Starting /dee2/code/volunteer_pipeline.sh SRR7172078 current disk space = 3087907979264 free memory = 1574370120 SRR7172078 SRAfilesize 8224322126e81be35a1acacd5f27929f SRR7172078.sra SRR7172078.sra file validated SRR7172078 is paired end SRR7172078 is conventional basespace SRR7172078 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172078_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4225 33.0 33.0 34.0 31.0 34.0 2 32.21725 33.0 32.0 34.0 28.0 34.0 3 32.14325 33.0 33.0 33.0 29.0 34.0 4 32.29025 33.0 33.0 34.0 31.0 34.0 5 32.82775 33.0 33.0 34.0 31.0 34.0 6 36.326 38.0 36.0 38.0 34.0 38.0 7 37.033 38.0 37.0 38.0 35.0 38.0 8 37.2695 38.0 38.0 38.0 36.0 38.0 9 37.3475 38.0 38.0 38.0 37.0 38.0 10-14 37.3728 38.0 38.0 38.0 37.0 38.0 15-19 37.40195 38.0 38.0 38.0 37.0 38.0 20-24 37.3757 38.0 38.0 38.0 37.0 38.0 25-29 37.369749999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.37215 38.0 38.0 38.0 37.0 38.0 35-39 37.31955 38.0 38.0 38.0 37.0 38.0 40-44 37.2524 38.0 38.0 38.0 37.0 38.0 45-49 37.13969999999999 38.0 38.0 38.0 36.2 38.0 50-54 37.054849999999995 38.0 38.0 38.0 36.0 38.0 55-59 37.01049999999999 38.0 38.0 38.0 35.8 38.0 60-64 36.84255 38.0 38.0 38.0 35.2 38.0 65-69 36.82684999999999 38.0 38.0 38.0 35.0 38.0 70-74 36.7308 38.0 38.0 38.0 34.8 38.0 75-79 36.632000000000005 38.0 38.0 38.0 34.2 38.0 80-84 36.5076 38.0 38.0 38.0 34.0 38.0 85-89 36.40635 38.0 37.2 38.0 34.0 38.0 90-94 36.32215 38.0 37.0 38.0 33.8 38.0 95-99 36.1078 38.0 37.0 38.0 33.2 38.0 100-104 35.9037 38.0 37.0 38.0 32.4 38.0 105-109 35.576499999999996 38.0 36.2 38.0 30.2 38.0 110-114 35.41445 38.0 36.0 38.0 29.4 38.0 115-119 35.30865 38.0 36.0 38.0 29.2 38.0 120-124 35.057550000000006 38.0 35.4 38.0 28.2 38.0 125-129 34.7803 38.0 35.0 38.0 27.8 38.0 130-134 34.44435 38.0 35.0 38.0 25.8 38.0 135-139 34.04055 38.0 34.2 38.0 23.6 38.0 140-144 33.24375 38.0 33.8 38.0 18.6 38.0 145-149 32.5168 38.0 33.2 38.0 14.0 38.0 150-151 28.350125 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 2.0 14 0.0 15 3.0 16 1.0 17 6.0 18 3.0 19 4.0 20 2.0 21 8.0 22 5.0 23 7.0 24 9.0 25 13.0 26 13.0 27 31.0 28 23.0 29 37.0 30 50.0 31 72.0 32 100.0 33 115.0 34 219.0 35 446.0 36 1024.0 37 1804.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.45977011494253 16.431556948798328 15.62173458725183 37.48693834900732 2 17.97949487371843 26.056514128532132 37.53438359589897 18.42960740185046 3 18.675 30.65 27.400000000000002 23.275000000000002 4 21.45 37.05 22.275 19.225 5 20.7 37.5 24.5 17.299999999999997 6 17.275 35.199999999999996 26.625 20.9 7 12.049999999999999 21.525 45.35 21.075 8 18.45 20.474999999999998 30.3 30.775000000000002 9 17.7 22.175 31.1 29.025000000000002 10-14 19.33 30.005 26.72 23.945 15-19 19.29 29.185 27.805000000000003 23.72 20-24 19.48 29.630000000000003 28.255000000000003 22.634999999999998 25-29 19.825 29.909999999999997 27.625 22.64 30-34 19.785 28.999999999999996 28.62 22.595000000000002 35-39 19.81 28.99 27.950000000000003 23.25 40-44 19.82 29.28 28.1 22.8 45-49 19.85 29.044999999999998 27.805000000000003 23.3 50-54 19.885 29.42 27.49 23.205000000000002 55-59 19.470000000000002 29.935000000000002 27.485 23.11 60-64 19.435 29.465000000000003 27.765 23.335 65-69 19.689999999999998 28.994999999999997 27.925 23.39 70-74 19.81 29.025000000000002 27.925 23.24 75-79 19.61 29.310000000000002 27.905 23.175 80-84 19.625 29.385 27.04 23.95 85-89 20.01 28.470000000000002 28.16 23.36 90-94 20.05 28.48 28.51 22.96 95-99 20.025000000000002 28.994999999999997 28.389999999999997 22.59 100-104 20.28 29.48 27.125 23.115 105-109 20.119999999999997 28.849999999999998 28.144999999999996 22.884999999999998 110-114 20.145 28.660000000000004 27.755000000000003 23.44 115-119 20.599999999999998 29.035 27.765 22.6 120-124 20.580000000000002 28.73 26.979999999999997 23.71 125-129 21.135 28.705000000000002 26.93 23.23 130-134 20.830000000000002 28.744999999999997 27.24 23.185 135-139 20.865000000000002 28.544999999999998 27.04 23.549999999999997 140-144 21.095 28.525 26.615 23.765 145-149 20.945 28.799999999999997 26.25 24.005000000000003 150-151 20.7125 28.15 26.0125 25.124999999999996 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 2.0 21 1.5 22 0.5 23 1.0 24 2.5 25 5.0 26 7.5 27 8.5 28 15.5 29 20.5 30 25.0 31 31.0 32 50.0 33 75.0 34 99.0 35 111.5 36 106.5 37 136.0 38 170.5 39 188.0 40 213.0 41 234.0 42 243.5 43 256.5 44 261.0 45 243.0 46 228.5 47 222.0 48 199.5 49 175.5 50 143.0 51 111.5 52 95.0 53 74.5 54 56.5 55 41.5 56 32.5 57 25.0 58 18.0 59 13.0 60 11.5 61 10.5 62 8.5 63 5.5 64 3.0 65 4.5 66 3.5 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.3 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.08952959028832 97.95 2 0.7334344967121902 1.4500000000000002 3 0.10116337885685382 0.3 4 0.07587253414264036 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.025 0.0 0.0 0.0 2 0.0 0.025 0.0 0.0 0.0 3 0.0 0.025 0.0 0.0 0.0 4 0.0 0.025 0.0 0.0 0.0 5 0.0 0.025 0.0 0.0 0.0 6 0.0 0.025 0.0 0.0 0.0 7 0.0 0.025 0.0 0.0 0.0 8 0.0 0.025 0.0 0.0 0.0 9 0.0 0.025 0.0 0.0 0.0 10-11 0.0 0.025 0.0 0.0 0.0 12-13 0.0 0.025 0.0 0.0 0.0 14-15 0.0 0.025 0.0 0.0 0.0 16-17 0.0 0.025 0.0 0.0 0.0 18-19 0.0 0.025 0.0 0.0 0.0 20-21 0.0 0.025 0.0 0.0 0.0 22-23 0.0 0.025 0.0 0.0 0.0 24-25 0.0 0.025 0.0 0.0 0.0 26-27 0.0 0.025 0.0 0.0 0.0 28-29 0.0 0.025 0.0 0.0 0.0 30-31 0.0 0.025 0.0 0.0 0.0 32-33 0.0 0.025 0.0 0.0 0.0 34-35 0.0 0.025 0.0 0.0 0.0 36-37 0.0 0.025 0.0 0.0 0.0 38-39 0.0 0.025 0.0 0.0 0.0 40-41 0.0 0.025 0.0 0.0 0.0 42-43 0.0 0.025 0.0 0.0 0.0 44-45 0.0 0.025 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0125 0.025 0.0 0.0 0.0 66-67 0.025 0.025 0.0 0.0 0.0 68-69 0.037500000000000006 0.025 0.0 0.0 0.0 70-71 0.075 0.025 0.0 0.0 0.0 72-73 0.1 0.025 0.0 0.0 0.0 74-75 0.1375 0.025 0.0 0.0 0.0 76-77 0.175 0.025 0.0 0.0 0.0 78-79 0.175 0.025 0.0 0.0 0.0 80-81 0.1875 0.025 0.0 0.0 0.0 82-83 0.25 0.025 0.0 0.0 0.0 84-85 0.2625 0.025 0.0 0.0 0.0 86-87 0.3125 0.025 0.0 0.0 0.0 88-89 0.4125 0.025 0.0 0.0 0.0 90-91 0.5 0.025 0.0 0.0 0.0 92-93 0.525 0.025 0.0 0.0 0.0 94-95 0.6499999999999999 0.025 0.0 0.0 0.0 96-97 0.8125 0.025 0.0 0.0 0.0 98-99 0.9874999999999999 0.025 0.0 0.0 0.0 100-101 1.1375 0.025 0.0 0.0 0.0 102-103 1.3250000000000002 0.025 0.0 0.0 0.0 104-105 1.65 0.025 0.0 0.0 0.0 106-107 1.9500000000000002 0.025 0.0 0.0 0.0 108-109 2.275 0.025 0.0 0.0 0.0 110-111 2.55 0.025 0.0 0.0 0.0 112-113 2.925 0.025 0.0 0.0 0.0 114-115 3.4625000000000004 0.025 0.0 0.0 0.0 116-117 4.0375 0.025 0.0 0.0 0.0 118-119 4.5375 0.025 0.0 0.0 0.0 120-121 5.0375 0.025 0.0 0.0 0.0 122-123 5.6 0.025 0.0 0.0 0.0 124-125 6.25 0.025 0.0 0.0 0.0 126-127 6.737500000000001 0.025 0.0 0.0 0.0 128-129 7.2875 0.025 0.0 0.0 0.0 130-131 8.0375 0.025 0.0 0.0 0.0 132-133 8.75 0.025 0.0 0.0 0.0 134-135 9.649999999999999 0.025 0.0 0.0 0.0 136-137 10.375 0.025 0.0 0.0 0.0 138-139 11.3875 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGAAGC 10 0.0068343505 144.975 7 AAAGATC 10 0.0068343505 144.975 2 >>END_MODULE SRR7172078 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172078_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.12925 33.0 33.0 34.0 33.0 34.0 2 33.19025 34.0 33.0 34.0 33.0 34.0 3 33.28925 34.0 33.0 34.0 33.0 34.0 4 33.266 34.0 33.0 34.0 33.0 34.0 5 33.259 34.0 33.0 34.0 33.0 34.0 6 37.376 38.0 38.0 38.0 37.0 38.0 7 37.41925 38.0 38.0 38.0 37.0 38.0 8 37.46325 38.0 38.0 38.0 38.0 38.0 9 37.421 38.0 38.0 38.0 37.0 38.0 10-14 37.410849999999996 38.0 38.0 38.0 37.2 38.0 15-19 37.396300000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.39245 38.0 38.0 38.0 37.0 38.0 25-29 37.3566 38.0 38.0 38.0 37.0 38.0 30-34 37.350449999999995 38.0 38.0 38.0 37.0 38.0 35-39 37.21255 38.0 38.0 38.0 36.8 38.0 40-44 37.2473 38.0 38.0 38.0 37.0 38.0 45-49 37.24065 38.0 38.0 38.0 37.0 38.0 50-54 37.190900000000006 38.0 38.0 38.0 36.4 38.0 55-59 37.161950000000004 38.0 38.0 38.0 36.0 38.0 60-64 37.11814999999999 38.0 38.0 38.0 36.0 38.0 65-69 37.0298 38.0 38.0 38.0 36.0 38.0 70-74 36.980450000000005 38.0 38.0 38.0 36.0 38.0 75-79 36.9057 38.0 38.0 38.0 35.8 38.0 80-84 36.803999999999995 38.0 38.0 38.0 35.0 38.0 85-89 36.726299999999995 38.0 38.0 38.0 34.8 38.0 90-94 36.564800000000005 38.0 38.0 38.0 34.0 38.0 95-99 36.3731 38.0 38.0 38.0 34.0 38.0 100-104 36.28885 38.0 37.6 38.0 34.0 38.0 105-109 36.095749999999995 38.0 37.2 38.0 33.2 38.0 110-114 35.85979999999999 38.0 37.0 38.0 32.2 38.0 115-119 35.7136 38.0 36.6 38.0 31.8 38.0 120-124 35.3935 38.0 36.0 38.0 30.2 38.0 125-129 34.96939999999999 38.0 35.4 38.0 28.0 38.0 130-134 34.72795 38.0 35.0 38.0 27.6 38.0 135-139 34.464549999999996 38.0 35.0 38.0 26.2 38.0 140-144 33.76990000000001 38.0 34.2 38.0 22.2 38.0 145-149 32.857600000000005 38.0 33.4 38.0 16.6 38.0 150-151 28.411875000000002 34.5 23.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 2.0 15 2.0 16 0.0 17 4.0 18 3.0 19 7.0 20 3.0 21 8.0 22 7.0 23 4.0 24 8.0 25 12.0 26 16.0 27 11.0 28 28.0 29 38.0 30 46.0 31 56.0 32 70.0 33 100.0 34 177.0 35 316.0 36 891.0 37 2186.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.475 14.174999999999999 18.825 33.525 2 23.1 21.975 37.8 17.125 3 21.7 26.525 30.575000000000003 21.2 4 24.099999999999998 35.5 20.775 19.625 5 23.75 35.375 23.325000000000003 17.549999999999997 6 18.325 37.05 24.05 20.575 7 18.275 15.45 44.474999999999994 21.8 8 20.575 22.75 27.85 28.825 9 21.65 24.125 28.175 26.05 10-14 22.919999999999998 28.560000000000002 26.735 21.785 15-19 23.655 27.41 28.595 20.34 20-24 23.04 28.59 27.644999999999996 20.724999999999998 25-29 23.665 27.994999999999997 28.455000000000002 19.885 30-34 23.095 28.055000000000003 28.17 20.68 35-39 23.095 27.700000000000003 28.185 21.02 40-44 23.330000000000002 28.68 27.36 20.630000000000003 45-49 23.57 27.16 29.075 20.195 50-54 23.45 27.365000000000002 29.14 20.044999999999998 55-59 22.915 27.905 28.64 20.54 60-64 22.919999999999998 28.144999999999996 28.77 20.165 65-69 22.915 27.889999999999997 28.575 20.62 70-74 23.1 28.199999999999996 28.444999999999997 20.255000000000003 75-79 23.435 28.33 28.12 20.115 80-84 22.965 27.495000000000005 28.84 20.7 85-89 23.57 27.83 28.285 20.315 90-94 23.57 28.03 28.825 19.575 95-99 24.245 28.325 27.72 19.71 100-104 23.105 27.825 28.475 20.595 105-109 23.855 28.255000000000003 28.005000000000003 19.885 110-114 23.96 28.28 27.99 19.77 115-119 23.48 28.605000000000004 27.88 20.035 120-124 24.395 27.965 28.025 19.615 125-129 24.25 28.035 28.194999999999997 19.52 130-134 24.62 28.51 27.72 19.15 135-139 25.230000000000004 28.16 27.62 18.990000000000002 140-144 24.86 28.68 27.43 19.03 145-149 25.775 27.92 27.54 18.765 150-151 26.200000000000003 27.500000000000004 27.450000000000003 18.85 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 0.5 25 1.0 26 2.5 27 4.0 28 9.5 29 13.0 30 17.5 31 25.0 32 32.5 33 46.5 34 65.0 35 73.0 36 83.5 37 114.5 38 150.0 39 173.0 40 193.0 41 231.0 42 260.0 43 257.5 44 273.0 45 281.5 46 260.5 47 258.0 48 235.0 49 195.0 50 158.5 51 130.0 52 103.5 53 79.0 54 68.5 55 50.5 56 35.5 57 27.0 58 20.0 59 17.0 60 13.0 61 9.0 62 8.0 63 5.0 64 3.0 65 2.5 66 2.5 67 3.0 68 2.0 69 1.0 70 0.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.85815782796244 97.39999999999999 2 0.8880994671403196 1.7500000000000002 3 0.17761989342806395 0.525 4 0.050748540979446845 0.2 5 0.025374270489723422 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.38749999999999996 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.6499999999999999 0.0 0.0 0.0 0.0 96-97 0.8125 0.0 0.0 0.0 0.0 98-99 0.975 0.0 0.0 0.0 0.0 100-101 1.1375 0.0 0.0 0.0 0.0 102-103 1.3250000000000002 0.0 0.0 0.0 0.0 104-105 1.65 0.0 0.0 0.0 0.0 106-107 1.975 0.0 0.0 0.0 0.0 108-109 2.3125 0.0 0.0 0.0 0.0 110-111 2.575 0.0 0.0 0.0 0.0 112-113 2.9875 0.0 0.0 0.0 0.0 114-115 3.5374999999999996 0.0 0.0 0.0 0.0 116-117 4.125 0.0 0.0 0.0 0.0 118-119 4.637499999999999 0.0 0.0 0.0 0.0 120-121 5.125 0.0 0.0 0.0 0.0 122-123 5.6625 0.0 0.0 0.0 0.0 124-125 6.3125 0.0 0.0 0.0 0.0 126-127 6.8375 0.0 0.0 0.0 0.0 128-129 7.3875 0.0 0.0 0.0 0.0 130-131 8.1375 0.0 0.0 0.0 0.0 132-133 8.8625 0.0 0.0 0.0 0.0 134-135 9.8 0.0 0.0 0.0 0.0 136-137 10.625 0.0 0.0 0.0 0.0 138-139 11.662500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 603226 spots for SRR7172078.sra Written 603226 spots for SRR7172078.sra Read 603226 spots for SRR7172078.sra Written 603226 spots for SRR7172078.sra Read 603226 spots for SRR7172078.sra Written 603226 spots for SRR7172078.sra Read 603226 spots for SRR7172078.sra Written 603226 spots for SRR7172078.sra Read 603226 spots for SRR7172078.sra Written 603226 spots for SRR7172078.sra Read 603226 spots for SRR7172078.sra Written 603226 spots for SRR7172078.sra Read 603226 spots for SRR7172078.sra Written 603226 spots for SRR7172078.sra Read 603226 spots for SRR7172078.sra Written 603226 spots for SRR7172078.sra Read 603226 spots for SRR7172078.sra Written 603226 spots for SRR7172078.sra Read 603226 spots for SRR7172078.sra Written 603226 spots for SRR7172078.sra Read 603226 spots for SRR7172078.sra Written 603226 spots for SRR7172078.sra Read 603226 spots for SRR7172078.sra Written 603226 spots for SRR7172078.sra Read 603226 spots for SRR7172078.sra Written 603226 spots for SRR7172078.sra Read 603226 spots for SRR7172078.sra Written 603226 spots for SRR7172078.sra Read 603226 spots for SRR7172078.sra Written 603226 spots for SRR7172078.sra Read 603226 spots for SRR7172078.sra Written 603226 spots for SRR7172078.sra Read 603226 spots for SRR7172078.sra Written 603226 spots for SRR7172078.sra Read 603226 spots for SRR7172078.sra Written 603226 spots for SRR7172078.sra Read 603233 spots for SRR7172078.sra Written 603233 spots for SRR7172078.sra Read 603226 spots for SRR7172078.sra Written 603226 spots for SRR7172078.sra SRR ids: ['SRR7172078.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cfz_loww SRR7172078.sra spots: 12064527 blocks: [[1, 603226], [603227, 1206452], [1206453, 1809678], [1809679, 2412904], [2412905, 3016130], [3016131, 3619356], [3619357, 4222582], [4222583, 4825808], [4825809, 5429034], [5429035, 6032260], [6032261, 6635486], [6635487, 7238712], [7238713, 7841938], [7841939, 8445164], [8445165, 9048390], [9048391, 9651616], [9651617, 10254842], [10254843, 10858068], [10858069, 11461294], [11461295, 12064527]] SRR7172078 file size 4066571 SRR7172078 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172078 SRR7172078_1.fastq SRR7172078_2.fastq Input file: SRR7172078_1.fastq Paired file: SRR7172078_2.fastq trimmed: SRR7172078-trimmed-pair1.fastq, SRR7172078-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 03:58:24 2025 >> started Fri Feb 14 03:58:37 2025 >> done (13.502s) 12064527 read pairs processed; of these: 6078 ( 0.05%) short read pairs filtered out after trimming by size control 3823 ( 0.03%) empty read pairs filtered out after trimming by size control 12054626 (99.92%) read pairs available; of these: 8077299 (67.01%) trimmed read pairs available after processing 3977327 (32.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 4 0.00% 21 7 0.00% 22 0 0.00% 23 6 0.00% 24 2 0.00% 25 7 0.00% 26 3 0.00% 27 4 0.00% 28 6 0.00% 29 1 0.00% 30 5 0.00% 31 3 0.00% 32 9 0.00% 33 5 0.00% 34 6 0.00% 35 5 0.00% 36 4 0.00% 37 8 0.00% 38 6 0.00% 39 6 0.00% 40 10 0.00% 41 15 0.00% 42 12 0.00% 43 22 0.00% 44 21 0.00% 45 15 0.00% 46 23 0.00% 47 26 0.00% 48 35 0.00% 49 40 0.00% 50 33 0.00% 51 57 0.00% 52 59 0.00% 53 66 0.00% 54 81 0.00% 55 87 0.00% 56 106 0.00% 57 119 0.00% 58 166 0.00% 59 156 0.00% 60 190 0.00% 61 210 0.00% 62 230 0.00% 63 275 0.00% 64 283 0.00% 65 347 0.00% 66 375 0.00% 67 452 0.00% 68 520 0.00% 69 603 0.01% 70 629 0.01% 71 755 0.01% 72 933 0.01% 73 1092 0.01% 74 1248 0.01% 75 1455 0.01% 76 1636 0.01% 77 1788 0.01% 78 2004 0.02% 79 2321 0.02% 80 2591 0.02% 81 2957 0.02% 82 3472 0.03% 83 4104 0.03% 84 4800 0.04% 85 5400 0.04% 86 5998 0.05% 87 6852 0.06% 88 7213 0.06% 89 7796 0.06% 90 8717 0.07% 91 9311 0.08% 92 10352 0.09% 93 10883 0.09% 94 12320 0.10% 95 12987 0.11% 96 14386 0.12% 97 14897 0.12% 98 15956 0.13% 99 16928 0.14% 100 18037 0.15% 101 19153 0.16% 102 20574 0.17% 103 21924 0.18% 104 23453 0.19% 105 24873 0.21% 106 26165 0.22% 107 27685 0.23% 108 28540 0.24% 109 29574 0.25% 110 30272 0.25% 111 31659 0.26% 112 33232 0.28% 113 35336 0.29% 114 36538 0.30% 115 38494 0.32% 116 40493 0.34% 117 41139 0.34% 118 42277 0.35% 119 43007 0.36% 120 44379 0.37% 121 45831 0.38% 122 47651 0.40% 123 49424 0.41% 124 51594 0.43% 125 53306 0.44% 126 55538 0.46% 127 58121 0.48% 128 59187 0.49% 129 61327 0.51% 130 64029 0.53% 131 66829 0.55% 132 70158 0.58% 133 74484 0.62% 134 77581 0.64% 135 82061 0.68% 136 87136 0.72% 137 92528 0.77% 138 99769 0.83% 139 107050 0.89% 140 116795 0.97% 141 128150 1.06% 142 144563 1.20% 143 164037 1.36% 144 193904 1.61% 145 234898 1.95% 146 298926 2.48% 147 401058 3.33% 148 589850 4.89% 149 1003101 8.32% 150 2645097 21.94% 151 3977327 32.99% 12054626 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=3.08 fanout-score-rank=27 prefix-density=0.53 prefix-fanout=2.6 sequence=TCCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACACTTGCAGCCATTCTCAGCACCGAAGTCCATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=55.34 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=7.8 sequence=AACAGCACCACACAAATAAAACTTGTAGAGTAGATGACACACAAATTAAACCAGCACACTGGGCTTGTCGCTCTTCTCAGCTAGCGCACATTATTGAGCACACATTTTTTTTTGGGCTACACGAATTTATAAACAGGAGATAAGTCTTTCAAGGAGGACTTCCAGCAATAGGAAAGATTGTCTCTTCTTTCCATTATTATGCCTTCGTAAGACTTGCATCGATATCTTTGGTAACAGTTATCATGAAATCCATGTACTTGTCTGGGACTGGGATATTCTCGTTCAGTTTCTCATATTCAATGATCAGCCTGGCCAAGCTTCCATCATCTTTTGGTGTA criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=5.40 fanout-score-rank=23 prefix-density=1.20 prefix-fanout=2.0 sequence=TGCAAGTGTGGATCAAACTGCACCTGTGATCCATGCTCCTGCAAATGAGGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=77.75 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=4.3 sequence=CAACAATAACGTCTCTTTCAGAAGGCATTGGTATCTTTTCCCCACTTCCAAGCATTTTTTCAACTAATCTTATGTTATTAACCATTTCCTTAAATTCTTCTGGGTCTGCTGACAAAGCATGATCAGGACCTTCCATATTTTTATCTAAGGTAAAGTGCTTCTCAATAACATCCGCTCCTAAGGCAACAGAAACTACTGGGGCGAGTATTCCCAATGTATGGTCAGAATATCCCACAGGGATATTGAATATACTTTTCAAGGTT SRR7172078 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 03:59:29 Started mapping on | Feb 14 03:59:29 Finished on | Feb 14 04:02:30 Mapping speed, Million of reads per hour | 239.76 Number of input reads | 12054626 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 10612559 Uniquely mapped reads % | 88.04% Average mapped length | 288.07 Number of splices: Total | 9459888 Number of splices: Annotated (sjdb) | 9216311 Number of splices: GT/AG | 9297981 Number of splices: GC/AG | 119701 Number of splices: AT/AC | 9807 Number of splices: Non-canonical | 32399 Mismatch rate per base, % | 0.47% Deletion rate per base | 0.04% Deletion average length | 2.50 Insertion rate per base | 0.03% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 282329 % of reads mapped to multiple loci | 2.34% Number of reads mapped to too many loci | 69663 % of reads mapped to too many loci | 0.58% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.85% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1166308 1166308 1166308 N_multimapping 282329 282329 282329 N_noFeature 410758 10480527 477864 N_ambiguous 131171 884 65709 UnstrandedReadsAssigned:10070630 PositiveStrandReadsAssigned:131148 NegativeStrandReadsAssigned:10068986 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=144 echo kmer=139 SRR7172078 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172078-trimmed-pair1.fastq SRR7172078-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,054,626 reads, 9,994,337 reads pseudoaligned [quant] estimated average fragment length: 213.582 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,016 rounds 52401 SRR7172078.ke.tsv 34699 SRR7172078.se.tsv 87100 total ==> SRR7172078.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1805.42 2010 97.7155 Potri.005G024800.1.v4.1 1035 822.418 1122 119.742 Potri.004G059700.1.v4.1 961 748.433 4 0.469086 Potri.007G009000.2.v4.1 1416 1203.42 0 0 Potri.003G141000.2.v4.1 2943 2730.42 224.177 7.20622 Potri.016G087400.1.v4.1 270 92.5358 455.503 432.043 Potri.015G069301.1.v4.1 564 353.349 0 0 Potri.010G195200.1.v4.1 1773 1560.42 286 16.0868 Potri.012G127500.1.v4.1 977 764.433 28462 3267.92 ==> SRR7172078.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 490 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 220 SRR7172078 completed mapping pipeline successfully