4.5 26 8.0 27 10.0 28 12.0 29 17.5 30 25.0 31 31.5 32 43.5 33 52.0 34 58.5 35 74.0 36 102.0 37 125.5 38 154.5 39 189.5 40 207.5 41 234.0 42 255.0 43 262.5 44 269.0 45 270.5 46 259.0 47 240.5 48 214.0 49 172.0 50 144.5 51 127.5 52 99.5 53 76.0 54 56.0 55 45.5 56 39.5 57 31.0 58 22.5 59 12.5 60 9.5 61 6.5 62 4.5 63 4.5 64 4.5 65 4.5 66 3.5 67 2.5 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.04 15-19 0.005 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.015 115-119 0.015 120-124 0.03 125-129 0.19499999999999998 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.475 0.0 0.0 0.0 0.0 110-111 0.6000000000000001 0.0 0.0 0.0 0.0 112-113 0.8 0.0 0.0 0.0 0.0 114-115 0.9625 0.0 0.0 0.0 0.0 116-117 1.2125 0.0 0.0 0.0 0.0 118-119 1.4125 0.0 0.0 0.0 0.0 120-121 1.575 0.0 0.0 0.0 0.0 122-123 1.875 0.0 0.0 0.0 0.0 124-125 2.175 0.0 0.0 0.0 0.0 126-127 2.425 0.0 0.0 0.0 0.0 128-129 2.7125 0.0 0.0 0.0 0.0 130-131 3.05 0.0 0.0 0.0 0.0 132-133 3.5374999999999996 0.0 0.0 0.0 0.0 134-135 3.9125 0.0 0.0 0.0 0.0 136-137 4.3125 0.0 0.0 0.0 0.0 138-139 4.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172073 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172073_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8315 33.0 33.0 34.0 32.0 34.0 2 32.983 34.0 33.0 34.0 32.0 34.0 3 33.02275 34.0 33.0 34.0 32.0 34.0 4 33.014 34.0 33.0 34.0 32.0 34.0 5 33.00425 34.0 33.0 34.0 32.0 34.0 6 37.1615 38.0 38.0 38.0 37.0 38.0 7 37.2535 38.0 38.0 38.0 37.0 38.0 8 37.27325 38.0 38.0 38.0 37.0 38.0 9 37.282 38.0 38.0 38.0 37.0 38.0 10-14 37.25435 38.0 38.0 38.0 37.0 38.0 15-19 37.1905 38.0 38.0 38.0 37.0 38.0 20-24 37.11705 38.0 38.0 38.0 37.0 38.0 25-29 37.10105 38.0 38.0 38.0 37.0 38.0 30-34 37.12785 38.0 38.0 38.0 37.0 38.0 35-39 37.0511 38.0 38.0 38.0 37.0 38.0 40-44 36.9345 38.0 38.0 38.0 36.2 38.0 45-49 37.0616 38.0 38.0 38.0 36.6 38.0 50-54 37.04655 38.0 38.0 38.0 36.4 38.0 55-59 37.04979999999999 38.0 38.0 38.0 36.4 38.0 60-64 37.0086 38.0 38.0 38.0 36.0 38.0 65-69 36.881449999999994 38.0 38.0 38.0 36.0 38.0 70-74 36.83825 38.0 38.0 38.0 36.0 38.0 75-79 36.78405 38.0 38.0 38.0 35.4 38.0 80-84 36.656549999999996 38.0 38.0 38.0 34.8 38.0 85-89 36.4086 38.0 38.0 38.0 34.0 38.0 90-94 36.21195 38.0 38.0 38.0 33.8 38.0 95-99 36.16525 38.0 38.0 38.0 33.8 38.0 100-104 36.11345 38.0 38.0 38.0 33.6 38.0 105-109 36.10835 38.0 38.0 38.0 33.8 38.0 110-114 36.0421 38.0 38.0 38.0 33.2 38.0 115-119 35.85365 38.0 37.4 38.0 32.6 38.0 120-124 35.475199999999994 38.0 37.0 38.0 31.0 38.0 125-129 35.1879 38.0 36.4 38.0 30.2 38.0 130-134 34.8959 38.0 36.0 38.0 28.8 38.0 135-139 34.33665 38.0 35.2 38.0 25.6 38.0 140-144 33.7955 38.0 33.6 38.0 22.0 38.0 145-149 32.9029 38.0 33.0 38.0 13.6 38.0 150-151 27.441499999999998 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 5.0 4 3.0 5 1.0 6 0.0 7 1.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 2.0 14 2.0 15 2.0 16 4.0 17 3.0 18 7.0 19 4.0 20 7.0 21 7.0 22 7.0 23 15.0 24 16.0 25 12.0 26 22.0 27 31.0 28 36.0 29 38.0 30 47.0 31 57.0 32 68.0 33 104.0 34 174.0 35 261.0 36 577.0 37 2483.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.846654973690804 14.206965672763719 16.411926835379603 37.53445251816587 2 22.466850137603203 23.692769577182887 37.60320240180135 16.23717788341256 3 19.914936202151615 25.31898924193145 31.873905429071804 22.892169126845133 4 24.056014003500874 34.058514628657164 21.48037009252313 20.40510127531883 5 23.50587646911728 37.43435858964741 21.880470117529384 17.179294823705927 6 17.224999999999998 38.15 23.35 21.275 7 16.67916979244811 15.303825956489122 45.66141535383846 22.355588897224308 8 19.575 21.725 29.7 28.999999999999996 9 21.425 24.775 28.475 25.324999999999996 10-14 22.490120554249412 28.32274523535591 27.05217347806513 22.13496073232955 15-19 22.354530444789113 28.22834842647721 28.2683744433882 21.148746685345472 20-24 22.644528905781154 28.32066413282657 28.525705141028208 20.509101820364073 25-29 22.2 28.68 28.285 20.835 30-34 22.17 28.005000000000003 28.999999999999996 20.825 35-39 22.42 28.549999999999997 28.349999999999998 20.68 40-44 22.869999999999997 27.805000000000003 28.33 20.995 45-49 22.470000000000002 28.17 28.694999999999997 20.665 50-54 22.27 28.325 28.34 21.065 55-59 23.064999999999998 27.750000000000004 28.384999999999998 20.8 60-64 23.105 27.815 28.349999999999998 20.73 65-69 22.895 28.12 28.585 20.4 70-74 23.46 27.815 28.035 20.69 75-79 22.925 27.595 28.63 20.849999999999998 80-84 23.405 27.465 28.265 20.865000000000002 85-89 23.65 27.439999999999998 28.785 20.125 90-94 23.28 27.944999999999997 28.73 20.044999999999998 95-99 23.051152557627884 28.296414820741038 28.081404070203508 20.571028551427574 100-104 23.25 28.105000000000004 28.405 20.24 105-109 23.3 27.595 28.835 20.27 110-114 23.5 27.825 28.04 20.635 115-119 23.235 27.85 28.4 20.515 120-124 23.845 27.43 28.435 20.29 125-129 24.104999999999997 27.815 27.975 20.105 130-134 23.77 27.62 28.305000000000003 20.305 135-139 24.33 28.53 27.715 19.425 140-144 24.46 27.639999999999997 27.88 20.02 145-149 25.259999999999998 27.605 27.85 19.285 150-151 24.5125 27.224999999999998 27.425 20.837500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.0 21 0.0 22 1.5 23 3.0 24 2.5 25 3.0 26 5.0 27 6.5 28 8.5 29 12.0 30 16.5 31 22.5 32 30.5 33 40.0 34 53.0 35 78.5 36 100.0 37 117.0 38 155.0 39 188.0 40 211.5 41 225.5 42 248.0 43 276.5 44 281.5 45 281.0 46 260.0 47 228.0 48 209.5 49 191.5 50 166.5 51 126.0 52 96.0 53 86.5 54 65.5 55 45.5 56 34.5 57 24.0 58 20.5 59 20.5 60 16.5 61 12.0 62 8.0 63 4.0 64 2.5 65 3.5 66 4.0 67 2.0 68 0.0 69 0.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.075 3 0.075 4 0.025 5 0.025 6 0.0 7 0.025 8 0.0 9 0.0 10-14 0.045 15-19 0.065 20-24 0.02 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.005 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.625 0.0 0.0 0.0 0.0 112-113 0.825 0.0 0.0 0.0 0.0 114-115 0.9875 0.0 0.0 0.0 0.0 116-117 1.225 0.0 0.0 0.0 0.0 118-119 1.4125 0.0 0.0 0.0 0.0 120-121 1.575 0.0 0.0 0.0 0.0 122-123 1.875 0.0 0.0 0.0 0.0 124-125 2.1625 0.0 0.0 0.0 0.0 126-127 2.4000000000000004 0.0 0.0 0.0 0.0 128-129 2.7 0.0 0.0 0.0 0.0 130-131 3.075 0.0 0.0 0.0 0.0 132-133 3.5625 0.0 0.0 0.0 0.0 134-135 3.9250000000000003 0.0 0.0 0.0 0.0 136-137 4.3375 0.0 0.0 0.0 0.0 138-139 4.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTGTGT 10 0.006830828 145.0 3 AAGATCT 10 0.006830828 145.0 3 CTGTGTT 10 0.006830828 145.0 4 >>END_MODULE Read 999437 spots for SRR7172073.sra Written 999437 spots for SRR7172073.sra Read 999437 spots for SRR7172073.sra Written 999437 spots for SRR7172073.sra Read 999437 spots for SRR7172073.sra Written 999437 spots for SRR7172073.sra Read 999437 spots for SRR7172073.sra Written 999437 spots for SRR7172073.sra Read 999437 spots for SRR7172073.sra Written 999437 spots for SRR7172073.sra Read 999437 spots for SRR7172073.sra Written 999437 spots for SRR7172073.sra Read 999437 spots for SRR7172073.sra Written 999437 spots for SRR7172073.sra Read 999437 spots for SRR7172073.sra Written 999437 spots for SRR7172073.sra Read 999437 spots for SRR7172073.sra Written 999437 spots for SRR7172073.sra Read 999453 spots for SRR7172073.sra Written 999453 spots for SRR7172073.sra Read 999437 spots for SRR7172073.sra Written 999437 spots for SRR7172073.sra Read 999437 spots for SRR7172073.sra Written 999437 spots for SRR7172073.sra Read 999437 spots for SRR7172073.sra Written 999437 spots for SRR7172073.sra Read 999437 spots for SRR7172073.sra Written 999437 spots for SRR7172073.sra Read 999437 spots for SRR7172073.sra Written 999437 spots for SRR7172073.sra Read 999437 spots for SRR7172073.sra Written 999437 spots for SRR7172073.sra Read 999437 spots for SRR7172073.sra Written 999437 spots for SRR7172073.sra Read 999437 spots for SRR7172073.sra Written 999437 spots for SRR7172073.sra Read 999437 spots for SRR7172073.sra Written 999437 spots for SRR7172073.sra Read 999437 spots for SRR7172073.sra Written 999437 spots for SRR7172073.sra SRR ids: ['SRR7172073.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w7e9x4ak SRR7172073.sra spots: 19988756 blocks: [[1, 999437], [999438, 1998874], [1998875, 2998311], [2998312, 3997748], [3997749, 4997185], [4997186, 5996622], [5996623, 6996059], [6996060, 7995496], [7995497, 8994933], [8994934, 9994370], [9994371, 10993807], [10993808, 11993244], [11993245, 12992681], [12992682, 13992118], [13992119, 14991555], [14991556, 15990992], [15990993, 16990429], [16990430, 17989866], [17989867, 18989303], [18989304, 19988756]] SRR7172073 file size 6751833 SRR7172073 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172073 SRR7172073_1.fastq SRR7172073_2.fastq Input file: SRR7172073_1.fastq Paired file: SRR7172073_2.fastq trimmed: SRR7172073-trimmed-pair1.fastq, SRR7172073-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 03:09:06 2025 >> started Fri Feb 14 03:09:28 2025 >> done (21.353s) 19988756 read pairs processed; of these: 11215 ( 0.06%) short read pairs filtered out after trimming by size control 11852 ( 0.06%) empty read pairs filtered out after trimming by size control 19965689 (99.88%) read pairs available; of these: 11356024 (56.88%) trimmed read pairs available after processing 8609665 (43.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 2 0.00% 21 6 0.00% 22 4 0.00% 23 3 0.00% 24 5 0.00% 25 6 0.00% 26 1 0.00% 27 4 0.00% 28 1 0.00% 29 6 0.00% 30 3 0.00% 31 5 0.00% 32 3 0.00% 33 4 0.00% 34 9 0.00% 35 6 0.00% 36 10 0.00% 37 6 0.00% 38 6 0.00% 39 7 0.00% 40 9 0.00% 41 14 0.00% 42 10 0.00% 43 12 0.00% 44 8 0.00% 45 8 0.00% 46 9 0.00% 47 17 0.00% 48 24 0.00% 49 21 0.00% 50 23 0.00% 51 23 0.00% 52 34 0.00% 53 43 0.00% 54 33 0.00% 55 55 0.00% 56 103 0.00% 57 519 0.00% 58 275 0.00% 59 212 0.00% 60 206 0.00% 61 105 0.00% 62 145 0.00% 63 167 0.00% 64 152 0.00% 65 157 0.00% 66 213 0.00% 67 299 0.00% 68 315 0.00% 69 310 0.00% 70 350 0.00% 71 350 0.00% 72 430 0.00% 73 643 0.00% 74 547 0.00% 75 727 0.00% 76 810 0.00% 77 1325 0.01% 78 1753 0.01% 79 1331 0.01% 80 1516 0.01% 81 1595 0.01% 82 1696 0.01% 83 2381 0.01% 84 4803 0.02% 85 4868 0.02% 86 4597 0.02% 87 4319 0.02% 88 4263 0.02% 89 4647 0.02% 90 4936 0.02% 91 5373 0.03% 92 5743 0.03% 93 6385 0.03% 94 7157 0.04% 95 7716 0.04% 96 8631 0.04% 97 9494 0.05% 98 9858 0.05% 99 10622 0.05% 100 11362 0.06% 101 12693 0.06% 102 12897 0.06% 103 13439 0.07% 104 14477 0.07% 105 15641 0.08% 106 16469 0.08% 107 17492 0.09% 108 18642 0.09% 109 19908 0.10% 110 21002 0.11% 111 22122 0.11% 112 23255 0.12% 113 24671 0.12% 114 26148 0.13% 115 28210 0.14% 116 29642 0.15% 117 31526 0.16% 118 33094 0.17% 119 34375 0.17% 120 36710 0.18% 121 38869 0.19% 122 41009 0.21% 123 43319 0.22% 124 45458 0.23% 125 48415 0.24% 126 51264 0.26% 127 54472 0.27% 128 56948 0.29% 129 59935 0.30% 130 63156 0.32% 131 65865 0.33% 132 69507 0.35% 133 74400 0.37% 134 78850 0.39% 135 84257 0.42% 136 90102 0.45% 137 96836 0.49% 138 104969 0.53% 139 114715 0.57% 140 125960 0.63% 141 139066 0.70% 142 159288 0.80% 143 178566 0.89% 144 212036 1.06% 145 257863 1.29% 146 324524 1.63% 147 437063 2.19% 148 655909 3.29% 149 1279233 6.41% 150 5717907 28.64% 151 8609665 43.12% 19965689 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=5.63 fanout-score-rank=9 prefix-density=0.60 prefix-fanout=3.3 sequence=TTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=34.25 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.5 sequence=AACTCCAGCAGGTTGATAGAAAGTACTTTACAGGGCGAGCACAGTTCATGGTCTTCACTCTTCAAGGTAAAGTATAAGCTCCACACTTGTAGCCCACAGGACGATCAGCAATGTTGCATCGTTTGGGAATGGTCATTGCAATTTCTGGCTTGATTCCAGAGCTCTTAGCAGTGTTGGAAAGCATAACAGCACAAAGGCACGCTGGGTTCTGTCCAATTTTCTTCACCCGAGCGCAGCACTGGCTCGAAACTGAAGAATTCTCATCCTGTGCTGCTGATGCACAAGGAGCCATCTTGAAAGCCTCCATGTCAGGAGTGGTGTTTTTCCCACATTCACCAGCCCCGTCAACTTGATTGA criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.65 fanout-score-rank=28 prefix-density=0.30 prefix-fanout=2.5 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=18 fanout-score=23.10 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=8.9 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7172073 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 03:10:36 Started mapping on | Feb 14 03:10:37 Finished on | Feb 14 03:13:49 Mapping speed, Million of reads per hour | 374.36 Number of input reads | 19965689 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 18334400 Uniquely mapped reads % | 91.83% Average mapped length | 294.30 Number of splices: Total | 17843384 Number of splices: Annotated (sjdb) | 17499092 Number of splices: GT/AG | 17543605 Number of splices: GC/AG | 229574 Number of splices: AT/AC | 13955 Number of splices: Non-canonical | 56250 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.04% Deletion average length | 2.23 Insertion rate per base | 0.03% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 539935 % of reads mapped to multiple loci | 2.70% Number of reads mapped to too many loci | 84054 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.88% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1103984 1103984 1103984 N_multimapping 539935 539935 539935 N_noFeature 600697 18148032 691551 N_ambiguous 194832 1191 98671 UnstrandedReadsAssigned:17538871 PositiveStrandReadsAssigned:185177 NegativeStrandReadsAssigned:17544178 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172073 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172073-trimmed-pair1.fastq SRR7172073-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,965,689 reads, 17,435,015 reads pseudoaligned [quant] estimated average fragment length: 243.693 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,046 rounds 52401 SRR7172073.ke.tsv 34699 SRR7172073.se.tsv 87100 total ==> SRR7172073.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1775.31 1548 50.107 Potri.005G024800.1.v4.1 1035 792.307 408 29.5915 Potri.004G059700.1.v4.1 961 718.318 46 3.67995 Potri.007G009000.2.v4.1 1416 1173.31 0 0 Potri.003G141000.2.v4.1 2943 2700.31 625.372 13.3084 Potri.016G087400.1.v4.1 270 76.7441 1294 968.926 Potri.015G069301.1.v4.1 564 324.874 0 0 Potri.010G195200.1.v4.1 1773 1530.31 541.79 20.3448 Potri.012G127500.1.v4.1 977 734.318 19628 1536.01 ==> SRR7172073.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 59 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 585 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 470 SRR7172073 completed mapping pipeline successfully