Starting /dee2/code/volunteer_pipeline.sh SRR7172074 current disk space = 3111453261824 free memory = 1569831488 SRR7172074 SRAfilesize 8805f5d38be7fb79afa73993e613351d SRR7172074.sra SRR7172074.sra file validated SRR7172074 is paired end SRR7172074 is conventional basespace SRR7172074 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172074_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.75725 33.0 33.0 34.0 32.0 34.0 2 32.9945 34.0 33.0 34.0 31.0 34.0 3 32.12325 33.0 32.0 33.0 31.0 34.0 4 32.5255 33.0 33.0 33.0 32.0 34.0 5 32.94825 33.0 33.0 33.0 32.0 34.0 6 36.44625 38.0 36.0 38.0 34.0 38.0 7 37.199 38.0 38.0 38.0 36.0 38.0 8 37.23725 38.0 38.0 38.0 36.0 38.0 9 37.6125 38.0 38.0 38.0 37.0 38.0 10-14 37.652499999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.61605 38.0 38.0 38.0 38.0 38.0 20-24 37.659650000000006 38.0 38.0 38.0 38.0 38.0 25-29 37.64130000000001 38.0 38.0 38.0 38.0 38.0 30-34 37.6045 38.0 38.0 38.0 38.0 38.0 35-39 37.5762 38.0 38.0 38.0 38.0 38.0 40-44 37.52945 38.0 38.0 38.0 38.0 38.0 45-49 37.537000000000006 38.0 38.0 38.0 38.0 38.0 50-54 37.4129 38.0 38.0 38.0 37.2 38.0 55-59 37.3765 38.0 38.0 38.0 37.0 38.0 60-64 37.2986 38.0 38.0 38.0 37.0 38.0 65-69 37.277300000000004 38.0 38.0 38.0 36.8 38.0 70-74 37.2043 38.0 38.0 38.0 36.2 38.0 75-79 37.0949 38.0 38.0 38.0 36.2 38.0 80-84 37.11645 38.0 38.0 38.0 36.0 38.0 85-89 36.95954999999999 38.0 38.0 38.0 36.0 38.0 90-94 36.82845 38.0 38.0 38.0 35.2 38.0 95-99 36.78075 38.0 38.0 38.0 35.2 38.0 100-104 36.592549999999996 38.0 38.0 38.0 34.6 38.0 105-109 36.39675 38.0 37.8 38.0 34.0 38.0 110-114 36.357000000000006 38.0 37.8 38.0 34.0 38.0 115-119 36.049699999999994 38.0 37.0 38.0 33.0 38.0 120-124 36.054500000000004 38.0 37.0 38.0 33.2 38.0 125-129 35.8326 38.0 37.0 38.0 32.2 38.0 130-134 35.5207 38.0 36.0 38.0 31.2 38.0 135-139 35.1357 38.0 35.8 38.0 28.4 38.0 140-144 35.09245 38.0 35.6 38.0 29.6 38.0 145-149 34.4881 38.0 35.0 38.0 27.4 38.0 150-151 30.702624999999998 36.5 29.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 2.0 9 1.0 10 0.0 11 0.0 12 2.0 13 1.0 14 2.0 15 1.0 16 1.0 17 2.0 18 2.0 19 2.0 20 1.0 21 2.0 22 4.0 23 4.0 24 8.0 25 7.0 26 7.0 27 11.0 28 18.0 29 24.0 30 16.0 31 41.0 32 44.0 33 73.0 34 122.0 35 268.0 36 795.0 37 2538.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.62814853284861 18.280965982861595 15.528434172942093 34.5624513113477 2 19.979994998749685 24.956239059764943 36.384096024006 18.67966991747937 3 17.325 32.4 27.900000000000002 22.375 4 19.650000000000002 36.5 23.474999999999998 20.375 5 20.25 36.975 23.849999999999998 18.925 6 16.7 36.075 25.724999999999998 21.5 7 12.525 20.775 46.375 20.325 8 17.625 21.775 30.15 30.45 9 18.275 21.275 32.35 28.1 10-14 19.31 29.98 27.195000000000004 23.515 15-19 19.145 29.134999999999998 27.85 23.87 20-24 18.7 28.935 28.549999999999997 23.815 25-29 19.595000000000002 29.585 27.765 23.055 30-34 19.61 29.160000000000004 27.74 23.49 35-39 19.695 29.599999999999998 27.634999999999998 23.07 40-44 19.48 29.5 27.705000000000002 23.315 45-49 20.44 29.32 27.46 22.78 50-54 20.055 29.285 27.689999999999998 22.97 55-59 20.215 29.345 27.455000000000002 22.985 60-64 19.805 29.13 27.74 23.325000000000003 65-69 20.365 29.134999999999998 27.245 23.255 70-74 20.22 29.065 27.37 23.345 75-79 20.515 29.315 27.36 22.81 80-84 20.095 28.575 27.700000000000003 23.630000000000003 85-89 19.735 29.115000000000002 27.54 23.61 90-94 19.919999999999998 28.645 28.095 23.34 95-99 20.275000000000002 29.005 27.529999999999998 23.189999999999998 100-104 20.14 29.304999999999996 27.29 23.265 105-109 20.380000000000003 28.82 27.325 23.474999999999998 110-114 20.5 28.96 27.62 22.919999999999998 115-119 20.765 29.244999999999997 26.490000000000002 23.5 120-124 20.285 29.165000000000003 27.245 23.305 125-129 20.965 28.255000000000003 27.29 23.49 130-134 21.044999999999998 29.110000000000003 26.314999999999998 23.53 135-139 21.055 29.020000000000003 26.525 23.400000000000002 140-144 21.065 28.955 27.02 22.96 145-149 20.86 29.060000000000002 26.47 23.61 150-151 21.087500000000002 28.1875 26.5125 24.212500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.5 18 1.0 19 0.0 20 1.0 21 1.0 22 1.5 23 2.5 24 1.5 25 1.0 26 5.0 27 13.0 28 13.5 29 17.5 30 31.5 31 36.0 32 47.0 33 62.5 34 72.5 35 86.5 36 108.5 37 142.5 38 175.5 39 197.5 40 206.0 41 223.5 42 256.5 43 255.0 44 259.0 45 260.5 46 228.0 47 219.0 48 212.0 49 185.0 50 143.5 51 109.5 52 95.0 53 79.5 54 60.0 55 44.0 56 32.0 57 20.5 58 14.5 59 14.0 60 12.0 61 8.0 62 7.5 63 7.5 64 4.5 65 4.0 66 3.0 67 3.5 68 4.0 69 2.5 70 1.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.7249999999999996 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5727569741141 99.05000000000001 2 0.3518471977883891 0.7000000000000001 3 0.050263885398341285 0.15 4 0.025131942699170642 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.725 0.0 0.0 0.0 0.0 106-107 1.025 0.0 0.0 0.0 0.0 108-109 1.1875 0.0 0.0 0.0 0.0 110-111 1.3375 0.0 0.0 0.0 0.0 112-113 1.5625 0.0 0.0 0.0 0.0 114-115 1.725 0.0 0.0 0.0 0.0 116-117 1.9874999999999998 0.0 0.0 0.0 0.0 118-119 2.4375 0.0 0.0 0.0 0.0 120-121 2.75 0.0 0.0 0.0 0.0 122-123 3.1125 0.0 0.0 0.0 0.0 124-125 3.5125 0.0 0.0 0.0 0.0 126-127 3.95 0.0 0.0 0.0 0.0 128-129 4.3375 0.0 0.0 0.0 0.0 130-131 4.825 0.0 0.0 0.0 0.0 132-133 5.2875 0.0 0.0 0.0 0.0 134-135 5.637499999999999 0.0 0.0 0.0 0.0 136-137 6.2875 0.0 0.0 0.0 0.0 138-139 6.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172074 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172074_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3065 34.0 33.0 34.0 33.0 34.0 2 33.417 34.0 33.0 34.0 33.0 34.0 3 33.3885 34.0 33.0 34.0 33.0 34.0 4 33.39325 34.0 33.0 34.0 33.0 34.0 5 33.399 34.0 33.0 34.0 33.0 34.0 6 37.60875 38.0 38.0 38.0 38.0 38.0 7 37.59075 38.0 38.0 38.0 38.0 38.0 8 37.56925 38.0 38.0 38.0 38.0 38.0 9 37.57525 38.0 38.0 38.0 38.0 38.0 10-14 37.5433 38.0 38.0 38.0 38.0 38.0 15-19 37.552749999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.513600000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.5038 38.0 38.0 38.0 38.0 38.0 30-34 37.464150000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.3886 38.0 38.0 38.0 38.0 38.0 40-44 37.42155 38.0 38.0 38.0 38.0 38.0 45-49 37.4077 38.0 38.0 38.0 38.0 38.0 50-54 37.3686 38.0 38.0 38.0 37.4 38.0 55-59 37.31145 38.0 38.0 38.0 37.2 38.0 60-64 37.26115 38.0 38.0 38.0 37.0 38.0 65-69 37.1805 38.0 38.0 38.0 36.8 38.0 70-74 37.15945000000001 38.0 38.0 38.0 36.8 38.0 75-79 37.02285 38.0 38.0 38.0 36.0 38.0 80-84 36.986900000000006 38.0 38.0 38.0 36.0 38.0 85-89 36.88335 38.0 38.0 38.0 35.8 38.0 90-94 36.8215 38.0 38.0 38.0 35.8 38.0 95-99 36.721500000000006 38.0 38.0 38.0 35.2 38.0 100-104 36.68055 38.0 38.0 38.0 35.0 38.0 105-109 36.61075 38.0 38.0 38.0 34.8 38.0 110-114 36.44075 38.0 38.0 38.0 34.2 38.0 115-119 36.21945 38.0 37.8 38.0 34.0 38.0 120-124 36.0745 38.0 37.8 38.0 33.8 38.0 125-129 35.8108 38.0 37.0 38.0 33.0 38.0 130-134 35.4716 38.0 36.0 38.0 31.0 38.0 135-139 35.11435 38.0 36.0 38.0 29.4 38.0 140-144 34.8154 38.0 35.2 38.0 28.0 38.0 145-149 34.192899999999995 38.0 34.2 38.0 25.8 38.0 150-151 30.286250000000003 36.0 29.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 2.0 4 1.0 5 1.0 6 0.0 7 0.0 8 4.0 9 0.0 10 1.0 11 0.0 12 2.0 13 1.0 14 1.0 15 1.0 16 0.0 17 1.0 18 5.0 19 2.0 20 5.0 21 1.0 22 3.0 23 2.0 24 12.0 25 8.0 26 8.0 27 14.0 28 19.0 29 27.0 30 31.0 31 28.0 32 47.0 33 67.0 34 112.0 35 216.0 36 627.0 37 2746.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.45 14.799999999999999 17.625 30.125 2 23.5 22.0 36.275 18.224999999999998 3 20.7 25.724999999999998 32.6 20.974999999999998 4 23.125 34.325 22.55 20.0 5 23.75 36.449999999999996 22.275 17.525 6 17.65 37.15 24.675 20.525 7 16.650000000000002 16.975 44.05 22.325 8 21.675 22.225 27.0 29.099999999999998 9 21.224999999999998 24.525 29.299999999999997 24.95 10-14 23.085 28.455000000000002 26.525 21.935 15-19 23.085 27.694999999999997 28.125 21.095 20-24 22.78 27.700000000000003 28.410000000000004 21.11 25-29 23.56 28.02 27.634999999999998 20.785 30-34 22.564999999999998 28.235 28.115000000000002 21.085 35-39 22.97 28.565 27.565 20.9 40-44 23.615 27.944999999999997 28.515 19.925 45-49 22.86 28.305000000000003 28.134999999999998 20.7 50-54 23.275000000000002 27.705000000000002 28.310000000000002 20.71 55-59 23.125 28.175 28.299999999999997 20.4 60-64 23.585 27.860000000000003 28.01 20.544999999999998 65-69 23.355 27.725 28.13 20.79 70-74 23.16 27.694999999999997 28.305000000000003 20.84 75-79 22.814999999999998 27.92 28.465 20.8 80-84 22.805 27.565 28.43 21.2 85-89 23.27 27.74 28.435 20.555 90-94 22.91 28.194999999999997 28.29 20.605 95-99 23.244999999999997 28.49 27.575 20.69 100-104 23.875 28.015 28.04 20.07 105-109 23.565 27.744999999999997 28.475 20.215 110-114 23.445 28.194999999999997 27.99 20.369999999999997 115-119 22.900000000000002 28.7 28.26 20.14 120-124 23.415 28.43 27.785 20.369999999999997 125-129 23.98 28.444999999999997 27.810000000000002 19.765 130-134 23.825 28.015 28.055000000000003 20.105 135-139 24.474999999999998 28.425 27.63 19.470000000000002 140-144 24.36 28.12 27.845 19.675 145-149 25.124999999999996 28.065 26.99 19.82 150-151 24.962500000000002 28.512500000000003 27.1625 19.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.0 22 1.5 23 2.0 24 2.0 25 3.0 26 3.5 27 2.0 28 3.0 29 10.5 30 20.5 31 24.5 32 29.5 33 40.0 34 52.5 35 73.0 36 92.5 37 105.5 38 130.5 39 163.5 40 194.5 41 224.5 42 255.0 43 280.0 44 285.0 45 281.0 46 274.0 47 255.0 48 226.5 49 198.0 50 164.0 51 126.5 52 97.5 53 77.5 54 65.5 55 55.5 56 45.0 57 33.5 58 25.0 59 20.5 60 12.5 61 8.0 62 6.5 63 6.5 64 6.0 65 3.5 66 3.0 67 1.5 68 1.5 69 1.5 70 0.0 71 0.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.03870478117885 97.875 2 0.8095117632178092 1.6 3 0.07589172780166961 0.22499999999999998 4 0.07589172780166961 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.775 0.0 0.0 0.0 0.0 106-107 1.1 0.0 0.0 0.0 0.0 108-109 1.2625 0.0 0.0 0.0 0.0 110-111 1.4125 0.0 0.0 0.0 0.0 112-113 1.65 0.0 0.0 0.0 0.0 114-115 1.775 0.0 0.0 0.0 0.0 116-117 2.0375 0.0 0.0 0.0 0.0 118-119 2.4875 0.0 0.0 0.0 0.0 120-121 2.8 0.0 0.0 0.0 0.0 122-123 3.1624999999999996 0.0 0.0 0.0 0.0 124-125 3.5374999999999996 0.0 0.0 0.0 0.0 126-127 3.9625000000000004 0.0 0.0 0.0 0.0 128-129 4.3375 0.0 0.0 0.0 0.0 130-131 4.85 0.0 0.0 0.0 0.0 132-133 5.35 0.0 0.0 0.0 0.0 134-135 5.7125 0.0 0.0 0.0 0.0 136-137 6.387499999999999 0.0 0.0 0.0 0.0 138-139 6.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCCAAT 10 0.006830828 145.0 6 GAAAATC 10 0.006830828 145.0 2 >>END_MODULE Read 420753 spots for SRR7172074.sra Written 420753 spots for SRR7172074.sra Read 420753 spots for SRR7172074.sra Written 420753 spots for SRR7172074.sra Read 420753 spots for SRR7172074.sra Written 420753 spots for SRR7172074.sra Read 420761 spots for SRR7172074.sra Written 420761 spots for SRR7172074.sra Read 420753 spots for SRR7172074.sra Written 420753 spots for SRR7172074.sra Read 420753 spots for SRR7172074.sra Written 420753 spots for SRR7172074.sra Read 420753 spots for SRR7172074.sra Written 420753 spots for SRR7172074.sra Read 420753 spots for SRR7172074.sra Written 420753 spots for SRR7172074.sra Read 420753 spots for SRR7172074.sra Written 420753 spots for SRR7172074.sra Read 420753 spots for SRR7172074.sra Written 420753 spots for SRR7172074.sra Read 420753 spots for SRR7172074.sra Written 420753 spots for SRR7172074.sra Read 420753 spots for SRR7172074.sra Written 420753 spots for SRR7172074.sra Read 420753 spots for SRR7172074.sra Written 420753 spots for SRR7172074.sra Read 420753 spots for SRR7172074.sra Written 420753 spots for SRR7172074.sra Read 420753 spots for SRR7172074.sra Written 420753 spots for SRR7172074.sra Read 420753 spots for SRR7172074.sra Written 420753 spots for SRR7172074.sra Read 420753 spots for SRR7172074.sra Written 420753 spots for SRR7172074.sra Read 420753 spots for SRR7172074.sra Written 420753 spots for SRR7172074.sra Read 420753 spots for SRR7172074.sra Written 420753 spots for SRR7172074.sra Read 420753 spots for SRR7172074.sra Written 420753 spots for SRR7172074.sra SRR ids: ['SRR7172074.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0xk074ru SRR7172074.sra spots: 8415068 blocks: [[1, 420753], [420754, 841506], [841507, 1262259], [1262260, 1683012], [1683013, 2103765], [2103766, 2524518], [2524519, 2945271], [2945272, 3366024], [3366025, 3786777], [3786778, 4207530], [4207531, 4628283], [4628284, 5049036], [5049037, 5469789], [5469790, 5890542], [5890543, 6311295], [6311296, 6732048], [6732049, 7152801], [7152802, 7573554], [7573555, 7994307], [7994308, 8415068]] SRR7172074 file size 2832985 SRR7172074 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172074 SRR7172074_1.fastq SRR7172074_2.fastq Input file: SRR7172074_1.fastq Paired file: SRR7172074_2.fastq trimmed: SRR7172074-trimmed-pair1.fastq, SRR7172074-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 17:07:31 2025 >> started Fri Feb 14 17:07:41 2025 >> done (9.846s) 8415068 read pairs processed; of these: 7139 ( 0.08%) short read pairs filtered out after trimming by size control 5009 ( 0.06%) empty read pairs filtered out after trimming by size control 8402920 (99.86%) read pairs available; of these: 4294200 (51.10%) trimmed read pairs available after processing 4108720 (48.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 0 0.00% 21 2 0.00% 22 5 0.00% 23 1 0.00% 24 3 0.00% 25 2 0.00% 26 2 0.00% 27 3 0.00% 28 4 0.00% 29 8 0.00% 30 4 0.00% 31 3 0.00% 32 5 0.00% 33 6 0.00% 34 6 0.00% 35 5 0.00% 36 2 0.00% 37 8 0.00% 38 5 0.00% 39 8 0.00% 40 6 0.00% 41 7 0.00% 42 5 0.00% 43 6 0.00% 44 8 0.00% 45 5 0.00% 46 10 0.00% 47 13 0.00% 48 11 0.00% 49 19 0.00% 50 15 0.00% 51 25 0.00% 52 22 0.00% 53 23 0.00% 54 19 0.00% 55 33 0.00% 56 37 0.00% 57 48 0.00% 58 48 0.00% 59 56 0.00% 60 60 0.00% 61 64 0.00% 62 75 0.00% 63 100 0.00% 64 93 0.00% 65 121 0.00% 66 139 0.00% 67 132 0.00% 68 152 0.00% 69 185 0.00% 70 200 0.00% 71 252 0.00% 72 297 0.00% 73 322 0.00% 74 358 0.00% 75 440 0.01% 76 552 0.01% 77 604 0.01% 78 590 0.01% 79 746 0.01% 80 805 0.01% 81 974 0.01% 82 1110 0.01% 83 1296 0.02% 84 1668 0.02% 85 2109 0.03% 86 2321 0.03% 87 2614 0.03% 88 2890 0.03% 89 3067 0.04% 90 3250 0.04% 91 3452 0.04% 92 3770 0.04% 93 3988 0.05% 94 4507 0.05% 95 4821 0.06% 96 5192 0.06% 97 5478 0.07% 98 5829 0.07% 99 6290 0.07% 100 6828 0.08% 101 7286 0.09% 102 7502 0.09% 103 8243 0.10% 104 8807 0.10% 105 9310 0.11% 106 10161 0.12% 107 10589 0.13% 108 11159 0.13% 109 11720 0.14% 110 12154 0.14% 111 13037 0.16% 112 13547 0.16% 113 14664 0.17% 114 15091 0.18% 115 15804 0.19% 116 16501 0.20% 117 17108 0.20% 118 17720 0.21% 119 18124 0.22% 120 18885 0.22% 121 19551 0.23% 122 20379 0.24% 123 21034 0.25% 124 22197 0.26% 125 23306 0.28% 126 24100 0.29% 127 24973 0.30% 128 26148 0.31% 129 27229 0.32% 130 28359 0.34% 131 29405 0.35% 132 30820 0.37% 133 32363 0.39% 134 33887 0.40% 135 35560 0.42% 136 37398 0.45% 137 39250 0.47% 138 41519 0.49% 139 44516 0.53% 140 47411 0.56% 141 51244 0.61% 142 56707 0.67% 143 63162 0.75% 144 72554 0.86% 145 87156 1.04% 146 109806 1.31% 147 153149 1.82% 148 243575 2.90% 149 496623 5.91% 150 2015163 23.98% 151 4108720 48.90% 8402920 reads passed initial QC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=27 prefix-density=0.88 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACCAGAGTTCATCTCAGACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=309.76 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=17.9 sequence=AAACAGAAACTAATTAAGCATTTTCATTAATTATCATCAACTCCACATAGTTCAAGTTTCCAAGCATACATGAAAACACCTTGAAAGTTGAAGCAGCCAACAAAGCAGTGACGCGTACACAAGACAAAGGATTTATAGGAACCCTT criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=2.67 fanout-score-rank=17 prefix-density=0.87 prefix-fanout=2.6 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=32.06 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=2.8 sequence=TCCTGCTCTCGCAATCGCTGCTTCTTTGTCTGTCTTTGGGTCGATCCGAAAGAGAGGAGCTCTTCTGCGCAATCATGTTGGTCTATCAAGATCTTCTCTCTGGTGATGAGCTTCTCTCGGATTCGTTCCCATACAAGGAGATTGAGAATGGGATACTGTGGGAAGTTGAAGGAAAGTGGGTTGTTCAAGGAGCCGTTGATGTAGACATTGGTGCAAATCCTTCAGCTGAAGGAGGTGATGAGGATGAGGGTGTTGATGACCAAGCTGCCAAGGTTGTTGACATCGTTGACACATTTAGGCTCCAGGAGCAACCTCCATTTGACAAGAAGCAGTTTCTTACACAGATTAAGAAATTTATCAAGAATCTGTCGGAGAAACTTGATGAGGACCAGAAGGAACATTTTAGAAAGAACATTGAGGGAGCAACCAAGTTCTTGCTTTCAAAAATCAAGGACTTGCAATTCTTTGTGGGGGAGAGCATGCATGATGATGG SRR7172074 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 17:08:43 Started mapping on | Feb 14 17:08:44 Finished on | Feb 14 17:10:53 Mapping speed, Million of reads per hour | 234.50 Number of input reads | 8402920 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 7383834 Uniquely mapped reads % | 87.87% Average mapped length | 293.42 Number of splices: Total | 6763278 Number of splices: Annotated (sjdb) | 6613558 Number of splices: GT/AG | 6642893 Number of splices: GC/AG | 90187 Number of splices: AT/AC | 6214 Number of splices: Non-canonical | 23984 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.05% Deletion average length | 2.50 Insertion rate per base | 0.03% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 228078 % of reads mapped to multiple loci | 2.71% Number of reads mapped to too many loci | 28078 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.98% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 798666 798666 798666 N_multimapping 228078 228078 228078 N_noFeature 230741 7302749 264995 N_ambiguous 84821 463 37727 UnstrandedReadsAssigned:7068272 PositiveStrandReadsAssigned:80622 NegativeStrandReadsAssigned:7081112 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172074 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172074-trimmed-pair1.fastq SRR7172074-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,402,920 reads, 7,037,884 reads pseudoaligned [quant] estimated average fragment length: 238.12 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,087 rounds 52401 SRR7172074.ke.tsv 34699 SRR7172074.se.tsv 87100 total ==> SRR7172074.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.88 1359 99.7384 Potri.005G024800.1.v4.1 1035 797.88 195 31.9429 Potri.004G059700.1.v4.1 961 723.895 13 2.34718 Potri.007G009000.2.v4.1 1416 1178.88 0 0 Potri.003G141000.2.v4.1 2943 2705.88 263 12.7035 Potri.016G087400.1.v4.1 270 83.3143 461 723.201 Potri.015G069301.1.v4.1 564 331.233 0 0 Potri.010G195200.1.v4.1 1773 1535.88 460.878 39.2199 Potri.012G127500.1.v4.1 977 739.89 3245 573.225 ==> SRR7172074.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 297 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 238 Potri.001G452600.v4.1 306 SRR7172074 completed mapping pipeline successfully