Starting /dee2/code/volunteer_pipeline.sh SRR7172075 current disk space = 3112475365376 free memory = 1470973736 SRR7172075 SRAfilesize ef9a90b5326da8455a149e16a7e6f1df SRR7172075.sra SRR7172075.sra file validated SRR7172075 is paired end SRR7172075 is conventional basespace SRR7172075 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172075_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.99025 34.0 33.0 34.0 32.0 34.0 2 33.2615 34.0 33.0 34.0 33.0 34.0 3 33.009 34.0 33.0 34.0 32.0 34.0 4 33.117 34.0 33.0 34.0 32.0 34.0 5 33.071 34.0 33.0 34.0 32.0 34.0 6 36.8265 38.0 37.0 38.0 35.0 38.0 7 37.331 38.0 38.0 38.0 37.0 38.0 8 37.4375 38.0 38.0 38.0 37.0 38.0 9 37.4165 38.0 38.0 38.0 38.0 38.0 10-14 37.473400000000005 38.0 38.0 38.0 37.8 38.0 15-19 37.47865 38.0 38.0 38.0 37.8 38.0 20-24 37.4497 38.0 38.0 38.0 37.4 38.0 25-29 37.385149999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.283899999999996 38.0 38.0 38.0 36.8 38.0 35-39 37.193349999999995 38.0 38.0 38.0 36.8 38.0 40-44 37.225350000000006 38.0 38.0 38.0 36.8 38.0 45-49 37.14045 38.0 38.0 38.0 36.6 38.0 50-54 37.34805 38.0 38.0 38.0 37.0 38.0 55-59 37.26395 38.0 38.0 38.0 36.6 38.0 60-64 37.18425 38.0 38.0 38.0 36.0 38.0 65-69 37.239549999999994 38.0 38.0 38.0 36.4 38.0 70-74 37.14755 38.0 38.0 38.0 36.2 38.0 75-79 37.0275 38.0 38.0 38.0 36.0 38.0 80-84 36.95635 38.0 38.0 38.0 35.8 38.0 85-89 36.85765 38.0 38.0 38.0 35.4 38.0 90-94 36.74375 38.0 38.0 38.0 34.8 38.0 95-99 36.67595 38.0 38.0 38.0 34.4 38.0 100-104 36.5368 38.0 38.0 38.0 34.0 38.0 105-109 36.49735 38.0 38.0 38.0 34.0 38.0 110-114 36.17065 38.0 37.6 38.0 33.4 38.0 115-119 36.0544 38.0 37.0 38.0 33.0 38.0 120-124 35.667950000000005 38.0 36.6 38.0 31.0 38.0 125-129 35.3519 38.0 36.0 38.0 31.0 38.0 130-134 35.30115 38.0 36.0 38.0 30.2 38.0 135-139 34.90905 38.0 35.8 38.0 28.8 38.0 140-144 34.1399 38.0 34.0 38.0 24.6 38.0 145-149 33.65990000000001 38.0 33.6 38.0 22.2 38.0 150-151 28.43925 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 1.0 16 0.0 17 1.0 18 0.0 19 1.0 20 2.0 21 4.0 22 8.0 23 7.0 24 7.0 25 14.0 26 17.0 27 20.0 28 25.0 29 33.0 30 41.0 31 77.0 32 87.0 33 106.0 34 171.0 35 246.0 36 643.0 37 2485.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.825 16.0 16.575 38.6 2 19.0 24.675 38.15 18.175 3 18.075 29.7 27.400000000000002 24.825 4 21.15 37.05 22.025 19.775000000000002 5 20.674999999999997 37.675 23.3 18.35 6 16.525000000000002 36.449999999999996 25.55 21.475 7 12.65 19.325 46.275 21.75 8 17.4 22.175 28.849999999999998 31.574999999999996 9 18.670012547051442 22.58469259723965 30.31367628607277 28.431618569636136 10-14 19.09881976395279 30.16603320664133 27.060412082416484 23.6747349469894 15-19 19.85 28.384999999999998 28.199999999999996 23.565 20-24 19.36 29.104999999999997 28.115000000000002 23.419999999999998 25-29 19.715 29.349999999999998 27.855 23.080000000000002 30-34 19.35 29.12 27.800000000000004 23.73 35-39 19.650000000000002 29.005 27.73 23.615 40-44 19.81 29.01 27.810000000000002 23.369999999999997 45-49 20.42204220422042 28.56785678567857 27.337733773377337 23.672367236723673 50-54 19.245 28.865000000000002 28.37 23.52 55-59 19.814999999999998 28.89 28.255000000000003 23.04 60-64 19.895 28.51 28.01 23.585 65-69 19.495 28.165000000000003 28.410000000000004 23.93 70-74 19.655 28.685 28.03 23.630000000000003 75-79 19.8 28.93 27.500000000000004 23.77 80-84 19.515 28.815 28.01 23.66 85-89 20.07 28.389999999999997 27.810000000000002 23.73 90-94 20.345 28.325 28.185 23.145 95-99 20.18 28.24 28.199999999999996 23.380000000000003 100-104 20.185 28.4 27.694999999999997 23.72 105-109 20.15100755037752 28.086404320216012 27.74138706935347 24.021201060053002 110-114 20.715215866973853 28.743864569768608 27.646999899829712 22.893919663427827 115-119 20.979999999999997 28.155 27.11 23.755000000000003 120-124 20.090112640801 27.874843554443054 28.235294117647058 23.799749687108886 125-129 20.805974637862764 27.983559721317224 27.808129918299834 23.402335722520174 130-134 20.830000000000002 28.12 27.38 23.669999999999998 135-139 21.04 28.67 26.66 23.630000000000003 140-144 21.26819022853428 28.26924038605791 27.48412261839276 22.97844676701505 145-149 20.849999999999998 28.42 26.985 23.745 150-151 20.7375 28.425 26.55 24.2875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.5 20 1.0 21 0.5 22 1.5 23 3.0 24 3.0 25 3.0 26 6.0 27 6.5 28 8.0 29 16.0 30 26.0 31 27.0 32 30.0 33 54.5 34 69.5 35 79.5 36 112.5 37 132.0 38 147.5 39 185.0 40 220.0 41 239.5 42 253.0 43 275.0 44 285.5 45 271.0 46 258.5 47 230.5 48 192.0 49 178.5 50 151.0 51 124.5 52 113.5 53 75.5 54 50.0 55 42.5 56 29.5 57 22.0 58 14.0 59 9.0 60 11.5 61 10.0 62 6.0 63 6.0 64 4.0 65 4.5 66 3.0 67 1.0 68 2.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.375 10-14 0.02 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.01 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.16999999999999998 115-119 0.0 120-124 0.125 125-129 0.245 130-134 0.0 135-139 0.0 140-144 0.015 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.23750000000000002 0.0 0.0 0.0 0.0 102-103 0.32499999999999996 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.7 0.0 0.0 0.0 0.0 110-111 0.8375 0.0 0.0 0.0 0.0 112-113 1.15 0.0 0.0 0.0 0.0 114-115 1.2625 0.0 0.0 0.0 0.0 116-117 1.425 0.0 0.0 0.0 0.0 118-119 1.7125 0.0 0.0 0.0 0.0 120-121 1.9249999999999998 0.0 0.0 0.0 0.0 122-123 2.2 0.0 0.0 0.0 0.0 124-125 2.525 0.0 0.0 0.0 0.0 126-127 2.7375 0.0 0.0 0.0 0.0 128-129 3.175 0.0 0.0 0.0 0.0 130-131 3.4749999999999996 0.0 0.0 0.0 0.0 132-133 3.775 0.0 0.0 0.0 0.0 134-135 4.25 0.0 0.0 0.0 0.0 136-137 4.6875 0.0 0.0 0.0 0.0 138-139 5.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACCAG 10 0.006830828 145.0 5 AAAGACC 10 0.006830828 145.0 6 >>END_MODULE SRR7172075 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172075_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9125 33.0 33.0 34.0 32.0 34.0 2 33.0665 34.0 33.0 34.0 32.0 34.0 3 33.1335 34.0 33.0 34.0 33.0 34.0 4 33.10375 34.0 33.0 34.0 33.0 34.0 5 33.0475 34.0 33.0 34.0 33.0 34.0 6 37.1665 38.0 38.0 38.0 37.0 38.0 7 37.215 38.0 38.0 38.0 37.0 38.0 8 37.1165 38.0 38.0 38.0 37.0 38.0 9 37.196 38.0 38.0 38.0 37.0 38.0 10-14 37.192150000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.166199999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.08955 38.0 38.0 38.0 37.0 38.0 25-29 37.0931 38.0 38.0 38.0 37.0 38.0 30-34 37.11345 38.0 38.0 38.0 37.0 38.0 35-39 37.038399999999996 38.0 38.0 38.0 37.0 38.0 40-44 36.93705 38.0 38.0 38.0 36.4 38.0 45-49 37.023849999999996 38.0 38.0 38.0 36.6 38.0 50-54 37.018150000000006 38.0 38.0 38.0 36.6 38.0 55-59 36.95805 38.0 38.0 38.0 36.2 38.0 60-64 36.927699999999994 38.0 38.0 38.0 36.2 38.0 65-69 36.81205 38.0 38.0 38.0 36.0 38.0 70-74 36.83365 38.0 38.0 38.0 36.0 38.0 75-79 36.7273 38.0 38.0 38.0 35.8 38.0 80-84 36.63805 38.0 38.0 38.0 35.0 38.0 85-89 36.5438 38.0 38.0 38.0 34.8 38.0 90-94 36.4311 38.0 38.0 38.0 34.6 38.0 95-99 36.17229999999999 38.0 38.0 38.0 33.8 38.0 100-104 36.20785000000001 38.0 38.0 38.0 34.0 38.0 105-109 36.16355 38.0 38.0 38.0 34.0 38.0 110-114 35.9418 38.0 38.0 38.0 33.2 38.0 115-119 35.8908 38.0 37.6 38.0 33.2 38.0 120-124 35.594750000000005 38.0 37.4 38.0 31.2 38.0 125-129 35.20075 38.0 36.6 38.0 30.6 38.0 130-134 34.824749999999995 38.0 36.0 38.0 28.0 38.0 135-139 34.429700000000004 38.0 36.0 38.0 26.8 38.0 140-144 33.740050000000004 38.0 34.6 38.0 21.2 38.0 145-149 33.24485000000001 38.0 33.0 38.0 18.6 38.0 150-151 28.1445 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 4.0 4 2.0 5 3.0 6 3.0 7 4.0 8 1.0 9 1.0 10 3.0 11 0.0 12 1.0 13 3.0 14 3.0 15 1.0 16 3.0 17 3.0 18 1.0 19 5.0 20 10.0 21 6.0 22 7.0 23 11.0 24 19.0 25 21.0 26 18.0 27 27.0 28 27.0 29 40.0 30 30.0 31 66.0 32 69.0 33 95.0 34 134.0 35 260.0 36 512.0 37 2603.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.8234704112337 13.615847542627884 19.78435305917753 33.776328986960884 2 23.64137240170298 21.7129977460556 38.11670423240671 16.528925619834713 3 19.684447783621337 25.79514149762084 32.33158026546457 22.188830453293264 4 26.296018031555224 33.007763586275985 20.210368144252442 20.485850237916353 5 23.516153268219384 37.315301778111696 21.788129226145756 17.380415727523165 6 17.234468937875754 38.12625250501002 24.874749498997996 19.76452905811623 7 17.334669338677354 15.155310621242485 45.89178356713427 21.618236472945892 8 20.96168294515402 21.763085399449036 28.09917355371901 29.17605810167794 9 22.439268720260454 23.115452041071876 29.000751314800898 25.444527923866765 10-14 23.499949914855254 28.383251527596915 26.13943704297305 21.977361514574778 15-19 22.917397184791866 28.73816560637179 27.440765416019637 20.90367179281671 20-24 23.13776531838206 27.808370044052865 28.33400080096115 20.719863836603924 25-29 23.165 27.79 28.095 20.95 30-34 22.35 28.389999999999997 27.894999999999996 21.365000000000002 35-39 23.11 28.355000000000004 27.68 20.855 40-44 23.225 28.395 28.095 20.285 45-49 23.27 28.615000000000002 27.474999999999998 20.64 50-54 23.215 28.515 27.544999999999998 20.724999999999998 55-59 23.225 27.92 27.655 21.2 60-64 23.212321232123212 28.352835283528353 27.65776577657766 20.77707770777078 65-69 23.541479035324727 27.959571700190132 27.639347543280294 20.859601721204843 70-74 23.155050783008956 28.72867363786461 27.682993946064943 20.43328163306149 75-79 23.55973772461084 27.80419440412433 28.039441413484155 20.59662645778067 80-84 23.393714971977584 28.3626901521217 27.346877502001597 20.89671737389912 85-89 23.405213388702656 28.37344273777956 27.6329614249262 20.588382448591585 90-94 23.09193734047345 28.256844001801714 28.09168710274761 20.559531554977227 95-99 23.566496547583306 27.644351045732012 28.049634744321022 20.739517662363653 100-104 23.39 28.660000000000004 27.465 20.485 105-109 23.56 28.17 27.655 20.615 110-114 23.599999999999998 28.285 27.62 20.495 115-119 23.697369736973698 28.28782878287829 28.17781778177818 19.836983698369835 120-124 23.85954381752701 28.07122849139656 27.696078431372552 20.373149259703883 125-129 23.82572157470862 28.082637186734033 27.607423340503228 20.484217898054126 130-134 24.224379503602883 28.357686148919136 27.381905524419537 20.036028823058448 135-139 23.936755729010308 28.55498849194436 27.789452616831785 19.71880316221355 140-144 25.236403662380546 27.54290288687647 27.6329614249262 19.58773202581678 145-149 24.77 28.07 27.47 19.689999999999998 150-151 24.975 27.85 28.1625 19.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 1.0 22 2.0 23 1.5 24 2.5 25 3.5 26 4.5 27 3.5 28 3.5 29 5.5 30 7.5 31 14.5 32 23.0 33 31.5 34 42.5 35 69.0 36 89.5 37 101.5 38 132.0 39 165.0 40 198.5 41 242.0 42 268.0 43 283.5 44 297.0 45 302.5 46 295.5 47 252.0 48 199.5 49 168.5 50 161.0 51 145.5 52 111.5 53 83.5 54 70.0 55 58.5 56 43.0 57 29.0 58 21.5 59 15.5 60 8.0 61 7.0 62 5.5 63 4.5 64 5.0 65 3.5 66 3.0 67 3.5 68 2.0 69 0.5 70 1.0 71 1.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.17500000000000002 3 0.17500000000000002 4 0.17500000000000002 5 0.17500000000000002 6 0.2 7 0.2 8 0.17500000000000002 9 0.17500000000000002 10-14 0.16999999999999998 15-19 0.185 20-24 0.12 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.01 65-69 0.06999999999999999 70-74 0.065 75-79 0.105 80-84 0.08 85-89 0.065 90-94 0.095 95-99 0.06999999999999999 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.01 120-124 0.04 125-129 0.045 130-134 0.08 135-139 0.06999999999999999 140-144 0.065 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.2125 0.0 0.0 0.0 0.0 102-103 0.30000000000000004 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.7 0.0 0.0 0.0 0.0 110-111 0.8375 0.0 0.0 0.0 0.0 112-113 1.1375 0.0 0.0 0.0 0.0 114-115 1.2375 0.0 0.0 0.0 0.0 116-117 1.4 0.0 0.0 0.0 0.0 118-119 1.6875 0.0 0.0 0.0 0.0 120-121 1.9 0.0 0.0 0.0 0.0 122-123 2.175 0.0 0.0 0.0 0.0 124-125 2.5125 0.0 0.0 0.0 0.0 126-127 2.7375 0.0 0.0 0.0 0.0 128-129 3.175 0.0 0.0 0.0 0.0 130-131 3.4625 0.0 0.0 0.0 0.0 132-133 3.775 0.0 0.0 0.0 0.0 134-135 4.25 0.0 0.0 0.0 0.0 136-137 4.675 0.0 0.0 0.0 0.0 138-139 5.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTCTTG 10 0.006830828 145.0 5 AAGAAAG 20 0.00593511 29.0 15-19 >>END_MODULE Read 904226 spots for SRR7172075.sra Written 904226 spots for SRR7172075.sra Read 904226 spots for SRR7172075.sra Written 904226 spots for SRR7172075.sra Read 904226 spots for SRR7172075.sra Written 904226 spots for SRR7172075.sra Read 904226 spots for SRR7172075.sra Written 904226 spots for SRR7172075.sra Read 904226 spots for SRR7172075.sra Written 904226 spots for SRR7172075.sra Read 904226 spots for SRR7172075.sra Written 904226 spots for SRR7172075.sra Read 904226 spots for SRR7172075.sra Written 904226 spots for SRR7172075.sra Read 904226 spots for SRR7172075.sra Written 904226 spots for SRR7172075.sra Read 904226 spots for SRR7172075.sra Written 904226 spots for SRR7172075.sra Read 904226 spots for SRR7172075.sra Written 904226 spots for SRR7172075.sra Read 904226 spots for SRR7172075.sra Written 904226 spots for SRR7172075.sra Read 904226 spots for SRR7172075.sra Written 904226 spots for SRR7172075.sra Read 904226 spots for SRR7172075.sra Written 904226 spots for SRR7172075.sra Read 904226 spots for SRR7172075.sra Written 904226 spots for SRR7172075.sra Read 904228 spots for SRR7172075.sra Written 904228 spots for SRR7172075.sra Read 904226 spots for SRR7172075.sra Written 904226 spots for SRR7172075.sra Read 904226 spots for SRR7172075.sra Written 904226 spots for SRR7172075.sra Read 904226 spots for SRR7172075.sra Written 904226 spots for SRR7172075.sra Read 904226 spots for SRR7172075.sra Written 904226 spots for SRR7172075.sra Read 904226 spots for SRR7172075.sra Written 904226 spots for SRR7172075.sra SRR ids: ['SRR7172075.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_68b9lyny SRR7172075.sra spots: 18084522 blocks: [[1, 904226], [904227, 1808452], [1808453, 2712678], [2712679, 3616904], [3616905, 4521130], [4521131, 5425356], [5425357, 6329582], [6329583, 7233808], [7233809, 8138034], [8138035, 9042260], [9042261, 9946486], [9946487, 10850712], [10850713, 11754938], [11754939, 12659164], [12659165, 13563390], [13563391, 14467616], [14467617, 15371842], [15371843, 16276068], [16276069, 17180294], [17180295, 18084522]] SRR7172075 file size 6106550 SRR7172075 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172075 SRR7172075_1.fastq SRR7172075_2.fastq Input file: SRR7172075_1.fastq Paired file: SRR7172075_2.fastq trimmed: SRR7172075-trimmed-pair1.fastq, SRR7172075-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 15:59:21 2025 >> started Fri Feb 14 15:59:42 2025 >> done (21.167s) 18084522 read pairs processed; of these: 17906 ( 0.10%) short read pairs filtered out after trimming by size control 21800 ( 0.12%) empty read pairs filtered out after trimming by size control 18044816 (99.78%) read pairs available; of these: 10255177 (56.83%) trimmed read pairs available after processing 7789639 (43.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 1 0.00% 21 2 0.00% 22 7 0.00% 23 6 0.00% 24 2 0.00% 25 6 0.00% 26 6 0.00% 27 5 0.00% 28 12 0.00% 29 6 0.00% 30 4 0.00% 31 5 0.00% 32 7 0.00% 33 9 0.00% 34 11 0.00% 35 14 0.00% 36 7 0.00% 37 8 0.00% 38 8 0.00% 39 8 0.00% 40 7 0.00% 41 7 0.00% 42 9 0.00% 43 16 0.00% 44 17 0.00% 45 12 0.00% 46 10 0.00% 47 16 0.00% 48 19 0.00% 49 33 0.00% 50 21 0.00% 51 26 0.00% 52 28 0.00% 53 37 0.00% 54 48 0.00% 55 47 0.00% 56 52 0.00% 57 85 0.00% 58 193 0.00% 59 327 0.00% 60 196 0.00% 61 166 0.00% 62 115 0.00% 63 138 0.00% 64 154 0.00% 65 189 0.00% 66 201 0.00% 67 201 0.00% 68 257 0.00% 69 251 0.00% 70 321 0.00% 71 339 0.00% 72 419 0.00% 73 469 0.00% 74 570 0.00% 75 662 0.00% 76 855 0.00% 77 874 0.00% 78 1126 0.01% 79 1306 0.01% 80 1419 0.01% 81 1457 0.01% 82 1932 0.01% 83 3117 0.02% 84 4607 0.03% 85 5047 0.03% 86 4978 0.03% 87 5175 0.03% 88 5280 0.03% 89 5126 0.03% 90 5122 0.03% 91 5487 0.03% 92 5934 0.03% 93 6336 0.04% 94 7006 0.04% 95 7593 0.04% 96 8075 0.04% 97 8910 0.05% 98 9387 0.05% 99 10224 0.06% 100 11725 0.06% 101 12011 0.07% 102 12336 0.07% 103 13374 0.07% 104 14039 0.08% 105 14840 0.08% 106 15735 0.09% 107 16842 0.09% 108 17611 0.10% 109 18912 0.10% 110 20038 0.11% 111 21121 0.12% 112 22370 0.12% 113 23519 0.13% 114 24962 0.14% 115 26305 0.15% 116 27760 0.15% 117 29099 0.16% 118 30747 0.17% 119 32577 0.18% 120 33830 0.19% 121 36280 0.20% 122 37103 0.21% 123 39649 0.22% 124 42210 0.23% 125 44453 0.25% 126 46831 0.26% 127 49415 0.27% 128 52602 0.29% 129 55159 0.31% 130 57071 0.32% 131 60621 0.34% 132 63828 0.35% 133 66578 0.37% 134 70799 0.39% 135 75967 0.42% 136 81260 0.45% 137 85024 0.47% 138 91500 0.51% 139 99507 0.55% 140 112494 0.62% 141 120775 0.67% 142 136433 0.76% 143 156089 0.87% 144 184679 1.02% 145 217633 1.21% 146 280486 1.55% 147 387204 2.15% 148 571527 3.17% 149 1147558 6.36% 150 5222523 28.94% 151 7789639 43.17% 18044816 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=4.69 fanout-score-rank=19 prefix-density=0.28 prefix-fanout=3.7 sequence=CCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.07 sequence-density-rank=22 fanout-score=61.95 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=14.9 sequence=TCATCCTCATCA criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=8.20 fanout-score-rank=15 prefix-density=0.31 prefix-fanout=5.3 sequence=GGTGCTGAGAATGGCTGCAAGTGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=45.17 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.0 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTC SRR7172075 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 16:01:00 Started mapping on | Feb 14 16:01:01 Finished on | Feb 14 16:04:38 Mapping speed, Million of reads per hour | 299.36 Number of input reads | 18044816 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 16325349 Uniquely mapped reads % | 90.47% Average mapped length | 294.11 Number of splices: Total | 15608004 Number of splices: Annotated (sjdb) | 15292879 Number of splices: GT/AG | 15347509 Number of splices: GC/AG | 199836 Number of splices: AT/AC | 13118 Number of splices: Non-canonical | 47541 Mismatch rate per base, % | 0.47% Deletion rate per base | 0.04% Deletion average length | 2.32 Insertion rate per base | 0.03% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 492963 % of reads mapped to multiple loci | 2.73% Number of reads mapped to too many loci | 44079 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.46% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1243353 1243353 1243353 N_multimapping 492963 492963 492963 N_noFeature 492998 16173726 550428 N_ambiguous 182707 752 88290 UnstrandedReadsAssigned:15649644 PositiveStrandReadsAssigned:150871 NegativeStrandReadsAssigned:15686631 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172075 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172075-trimmed-pair1.fastq SRR7172075-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,044,816 reads, 15,554,491 reads pseudoaligned [quant] estimated average fragment length: 245.478 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,145 rounds 52401 SRR7172075.ke.tsv 34699 SRR7172075.se.tsv 87100 total ==> SRR7172075.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.52 1645 57.6188 Potri.005G024800.1.v4.1 1035 790.522 285 22.3958 Potri.004G059700.1.v4.1 961 716.548 42 3.64116 Potri.007G009000.2.v4.1 1416 1171.52 0 0 Potri.003G141000.2.v4.1 2943 2698.52 566 13.0294 Potri.016G087400.1.v4.1 270 78.0358 1023.32 814.615 Potri.015G069301.1.v4.1 564 323.749 0 0 Potri.010G195200.1.v4.1 1773 1528.52 883.867 35.9211 Potri.012G127500.1.v4.1 977 732.532 9384 795.786 ==> SRR7172075.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 60 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 745 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 301 SRR7172075 completed mapping pipeline successfully