Starting /dee2/code/volunteer_pipeline.sh SRR7172077 current disk space = 3111433904128 free memory = 1574599672 SRR7172077 SRAfilesize 03fda7855262717bc97d2dce6d45c38e SRR7172077.sra SRR7172077.sra file validated SRR7172077 is paired end SRR7172077 is conventional basespace SRR7172077 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172077_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.676 33.0 33.0 34.0 32.0 34.0 2 33.08875 34.0 33.0 34.0 32.0 34.0 3 32.64725 33.0 33.0 34.0 31.0 34.0 4 33.068 33.0 33.0 34.0 32.0 34.0 5 33.00675 34.0 33.0 34.0 32.0 34.0 6 37.08725 38.0 37.0 38.0 36.0 38.0 7 37.4525 38.0 38.0 38.0 37.0 38.0 8 37.48075 38.0 38.0 38.0 37.0 38.0 9 37.4745 38.0 38.0 38.0 38.0 38.0 10-14 37.285700000000006 38.0 38.0 38.0 37.2 38.0 15-19 37.473150000000004 38.0 38.0 38.0 37.4 38.0 20-24 37.430949999999996 38.0 38.0 38.0 37.4 38.0 25-29 37.3705 38.0 38.0 38.0 37.0 38.0 30-34 37.376549999999995 38.0 38.0 38.0 37.0 38.0 35-39 37.2702 38.0 38.0 38.0 37.0 38.0 40-44 37.2094 38.0 38.0 38.0 36.6 38.0 45-49 36.95205 38.0 38.0 38.0 35.6 38.0 50-54 37.184799999999996 38.0 38.0 38.0 36.4 38.0 55-59 37.30545 38.0 38.0 38.0 37.0 38.0 60-64 37.2804 38.0 38.0 38.0 37.0 38.0 65-69 37.221500000000006 38.0 38.0 38.0 36.6 38.0 70-74 37.0958 38.0 38.0 38.0 36.0 38.0 75-79 37.002950000000006 38.0 38.0 38.0 36.0 38.0 80-84 36.9544 38.0 38.0 38.0 35.8 38.0 85-89 36.772000000000006 38.0 38.0 38.0 35.2 38.0 90-94 36.81314999999999 38.0 38.0 38.0 35.0 38.0 95-99 36.68560000000001 38.0 38.0 38.0 34.2 38.0 100-104 36.6195 38.0 38.0 38.0 34.4 38.0 105-109 36.440349999999995 38.0 38.0 38.0 34.0 38.0 110-114 36.26965 38.0 38.0 38.0 34.0 38.0 115-119 36.137499999999996 38.0 37.0 38.0 33.4 38.0 120-124 36.00795000000001 38.0 37.0 38.0 33.0 38.0 125-129 35.734950000000005 38.0 37.0 38.0 31.6 38.0 130-134 35.43225 38.0 36.2 38.0 30.2 38.0 135-139 34.99810000000001 38.0 36.0 38.0 29.4 38.0 140-144 34.42815 38.0 34.4 38.0 26.8 38.0 145-149 33.6794 38.0 33.6 38.0 22.6 38.0 150-151 28.609375 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 1.0 16 1.0 17 1.0 18 2.0 19 2.0 20 6.0 21 4.0 22 6.0 23 8.0 24 5.0 25 6.0 26 19.0 27 23.0 28 23.0 29 33.0 30 43.0 31 67.0 32 67.0 33 100.0 34 158.0 35 244.0 36 615.0 37 2563.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.125 17.05 15.174999999999999 38.65 2 18.075 26.974999999999998 37.724999999999994 17.224999999999998 3 17.5 30.25 27.150000000000002 25.1 4 19.925 36.5 22.125 21.45 5 20.875 38.25 23.1 17.775 6 16.325 35.4 26.200000000000003 22.075 7 12.225 20.549999999999997 45.725 21.5 8 18.25 21.375 28.849999999999998 31.525 9 18.55 21.475 31.4 28.575 10-14 19.4357996185122 29.881537998192954 26.44312819997992 24.23953418331493 15-19 19.275000000000002 28.845 28.08 23.799999999999997 20-24 19.259999999999998 29.020000000000003 27.939999999999998 23.78 25-29 19.48 29.195 28.375 22.95 30-34 19.695 29.110000000000003 27.794999999999998 23.400000000000002 35-39 19.855 29.39 27.735 23.02 40-44 19.63 28.835 28.23 23.305 45-49 19.495 29.134999999999998 28.035 23.335 50-54 19.259999999999998 28.365000000000002 28.76 23.615 55-59 19.900000000000002 28.93 28.09 23.080000000000002 60-64 19.259999999999998 28.975 27.85 23.915 65-69 19.585 29.01 27.925 23.48 70-74 19.42 29.12 28.194999999999997 23.265 75-79 20.085 28.860000000000003 27.46 23.595 80-84 19.74 28.52 28.625 23.115 85-89 20.075000000000003 28.645 27.97 23.31 90-94 19.725 28.34 28.139999999999997 23.794999999999998 95-99 20.185 28.865000000000002 27.73 23.22 100-104 20.21 28.83 27.92 23.04 105-109 20.33313325330132 29.031612645058026 27.541016406562623 23.094237695078032 110-114 20.19802970445567 28.994349152372855 27.639145871880782 23.168475271290696 115-119 20.621031051552578 29.006450322516127 27.33136656832842 23.04115205760288 120-124 20.624124824964994 27.815563112622527 28.21564312862572 23.344668933786757 125-129 21.008655626157 27.45784760094061 28.443488267373795 23.090008505528594 130-134 20.665 28.17 27.88 23.285 135-139 20.919999999999998 28.475 27.700000000000003 22.905 140-144 20.4 28.28 27.195000000000004 24.125 145-149 20.560000000000002 29.099999999999998 26.88 23.46 150-151 20.825 28.3375 27.462500000000002 23.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 1.0 23 3.0 24 2.5 25 4.5 26 11.0 27 12.0 28 11.5 29 17.5 30 24.5 31 33.5 32 46.0 33 60.0 34 71.5 35 82.0 36 105.5 37 136.0 38 155.0 39 181.0 40 224.0 41 244.5 42 248.0 43 256.0 44 281.5 45 285.0 46 251.5 47 235.0 48 205.5 49 171.5 50 142.5 51 104.5 52 85.5 53 69.5 54 49.5 55 45.0 56 37.5 57 26.5 58 18.0 59 9.5 60 9.0 61 8.5 62 7.5 63 7.0 64 7.0 65 4.5 66 1.5 67 1.0 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.38999999999999996 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.04 110-114 0.015 115-119 0.005 120-124 0.02 125-129 0.065 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.8 0.0 0.0 0.0 0.0 110-111 1.05 0.0 0.0 0.0 0.0 112-113 1.2375 0.0 0.0 0.0 0.0 114-115 1.425 0.0 0.0 0.0 0.0 116-117 1.6625 0.0 0.0 0.0 0.0 118-119 1.7999999999999998 0.0 0.0 0.0 0.0 120-121 2.0125 0.0 0.0 0.0 0.0 122-123 2.3 0.0 0.0 0.0 0.0 124-125 2.5250000000000004 0.0 0.0 0.0 0.0 126-127 2.8125 0.0 0.0 0.0 0.0 128-129 3.0625 0.0 0.0 0.0 0.0 130-131 3.25 0.0 0.0 0.0 0.0 132-133 3.6625 0.0 0.0 0.0 0.0 134-135 3.95 0.0 0.0 0.0 0.0 136-137 4.300000000000001 0.0 0.0 0.0 0.0 138-139 4.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAATGC 10 0.006843168 144.91249 2 TCTCATT 20 3.4174576E-4 110.06013 6 >>END_MODULE SRR7172077 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172077_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9825 33.0 33.0 34.0 32.0 34.0 2 33.0495 34.0 33.0 34.0 32.0 34.0 3 33.1555 34.0 33.0 34.0 33.0 34.0 4 33.13775 34.0 33.0 34.0 33.0 34.0 5 33.14225 34.0 33.0 34.0 33.0 34.0 6 37.2955 38.0 38.0 38.0 37.0 38.0 7 37.35375 38.0 38.0 38.0 37.0 38.0 8 37.34275 38.0 38.0 38.0 37.0 38.0 9 37.341 38.0 38.0 38.0 37.0 38.0 10-14 37.318650000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.2618 38.0 38.0 38.0 37.0 38.0 20-24 37.190999999999995 38.0 38.0 38.0 37.0 38.0 25-29 37.17085 38.0 38.0 38.0 37.0 38.0 30-34 37.1866 38.0 38.0 38.0 37.0 38.0 35-39 37.1202 38.0 38.0 38.0 36.8 38.0 40-44 37.059999999999995 38.0 38.0 38.0 36.6 38.0 45-49 37.13440000000001 38.0 38.0 38.0 36.8 38.0 50-54 37.11045 38.0 38.0 38.0 37.0 38.0 55-59 37.081450000000004 38.0 38.0 38.0 36.8 38.0 60-64 37.0041 38.0 38.0 38.0 36.6 38.0 65-69 36.97855 38.0 38.0 38.0 36.0 38.0 70-74 36.9831 38.0 38.0 38.0 36.2 38.0 75-79 36.89475 38.0 38.0 38.0 36.0 38.0 80-84 36.79485 38.0 38.0 38.0 35.6 38.0 85-89 36.6573 38.0 38.0 38.0 35.0 38.0 90-94 36.51090000000001 38.0 38.0 38.0 34.2 38.0 95-99 36.27395 38.0 38.0 38.0 33.8 38.0 100-104 36.2345 38.0 38.0 38.0 34.0 38.0 105-109 36.254949999999994 38.0 38.0 38.0 34.0 38.0 110-114 36.11895 38.0 38.0 38.0 33.8 38.0 115-119 35.95719999999999 38.0 37.6 38.0 33.0 38.0 120-124 35.83495 38.0 37.2 38.0 32.4 38.0 125-129 35.74785000000001 38.0 37.0 38.0 32.2 38.0 130-134 35.36665000000001 38.0 36.6 38.0 31.0 38.0 135-139 35.07365 38.0 36.0 38.0 31.0 38.0 140-144 34.44015 38.0 35.4 38.0 26.8 38.0 145-149 33.679050000000004 38.0 34.4 38.0 22.6 38.0 150-151 28.8735 35.5 18.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 3.0 4 2.0 5 0.0 6 0.0 7 1.0 8 2.0 9 0.0 10 2.0 11 0.0 12 3.0 13 1.0 14 2.0 15 5.0 16 2.0 17 2.0 18 7.0 19 4.0 20 4.0 21 6.0 22 6.0 23 8.0 24 10.0 25 10.0 26 25.0 27 14.0 28 20.0 29 36.0 30 56.0 31 50.0 32 68.0 33 83.0 34 154.0 35 219.0 36 567.0 37 2625.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.400050037528146 13.41005754315737 17.91343507630723 35.27645734300726 2 21.866399799849887 23.367525644233176 38.50387790843132 16.262196647485613 3 20.465349011758818 25.719289467100324 31.998999249437077 21.816362271703778 4 23.817863397548162 34.42581936452339 21.115836877658246 20.640480360270203 5 22.066549912434326 38.32874655991994 22.34175631723793 17.262947210407805 6 17.95 38.45 25.25 18.35 7 15.950000000000001 16.175 47.225 20.65 8 20.7 22.35 28.15 28.799999999999997 9 22.975 23.65 28.299999999999997 25.074999999999996 10-14 22.88614430721536 29.04145207260363 26.08630431521576 21.986099304965247 15-19 22.33 28.075 28.52 21.075 20-24 22.495 28.18 28.005000000000003 21.32 25-29 22.74 28.255000000000003 28.595 20.41 30-34 23.005 28.22 28.060000000000002 20.715 35-39 22.75 28.544999999999998 27.950000000000003 20.755000000000003 40-44 22.845 27.915 28.33 20.91 45-49 22.52 27.85 28.52 21.11 50-54 23.05 28.105000000000004 28.634999999999998 20.21 55-59 22.465 28.34 28.365000000000002 20.830000000000002 60-64 22.955000000000002 28.299999999999997 27.839999999999996 20.905 65-69 23.125 27.935 28.57 20.369999999999997 70-74 23.205000000000002 27.79 29.115000000000002 19.89 75-79 22.7 28.22 28.565 20.515 80-84 23.165 28.000000000000004 28.43 20.405 85-89 23.095 28.16 27.839999999999996 20.905 90-94 23.294999999999998 28.04 28.470000000000002 20.195 95-99 23.535 27.965 28.42 20.080000000000002 100-104 23.345 28.134999999999998 28.035 20.485 105-109 23.585 27.99 28.46 19.965 110-114 23.68 28.205000000000002 28.28 19.835 115-119 23.45 28.060000000000002 28.299999999999997 20.19 120-124 23.82 28.32 27.744999999999997 20.115 125-129 23.880000000000003 27.48 28.43 20.21 130-134 23.705000000000002 28.32 27.985 19.99 135-139 23.380000000000003 28.24 27.975 20.405 140-144 24.285 28.225 27.839999999999996 19.650000000000002 145-149 24.01 28.22 27.88 19.89 150-151 24.6125 27.825 28.037499999999998 19.525000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.5 22 1.5 23 2.5 24 4.0 25 4.0 26 2.5 27 3.0 28 7.0 29 10.5 30 11.5 31 18.0 32 32.0 33 43.0 34 47.0 35 62.0 36 89.5 37 124.5 38 160.0 39 187.0 40 213.0 41 241.0 42 276.0 43 294.5 44 282.0 45 276.5 46 268.0 47 237.0 48 214.0 49 191.0 50 153.0 51 123.5 52 105.5 53 81.0 54 58.0 55 42.0 56 28.5 57 23.5 58 18.0 59 10.5 60 10.0 61 8.5 62 7.5 63 7.5 64 6.0 65 4.0 66 1.5 67 1.5 68 1.5 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.075 3 0.075 4 0.075 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.7125 0.0 0.0 0.0 0.0 108-109 0.85 0.0 0.0 0.0 0.0 110-111 1.1 0.0 0.0 0.0 0.0 112-113 1.275 0.0 0.0 0.0 0.0 114-115 1.475 0.0 0.0 0.0 0.0 116-117 1.7125 0.0 0.0 0.0 0.0 118-119 1.85 0.0 0.0 0.0 0.0 120-121 2.0625 0.0 0.0 0.0 0.0 122-123 2.3499999999999996 0.0 0.0 0.0 0.0 124-125 2.575 0.0 0.0 0.0 0.0 126-127 2.8625 0.0 0.0 0.0 0.0 128-129 3.1125 0.0 0.0 0.0 0.0 130-131 3.3 0.0 0.0 0.0 0.0 132-133 3.7125 0.0 0.0 0.0 0.0 134-135 4.025 0.0 0.0 0.0 0.0 136-137 4.375 0.0 0.0 0.0 0.0 138-139 4.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCGGAA 10 0.006830828 145.0 6 CTTGGAG 10 0.006830828 145.0 1 AAAAATG 10 0.006830828 145.0 2 >>END_MODULE Read 732988 spots for SRR7172077.sra Written 732988 spots for SRR7172077.sra Read 732988 spots for SRR7172077.sra Written 732988 spots for SRR7172077.sra Read 732988 spots for SRR7172077.sra Written 732988 spots for SRR7172077.sra Read 732988 spots for SRR7172077.sra Written 732988 spots for SRR7172077.sra Read 732988 spots for SRR7172077.sra Written 732988 spots for SRR7172077.sra Read 732988 spots for SRR7172077.sra Written 732988 spots for SRR7172077.sra Read 732988 spots for SRR7172077.sra Written 732988 spots for SRR7172077.sra Read 732988 spots for SRR7172077.sra Written 732988 spots for SRR7172077.sra Read 732988 spots for SRR7172077.sra Written 732988 spots for SRR7172077.sra Read 732988 spots for SRR7172077.sra Written 732988 spots for SRR7172077.sra Read 732988 spots for SRR7172077.sra Written 732988 spots for SRR7172077.sra Read 732988 spots for SRR7172077.sra Written 732988 spots for SRR7172077.sra Read 732988 spots for SRR7172077.sra Written 732988 spots for SRR7172077.sra Read 732988 spots for SRR7172077.sra Written 732988 spots for SRR7172077.sra Read 732988 spots for SRR7172077.sra Written 732988 spots for SRR7172077.sra Read 732988 spots for SRR7172077.sra Written 732988 spots for SRR7172077.sra Read 732988 spots for SRR7172077.sra Written 732988 spots for SRR7172077.sra Read 732988 spots for SRR7172077.sra Written 732988 spots for SRR7172077.sra Read 732988 spots for SRR7172077.sra Written 732988 spots for SRR7172077.sra Read 732988 spots for SRR7172077.sra Written 732988 spots for SRR7172077.sra SRR ids: ['SRR7172077.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bm91i8zv SRR7172077.sra spots: 14659760 blocks: [[1, 732988], [732989, 1465976], [1465977, 2198964], [2198965, 2931952], [2931953, 3664940], [3664941, 4397928], [4397929, 5130916], [5130917, 5863904], [5863905, 6596892], [6596893, 7329880], [7329881, 8062868], [8062869, 8795856], [8795857, 9528844], [9528845, 10261832], [10261833, 10994820], [10994821, 11727808], [11727809, 12460796], [12460797, 13193784], [13193785, 13926772], [13926773, 14659760]] SRR7172077 file size 4946011 SRR7172077 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172077 SRR7172077_1.fastq SRR7172077_2.fastq Input file: SRR7172077_1.fastq Paired file: SRR7172077_2.fastq trimmed: SRR7172077-trimmed-pair1.fastq, SRR7172077-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 17:10:05 2025 >> started Fri Feb 14 17:10:21 2025 >> done (15.480s) 14659760 read pairs processed; of these: 9011 ( 0.06%) short read pairs filtered out after trimming by size control 10255 ( 0.07%) empty read pairs filtered out after trimming by size control 14640494 (99.87%) read pairs available; of these: 7063988 (48.25%) trimmed read pairs available after processing 7576506 (51.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 1 0.00% 21 3 0.00% 22 0 0.00% 23 1 0.00% 24 4 0.00% 25 2 0.00% 26 6 0.00% 27 5 0.00% 28 4 0.00% 29 2 0.00% 30 4 0.00% 31 0 0.00% 32 2 0.00% 33 2 0.00% 34 8 0.00% 35 2 0.00% 36 5 0.00% 37 3 0.00% 38 5 0.00% 39 3 0.00% 40 4 0.00% 41 9 0.00% 42 14 0.00% 43 9 0.00% 44 7 0.00% 45 7 0.00% 46 9 0.00% 47 9 0.00% 48 15 0.00% 49 14 0.00% 50 17 0.00% 51 19 0.00% 52 16 0.00% 53 17 0.00% 54 34 0.00% 55 34 0.00% 56 47 0.00% 57 36 0.00% 58 59 0.00% 59 69 0.00% 60 94 0.00% 61 68 0.00% 62 85 0.00% 63 110 0.00% 64 105 0.00% 65 143 0.00% 66 146 0.00% 67 157 0.00% 68 180 0.00% 69 180 0.00% 70 208 0.00% 71 237 0.00% 72 306 0.00% 73 346 0.00% 74 404 0.00% 75 463 0.00% 76 539 0.00% 77 584 0.00% 78 680 0.00% 79 863 0.01% 80 874 0.01% 81 987 0.01% 82 1197 0.01% 83 1421 0.01% 84 2297 0.02% 85 2673 0.02% 86 2686 0.02% 87 3041 0.02% 88 3303 0.02% 89 3239 0.02% 90 3452 0.02% 91 3516 0.02% 92 4018 0.03% 93 4326 0.03% 94 4634 0.03% 95 5035 0.03% 96 5335 0.04% 97 5868 0.04% 98 6237 0.04% 99 7092 0.05% 100 8259 0.06% 101 8050 0.05% 102 8353 0.06% 103 9100 0.06% 104 9513 0.06% 105 10271 0.07% 106 10724 0.07% 107 11186 0.08% 108 11991 0.08% 109 12559 0.09% 110 13460 0.09% 111 14099 0.10% 112 14676 0.10% 113 15474 0.11% 114 16355 0.11% 115 17279 0.12% 116 18224 0.12% 117 19050 0.13% 118 20146 0.14% 119 20949 0.14% 120 21857 0.15% 121 22925 0.16% 122 23966 0.16% 123 25426 0.17% 124 26330 0.18% 125 27917 0.19% 126 29040 0.20% 127 30261 0.21% 128 31728 0.22% 129 33607 0.23% 130 35223 0.24% 131 36642 0.25% 132 39568 0.27% 133 41560 0.28% 134 44504 0.30% 135 47426 0.32% 136 51235 0.35% 137 54585 0.37% 138 59487 0.41% 139 65783 0.45% 140 75098 0.51% 141 78585 0.54% 142 88125 0.60% 143 99683 0.68% 144 116727 0.80% 145 140479 0.96% 146 176214 1.20% 147 239620 1.64% 148 366197 2.50% 149 733797 5.01% 150 3853038 26.32% 151 7576506 51.75% 14640494 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.73 fanout-score-rank=26 prefix-density=0.39 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.04 sequence-density-rank=29 fanout-score=23.39 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=5.1 sequence=CAAAGATCATGCCACCAAA criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=24 prefix-density=0.41 prefix-fanout=2.3 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=23 fanout-score=24.20 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=4.1 sequence=AGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGG SRR7172077 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 17:11:26 Started mapping on | Feb 14 17:11:27 Finished on | Feb 14 17:14:18 Mapping speed, Million of reads per hour | 308.22 Number of input reads | 14640494 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 13381080 Uniquely mapped reads % | 91.40% Average mapped length | 295.58 Number of splices: Total | 12886804 Number of splices: Annotated (sjdb) | 12633822 Number of splices: GT/AG | 12668867 Number of splices: GC/AG | 166316 Number of splices: AT/AC | 10962 Number of splices: Non-canonical | 40659 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.04% Deletion average length | 2.23 Insertion rate per base | 0.03% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 407025 % of reads mapped to multiple loci | 2.78% Number of reads mapped to too many loci | 39863 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.46% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 861416 861416 861416 N_multimapping 407025 407025 407025 N_noFeature 453027 13246993 517733 N_ambiguous 150761 884 80821 UnstrandedReadsAssigned:12777292 PositiveStrandReadsAssigned:133203 NegativeStrandReadsAssigned:12782526 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172077 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172077-trimmed-pair1.fastq SRR7172077-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,640,494 reads, 12,673,488 reads pseudoaligned [quant] estimated average fragment length: 249.946 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,108 rounds 52401 SRR7172077.ke.tsv 34699 SRR7172077.se.tsv 87100 total ==> SRR7172077.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1769.05 1499 67.8509 Potri.005G024800.1.v4.1 1035 786.054 250 25.4673 Potri.004G059700.1.v4.1 961 712.06 22 2.47401 Potri.007G009000.2.v4.1 1416 1167.05 0 0 Potri.003G141000.2.v4.1 2943 2694.05 518 15.3964 Potri.016G087400.1.v4.1 270 75.6702 637 674.077 Potri.015G069301.1.v4.1 564 319.477 0 0 Potri.010G195200.1.v4.1 1773 1524.05 355 18.6519 Potri.012G127500.1.v4.1 977 728.06 3942 433.556 ==> SRR7172077.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 62 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 431 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 260 SRR7172077 completed mapping pipeline successfully