Starting /dee2/code/volunteer_pipeline.sh SRR7172076 current disk space = 3111549976576 free memory = 1574350100 SRR7172076 SRAfilesize 0353c20c953a5aa19dd4db22580a4a64 SRR7172076.sra SRR7172076.sra file validated SRR7172076 is paired end SRR7172076 is conventional basespace SRR7172076 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172076_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.53575 33.0 32.0 33.0 25.0 34.0 2 31.57075 33.0 32.0 33.0 27.0 34.0 3 31.74425 33.0 31.0 33.0 28.0 34.0 4 31.414 33.0 31.0 33.0 29.0 34.0 5 31.734 33.0 31.0 33.0 29.0 34.0 6 35.62025 37.0 35.0 38.0 31.0 38.0 7 36.45 38.0 37.0 38.0 34.0 38.0 8 36.995 38.0 38.0 38.0 35.0 38.0 9 37.193 38.0 38.0 38.0 36.0 38.0 10-14 37.31035000000001 38.0 38.0 38.0 36.4 38.0 15-19 37.361450000000005 38.0 38.0 38.0 36.8 38.0 20-24 37.4062 38.0 38.0 38.0 37.0 38.0 25-29 37.3842 38.0 38.0 38.0 37.0 38.0 30-34 37.36905 38.0 38.0 38.0 37.0 38.0 35-39 37.3527 38.0 38.0 38.0 37.0 38.0 40-44 37.30865 38.0 38.0 38.0 36.4 38.0 45-49 37.24685000000001 38.0 38.0 38.0 36.4 38.0 50-54 37.1394 38.0 38.0 38.0 36.0 38.0 55-59 37.07065 38.0 38.0 38.0 36.0 38.0 60-64 36.915350000000004 38.0 38.0 38.0 35.2 38.0 65-69 36.857749999999996 38.0 38.0 38.0 35.0 38.0 70-74 36.837650000000004 38.0 38.0 38.0 35.0 38.0 75-79 36.714299999999994 38.0 38.0 38.0 34.2 38.0 80-84 36.63705 38.0 38.0 38.0 34.0 38.0 85-89 36.4952 38.0 37.6 38.0 34.0 38.0 90-94 36.41175 38.0 37.0 38.0 34.0 38.0 95-99 36.2333 38.0 37.0 38.0 33.6 38.0 100-104 36.06365 38.0 37.0 38.0 33.0 38.0 105-109 35.78685 38.0 36.6 38.0 31.4 38.0 110-114 35.66245 38.0 36.2 38.0 30.8 38.0 115-119 35.5399 38.0 36.0 38.0 30.8 38.0 120-124 35.21085 38.0 35.8 38.0 28.4 38.0 125-129 34.9813 38.0 35.0 38.0 27.8 38.0 130-134 34.673100000000005 38.0 35.0 38.0 27.2 38.0 135-139 34.42774999999999 38.0 35.0 38.0 26.2 38.0 140-144 33.65125 38.0 34.2 38.0 21.4 38.0 145-149 32.733000000000004 38.0 33.4 38.0 14.4 38.0 150-151 28.833375 36.0 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 0.0 14 1.0 15 2.0 16 3.0 17 0.0 18 1.0 19 1.0 20 6.0 21 4.0 22 2.0 23 8.0 24 10.0 25 12.0 26 11.0 27 16.0 28 35.0 29 31.0 30 51.0 31 67.0 32 88.0 33 125.0 34 222.0 35 445.0 36 1098.0 37 1759.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.919767748746374 18.76484560570071 12.061229875956716 33.2541567695962 2 18.2 26.25 36.7 18.85 3 17.2 30.275000000000002 27.725 24.8 4 19.85 38.074999999999996 21.95 20.125 5 18.425 38.074999999999996 23.75 19.75 6 15.575 36.425000000000004 25.6 22.400000000000002 7 12.775 20.974999999999998 45.675 20.575 8 17.724999999999998 22.025 29.175 31.075000000000003 9 18.15 23.599999999999998 30.2 28.050000000000004 10-14 19.695 30.385 25.855 24.065 15-19 19.75 29.060000000000002 27.605 23.585 20-24 19.465 29.29 27.395000000000003 23.849999999999998 25-29 19.955000000000002 29.770000000000003 27.35 22.925 30-34 19.81 29.5 27.534999999999997 23.155 35-39 20.625 29.4 27.0 22.975 40-44 19.994999999999997 29.595 27.455000000000002 22.955000000000002 45-49 20.185 29.4 26.91 23.505000000000003 50-54 20.285 28.615000000000002 27.58 23.52 55-59 20.28 29.060000000000002 27.63 23.03 60-64 20.064999999999998 29.244999999999997 27.465 23.225 65-69 19.755 29.42 27.58 23.244999999999997 70-74 19.845 29.299999999999997 27.74 23.115 75-79 20.0 29.565 27.565 22.869999999999997 80-84 20.185 28.720000000000002 27.689999999999998 23.405 85-89 20.625 28.970000000000002 27.634999999999998 22.770000000000003 90-94 20.685000000000002 28.37 27.779999999999998 23.165 95-99 20.48 28.525 27.38 23.615 100-104 20.805 28.92 27.565 22.71 105-109 20.4 28.345 28.02 23.235 110-114 20.755000000000003 28.799999999999997 27.785 22.66 115-119 21.029999999999998 29.125 27.495000000000005 22.35 120-124 20.205000000000002 28.53 27.700000000000003 23.565 125-129 20.810000000000002 28.455000000000002 27.485 23.25 130-134 21.325 28.32 27.165 23.189999999999998 135-139 20.775 28.88 26.8 23.544999999999998 140-144 20.73 28.735 26.795 23.74 145-149 21.305 28.765 26.715 23.215 150-151 20.8125 28.6125 26.724999999999998 23.849999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.5 24 2.0 25 3.0 26 5.5 27 9.5 28 12.0 29 15.0 30 19.5 31 29.0 32 42.0 33 50.5 34 65.5 35 92.5 36 118.5 37 134.5 38 141.0 39 165.0 40 193.0 41 232.0 42 260.5 43 270.0 44 287.0 45 283.5 46 265.0 47 234.5 48 206.5 49 178.0 50 146.0 51 118.0 52 98.0 53 86.5 54 59.5 55 37.0 56 32.0 57 24.5 58 21.0 59 13.5 60 10.5 61 10.0 62 6.0 63 5.0 64 3.0 65 1.5 66 1.5 67 1.5 68 0.5 69 0.0 70 0.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.2749999999999995 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.30000000000000004 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.7625 0.0 0.0 0.0 0.0 108-109 0.9 0.0 0.0 0.0 0.0 110-111 1.0625 0.0 0.0 0.0 0.0 112-113 1.225 0.0 0.0 0.0 0.0 114-115 1.4375 0.0 0.0 0.0 0.0 116-117 1.7125 0.0 0.0 0.0 0.0 118-119 1.9874999999999998 0.0 0.0 0.0 0.0 120-121 2.1875 0.0 0.0 0.0 0.0 122-123 2.4875 0.0 0.0 0.0 0.0 124-125 2.8625 0.0 0.0 0.0 0.0 126-127 3.35 0.0 0.0 0.0 0.0 128-129 3.725 0.0 0.0 0.0 0.0 130-131 4.1125 0.0 0.0 0.0 0.0 132-133 4.775 0.0 0.0 0.0 0.0 134-135 5.137499999999999 0.0 0.0 0.0 0.0 136-137 5.5125 0.0 0.0 0.0 0.0 138-139 5.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGATGCA 10 0.006836113 144.9625 4 AACCAAC 10 0.006836113 144.9625 5 GCCAATG 10 0.006836113 144.9625 145 >>END_MODULE SRR7172076 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172076_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.999 33.0 33.0 34.0 32.0 34.0 2 33.00775 33.0 33.0 34.0 32.0 34.0 3 33.12825 34.0 33.0 34.0 32.0 34.0 4 33.112 34.0 33.0 34.0 33.0 34.0 5 33.0385 34.0 33.0 34.0 33.0 34.0 6 37.1585 38.0 38.0 38.0 37.0 38.0 7 37.21775 38.0 38.0 38.0 37.0 38.0 8 37.21575 38.0 38.0 38.0 37.0 38.0 9 37.26525 38.0 38.0 38.0 37.0 38.0 10-14 37.22125 38.0 38.0 38.0 37.0 38.0 15-19 37.20315 38.0 38.0 38.0 37.0 38.0 20-24 37.17395 38.0 38.0 38.0 37.0 38.0 25-29 37.1297 38.0 38.0 38.0 36.6 38.0 30-34 37.1255 38.0 38.0 38.0 36.4 38.0 35-39 36.96995 38.0 38.0 38.0 36.0 38.0 40-44 37.0039 38.0 38.0 38.0 36.0 38.0 45-49 36.981700000000004 38.0 38.0 38.0 36.0 38.0 50-54 36.94095 38.0 38.0 38.0 36.0 38.0 55-59 36.88195 38.0 38.0 38.0 36.0 38.0 60-64 36.8563 38.0 38.0 38.0 36.0 38.0 65-69 36.731550000000006 38.0 38.0 38.0 35.0 38.0 70-74 36.69745 38.0 38.0 38.0 34.8 38.0 75-79 36.534499999999994 38.0 38.0 38.0 34.0 38.0 80-84 36.41345 38.0 38.0 38.0 34.0 38.0 85-89 36.35125 38.0 37.8 38.0 33.8 38.0 90-94 36.21655 38.0 37.0 38.0 33.4 38.0 95-99 36.04405 38.0 37.0 38.0 32.8 38.0 100-104 36.00215000000001 38.0 37.0 38.0 33.0 38.0 105-109 35.7562 38.0 37.0 38.0 31.2 38.0 110-114 35.41575 38.0 36.2 38.0 30.2 38.0 115-119 35.24550000000001 38.0 36.0 38.0 28.6 38.0 120-124 34.99835 38.0 35.8 38.0 28.0 38.0 125-129 34.556650000000005 38.0 35.0 38.0 26.4 38.0 130-134 34.14715 38.0 34.6 38.0 23.2 38.0 135-139 33.8483 38.0 34.2 38.0 22.6 38.0 140-144 33.068999999999996 38.0 33.6 38.0 17.4 38.0 145-149 31.990099999999995 37.4 31.8 38.0 11.2 38.0 150-151 27.391624999999998 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 1.0 5 1.0 6 2.0 7 0.0 8 3.0 9 2.0 10 0.0 11 0.0 12 1.0 13 1.0 14 3.0 15 1.0 16 1.0 17 2.0 18 3.0 19 5.0 20 5.0 21 6.0 22 10.0 23 16.0 24 17.0 25 22.0 26 16.0 27 27.0 28 26.0 29 45.0 30 43.0 31 69.0 32 77.0 33 118.0 34 218.0 35 414.0 36 854.0 37 1985.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.975 16.3 14.725 28.999999999999996 2 23.5 22.775000000000002 35.375 18.35 3 20.625 26.200000000000003 32.074999999999996 21.099999999999998 4 23.65 36.025 20.7 19.625 5 22.1 37.625 22.55 17.724999999999998 6 18.05 37.1 24.425 20.424999999999997 7 17.325 16.05 45.35 21.275 8 21.05 19.900000000000002 29.4 29.65 9 21.125 23.9 27.55 27.425 10-14 22.95 28.754999999999995 26.490000000000002 21.805 15-19 23.145 27.765 28.08 21.01 20-24 22.615 27.800000000000004 28.27 21.315 25-29 22.6 28.07 28.29 21.04 30-34 22.615 28.04 28.005000000000003 21.34 35-39 22.88 28.310000000000002 28.410000000000004 20.4 40-44 22.650000000000002 27.584999999999997 28.57 21.195 45-49 22.6 27.855 28.67 20.875 50-54 22.12 27.785 28.89 21.205 55-59 23.54 27.3 28.425 20.735 60-64 22.62 27.944999999999997 28.435 21.0 65-69 22.37 27.905 28.955 20.77 70-74 23.09 28.09 28.18 20.64 75-79 23.445 27.634999999999998 28.09 20.830000000000002 80-84 23.71 27.425 28.62 20.244999999999997 85-89 23.44 27.37 28.345 20.845 90-94 23.605 27.439999999999998 28.815 20.14 95-99 22.78 27.700000000000003 28.99 20.53 100-104 23.34 27.61 28.544999999999998 20.505000000000003 105-109 23.845 27.944999999999997 28.175 20.035 110-114 23.44 28.09 27.91 20.560000000000002 115-119 23.485 28.095 28.07 20.349999999999998 120-124 23.875 27.794999999999998 28.205000000000002 20.125 125-129 23.44 28.155 28.08 20.325 130-134 24.5 27.639999999999997 28.17 19.689999999999998 135-139 24.695 28.000000000000004 27.375 19.93 140-144 24.19 27.79 27.994999999999997 20.025000000000002 145-149 24.955 28.000000000000004 27.55 19.495 150-151 24.6125 28.5875 27.55 19.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 1.5 24 1.5 25 2.0 26 2.0 27 5.5 28 7.5 29 11.0 30 17.0 31 14.0 32 17.5 33 28.5 34 53.0 35 75.5 36 89.5 37 111.5 38 135.5 39 170.0 40 204.5 41 236.5 42 262.0 43 268.0 44 288.5 45 296.5 46 267.0 47 242.0 48 222.5 49 201.5 50 178.0 51 145.5 52 115.5 53 91.5 54 68.0 55 49.0 56 29.0 57 24.0 58 23.5 59 12.0 60 6.5 61 5.0 62 4.0 63 3.0 64 1.5 65 1.5 66 1.0 67 1.5 68 1.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8246492985972 99.625 2 0.15030060120240482 0.3 3 0.0250501002004008 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.45 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.6125 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.825 0.0 0.0 0.0 0.0 110-111 0.9875 0.0 0.0 0.0 0.0 112-113 1.15 0.0 0.0 0.0 0.0 114-115 1.3624999999999998 0.0 0.0 0.0 0.0 116-117 1.6875 0.0 0.0 0.0 0.0 118-119 1.9625 0.0 0.0 0.0 0.0 120-121 2.1875 0.0 0.0 0.0 0.0 122-123 2.4749999999999996 0.0 0.0 0.0 0.0 124-125 2.8125 0.0 0.0 0.0 0.0 126-127 3.3 0.0 0.0 0.0 0.0 128-129 3.65 0.0 0.0 0.0 0.0 130-131 4.025 0.0 0.0 0.0 0.0 132-133 4.7 0.0 0.0 0.0 0.0 134-135 5.050000000000001 0.0 0.0 0.0 0.0 136-137 5.4375 0.0 0.0 0.0 0.0 138-139 5.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTGGAT 10 0.006830828 145.0 145 GAGATCG 20 0.00593511 29.0 140-144 >>END_MODULE Read 616437 spots for SRR7172076.sra Written 616437 spots for SRR7172076.sra Read 616437 spots for SRR7172076.sra Written 616437 spots for SRR7172076.sra Read 616437 spots for SRR7172076.sra Written 616437 spots for SRR7172076.sra Read 616437 spots for SRR7172076.sra Written 616437 spots for SRR7172076.sra Read 616437 spots for SRR7172076.sra Written 616437 spots for SRR7172076.sra Read 616437 spots for SRR7172076.sra Written 616437 spots for SRR7172076.sra Read 616437 spots for SRR7172076.sra Written 616437 spots for SRR7172076.sra Read 616437 spots for SRR7172076.sra Written 616437 spots for SRR7172076.sra Read 616437 spots for SRR7172076.sra Written 616437 spots for SRR7172076.sra Read 616437 spots for SRR7172076.sra Written 616437 spots for SRR7172076.sra Read 616437 spots for SRR7172076.sra Written 616437 spots for SRR7172076.sra Read 616438 spots for SRR7172076.sra Written 616438 spots for SRR7172076.sra Read 616437 spots for SRR7172076.sra Written 616437 spots for SRR7172076.sra Read 616437 spots for SRR7172076.sra Written 616437 spots for SRR7172076.sra Read 616437 spots for SRR7172076.sra Written 616437 spots for SRR7172076.sra Read 616437 spots for SRR7172076.sra Written 616437 spots for SRR7172076.sra Read 616437 spots for SRR7172076.sra Written 616437 spots for SRR7172076.sra Read 616437 spots for SRR7172076.sra Written 616437 spots for SRR7172076.sra Read 616437 spots for SRR7172076.sra Written 616437 spots for SRR7172076.sra Read 616437 spots for SRR7172076.sra Written 616437 spots for SRR7172076.sra SRR ids: ['SRR7172076.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ipylvfbc SRR7172076.sra spots: 12328741 blocks: [[1, 616437], [616438, 1232874], [1232875, 1849311], [1849312, 2465748], [2465749, 3082185], [3082186, 3698622], [3698623, 4315059], [4315060, 4931496], [4931497, 5547933], [5547934, 6164370], [6164371, 6780807], [6780808, 7397244], [7397245, 8013681], [8013682, 8630118], [8630119, 9246555], [9246556, 9862992], [9862993, 10479429], [10479430, 11095866], [11095867, 11712303], [11712304, 12328741]] SRR7172076 file size 4156105 SRR7172076 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172076 SRR7172076_1.fastq SRR7172076_2.fastq Input file: SRR7172076_1.fastq Paired file: SRR7172076_2.fastq trimmed: SRR7172076-trimmed-pair1.fastq, SRR7172076-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 17:07:44 2025 >> started Fri Feb 14 17:07:58 2025 >> done (14.287s) 12328741 read pairs processed; of these: 8140 ( 0.07%) short read pairs filtered out after trimming by size control 6125 ( 0.05%) empty read pairs filtered out after trimming by size control 12314476 (99.88%) read pairs available; of these: 7834565 (63.62%) trimmed read pairs available after processing 4479911 (36.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 8 0.00% 21 3 0.00% 22 6 0.00% 23 2 0.00% 24 4 0.00% 25 4 0.00% 26 8 0.00% 27 5 0.00% 28 5 0.00% 29 7 0.00% 30 5 0.00% 31 6 0.00% 32 5 0.00% 33 2 0.00% 34 8 0.00% 35 4 0.00% 36 10 0.00% 37 10 0.00% 38 6 0.00% 39 7 0.00% 40 8 0.00% 41 7 0.00% 42 9 0.00% 43 10 0.00% 44 8 0.00% 45 9 0.00% 46 13 0.00% 47 14 0.00% 48 16 0.00% 49 11 0.00% 50 25 0.00% 51 26 0.00% 52 35 0.00% 53 28 0.00% 54 34 0.00% 55 46 0.00% 56 51 0.00% 57 40 0.00% 58 60 0.00% 59 75 0.00% 60 106 0.00% 61 99 0.00% 62 119 0.00% 63 93 0.00% 64 132 0.00% 65 149 0.00% 66 159 0.00% 67 181 0.00% 68 202 0.00% 69 267 0.00% 70 311 0.00% 71 290 0.00% 72 405 0.00% 73 458 0.00% 74 490 0.00% 75 596 0.00% 76 718 0.01% 77 733 0.01% 78 843 0.01% 79 947 0.01% 80 1069 0.01% 81 1284 0.01% 82 1419 0.01% 83 1659 0.01% 84 2188 0.02% 85 2566 0.02% 86 2876 0.02% 87 3093 0.03% 88 3404 0.03% 89 3474 0.03% 90 3898 0.03% 91 4226 0.03% 92 4624 0.04% 93 4961 0.04% 94 5428 0.04% 95 5751 0.05% 96 5998 0.05% 97 6599 0.05% 98 6798 0.06% 99 7460 0.06% 100 7918 0.06% 101 8663 0.07% 102 9438 0.08% 103 10105 0.08% 104 10717 0.09% 105 11548 0.09% 106 12287 0.10% 107 12928 0.10% 108 13515 0.11% 109 14584 0.12% 110 15140 0.12% 111 16028 0.13% 112 16886 0.14% 113 18133 0.15% 114 19078 0.15% 115 20698 0.17% 116 21367 0.17% 117 22612 0.18% 118 23347 0.19% 119 24132 0.20% 120 25599 0.21% 121 26815 0.22% 122 28641 0.23% 123 30430 0.25% 124 32634 0.27% 125 34443 0.28% 126 35821 0.29% 127 38314 0.31% 128 40357 0.33% 129 43027 0.35% 130 45639 0.37% 131 48689 0.40% 132 52590 0.43% 133 56942 0.46% 134 61764 0.50% 135 66479 0.54% 136 71876 0.58% 137 78359 0.64% 138 85883 0.70% 139 94787 0.77% 140 105148 0.85% 141 117873 0.96% 142 136592 1.11% 143 159822 1.30% 144 192627 1.56% 145 238927 1.94% 146 311279 2.53% 147 427364 3.47% 148 640784 5.20% 149 1113075 9.04% 150 2996143 24.33% 151 4479911 36.38% 12314476 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=5.84 fanout-score-rank=17 prefix-density=0.29 prefix-fanout=4.5 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=33.54 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=5.9 sequence=TTGTCAATGGTATCAGAGCTCTCCACCTCCAAGGTGATGGTCT criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=28 prefix-density=0.29 prefix-fanout=2.1 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=16 fanout-score=25.43 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=8.7 sequence=TGGTGCTGAGAATGGCTGCAAGTG SRR7172076 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 17:08:48 Started mapping on | Feb 14 17:08:48 Finished on | Feb 14 17:10:17 Mapping speed, Million of reads per hour | 498.11 Number of input reads | 12314476 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 11458625 Uniquely mapped reads % | 93.05% Average mapped length | 292.46 Number of splices: Total | 11121732 Number of splices: Annotated (sjdb) | 10923110 Number of splices: GT/AG | 10945491 Number of splices: GC/AG | 138775 Number of splices: AT/AC | 7704 Number of splices: Non-canonical | 29762 Mismatch rate per base, % | 0.50% Deletion rate per base | 0.04% Deletion average length | 2.25 Insertion rate per base | 0.02% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 317549 % of reads mapped to multiple loci | 2.58% Number of reads mapped to too many loci | 35076 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.97% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 547412 547412 547412 N_multimapping 317549 317549 317549 N_noFeature 339125 11320651 417216 N_ambiguous 126656 825 66192 UnstrandedReadsAssigned:10992844 PositiveStrandReadsAssigned:137149 NegativeStrandReadsAssigned:10975217 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7172076 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172076-trimmed-pair1.fastq SRR7172076-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,314,476 reads, 10,888,818 reads pseudoaligned [quant] estimated average fragment length: 242.371 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 986 rounds 52401 SRR7172076.ke.tsv 34699 SRR7172076.se.tsv 87100 total ==> SRR7172076.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.63 812 41.6283 Potri.005G024800.1.v4.1 1035 793.629 40 4.59063 Potri.004G059700.1.v4.1 961 719.639 11 1.39222 Potri.007G009000.2.v4.1 1416 1174.63 0 0 Potri.003G141000.2.v4.1 2943 2701.63 347.133 11.7031 Potri.016G087400.1.v4.1 270 79.5689 565.057 646.812 Potri.015G069301.1.v4.1 564 326.691 0 0 Potri.010G195200.1.v4.1 1773 1531.63 201.828 12.0021 Potri.012G127500.1.v4.1 977 735.634 2664 329.839 ==> SRR7172076.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 63 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 362 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 136 SRR7172076 completed mapping pipeline successfully