Starting /dee2/code/volunteer_pipeline.sh SRR7172079 current disk space = 3088257437696 free memory = 1449513776 SRR7172079 SRAfilesize 540586d45a17e13a25490a84b82cb7d4 SRR7172079.sra SRR7172079.sra file validated SRR7172079 is paired end SRR7172079 is conventional basespace SRR7172079 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172079_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.65175 33.0 33.0 34.0 32.0 34.0 2 30.384 31.0 31.0 33.0 25.0 33.0 3 31.73825 33.0 31.0 33.0 29.0 33.0 4 32.598 33.0 33.0 34.0 32.0 34.0 5 32.84625 33.0 33.0 34.0 32.0 34.0 6 36.59025 38.0 37.0 38.0 34.0 38.0 7 37.23875 38.0 38.0 38.0 36.0 38.0 8 37.02125 38.0 38.0 38.0 36.0 38.0 9 37.27375 38.0 38.0 38.0 37.0 38.0 10-14 37.40555 38.0 38.0 38.0 37.0 38.0 15-19 37.411199999999994 38.0 38.0 38.0 37.0 38.0 20-24 37.398199999999996 38.0 38.0 38.0 37.2 38.0 25-29 37.21015 38.0 38.0 38.0 36.8 38.0 30-34 36.93895 38.0 38.0 38.0 35.6 38.0 35-39 36.7482 38.0 38.0 38.0 34.8 38.0 40-44 36.9718 38.0 38.0 38.0 36.0 38.0 45-49 37.02765 38.0 38.0 38.0 36.0 38.0 50-54 37.06265 38.0 38.0 38.0 36.0 38.0 55-59 37.14020000000001 38.0 38.0 38.0 36.0 38.0 60-64 37.13349999999999 38.0 38.0 38.0 36.0 38.0 65-69 37.1103 38.0 38.0 38.0 36.0 38.0 70-74 36.973749999999995 38.0 38.0 38.0 36.0 38.0 75-79 36.847750000000005 38.0 38.0 38.0 35.2 38.0 80-84 36.62605 38.0 38.0 38.0 34.4 38.0 85-89 36.53085 38.0 38.0 38.0 34.2 38.0 90-94 36.3112 38.0 38.0 38.0 33.6 38.0 95-99 36.4096 38.0 38.0 38.0 34.0 38.0 100-104 36.296850000000006 38.0 37.6 38.0 33.8 38.0 105-109 36.177949999999996 38.0 37.4 38.0 33.6 38.0 110-114 36.03085 38.0 37.0 38.0 33.2 38.0 115-119 35.818200000000004 38.0 37.0 38.0 31.0 38.0 120-124 35.55555 38.0 36.6 38.0 30.6 38.0 125-129 35.1442 38.0 36.0 38.0 29.0 38.0 130-134 34.74445000000001 38.0 35.4 38.0 27.0 38.0 135-139 34.49495 38.0 34.4 38.0 27.0 38.0 140-144 33.6053 38.0 33.2 38.0 21.4 38.0 145-149 32.803999999999995 38.0 33.0 38.0 13.6 38.0 150-151 27.825375 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 3.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 1.0 16 1.0 17 1.0 18 3.0 19 4.0 20 4.0 21 2.0 22 5.0 23 7.0 24 20.0 25 21.0 26 27.0 27 22.0 28 33.0 29 45.0 30 57.0 31 65.0 32 103.0 33 135.0 34 183.0 35 301.0 36 666.0 37 2290.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.150000000000006 17.150000000000002 16.275000000000002 32.425 2 20.640480360270203 24.093069802351764 35.47660745559169 19.78984238178634 3 18.0 30.45 27.400000000000002 24.15 4 20.175 37.5 22.375 19.950000000000003 5 21.525 36.475 23.5 18.5 6 17.150000000000002 36.15 24.9 21.8 7 12.325 21.625 45.375 20.674999999999997 8 17.599999999999998 22.125 27.375 32.9 9 16.2 22.225 32.45 29.125 10-14 19.713942788557713 30.156031206241245 26.605321064212845 23.524704940988197 15-19 19.900000000000002 28.895 27.62 23.585 20-24 19.72 28.515 28.475 23.29 25-29 20.285 28.970000000000002 27.815 22.93 30-34 19.49 29.104999999999997 27.865000000000002 23.54 35-39 20.315 29.13 27.279999999999998 23.275000000000002 40-44 20.26 29.43 27.384999999999998 22.925 45-49 19.880994049702487 29.111455572778638 27.77638881944097 23.231161558077904 50-54 19.814999999999998 28.7 27.825 23.66 55-59 20.29 28.595 27.765 23.35 60-64 20.150000000000002 28.360000000000003 27.845 23.645 65-69 20.075000000000003 28.78 27.58 23.565 70-74 20.465 28.84 27.46 23.235 75-79 20.549999999999997 28.815 27.38 23.255 80-84 20.605 28.595 27.87 22.93 85-89 20.366018300915044 28.851442572128605 27.2163608180409 23.566178308915443 90-94 20.393058958843827 28.614292143821572 27.43911586738011 23.553533029954494 95-99 20.79 27.685 28.235 23.29 100-104 20.580000000000002 28.38 27.505000000000003 23.535 105-109 20.525 28.38 27.655 23.44 110-114 20.604271922365065 28.782952328547847 27.247261267570405 23.365514481516684 115-119 20.334150367665448 29.133109899454755 26.807063178430298 23.7256765544495 120-124 21.257754652791675 28.672203321993194 26.86611967180308 23.203922353412047 125-129 21.337946943483278 28.39877639035154 26.854219948849106 23.409056717316084 130-134 20.380000000000003 28.9 27.13 23.59 135-139 20.625 28.475 27.22 23.68 140-144 21.560000000000002 27.865000000000002 27.13 23.445 145-149 21.529999999999998 27.77 27.36 23.34 150-151 21.15 28.6625 25.837500000000002 24.349999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 3.0 22 3.0 23 2.0 24 2.5 25 4.0 26 9.0 27 9.5 28 10.0 29 20.0 30 29.0 31 31.0 32 41.5 33 59.0 34 71.5 35 90.0 36 117.0 37 141.5 38 153.0 39 172.5 40 206.0 41 212.0 42 212.5 43 245.0 44 259.0 45 237.0 46 233.5 47 227.0 48 204.0 49 182.5 50 162.5 51 145.0 52 112.5 53 84.5 54 63.0 55 53.0 56 45.0 57 31.5 58 26.0 59 20.0 60 15.5 61 10.5 62 7.5 63 6.0 64 5.5 65 4.0 66 3.5 67 4.5 68 3.5 69 2.0 70 0.5 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.02 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.005 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.015 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.045 115-119 0.045 120-124 0.06 125-129 0.295 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52249308871576 99.0 2 0.42724302588590096 0.8500000000000001 3 0.050263885398341285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.45 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.7 0.0 0.0 0.0 0.0 110-111 0.8500000000000001 0.0 0.0 0.0 0.0 112-113 1.0625 0.0 0.0 0.0 0.0 114-115 1.2875 0.0 0.0 0.0 0.0 116-117 1.4249999999999998 0.0 0.0 0.0 0.0 118-119 1.6875 0.0 0.0 0.0 0.0 120-121 2.0375 0.0 0.0 0.0 0.0 122-123 2.3375 0.0 0.0 0.0 0.0 124-125 2.5625 0.0 0.0 0.0 0.0 126-127 2.9875 0.0 0.0 0.0 0.0 128-129 3.525 0.0 0.0 0.0 0.0 130-131 3.8625 0.0 0.0 0.0 0.0 132-133 4.225 0.0 0.0 0.0 0.0 134-135 4.699999999999999 0.0 0.0 0.0 0.0 136-137 5.175000000000001 0.0 0.0 0.0 0.0 138-139 5.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGTCC 10 0.006830828 145.0 8 TGAGATG 10 0.006830828 145.0 8 >>END_MODULE SRR7172079 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172079_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7035 33.0 33.0 34.0 32.0 34.0 2 32.73275 34.0 33.0 34.0 32.0 34.0 3 32.8085 34.0 33.0 34.0 32.0 34.0 4 32.74975 34.0 33.0 34.0 32.0 34.0 5 32.84 34.0 33.0 34.0 32.0 34.0 6 36.85325 38.0 38.0 38.0 36.0 38.0 7 36.95 38.0 38.0 38.0 36.0 38.0 8 36.94325 38.0 38.0 38.0 36.0 38.0 9 36.96275 38.0 38.0 38.0 36.0 38.0 10-14 36.92985 38.0 38.0 38.0 36.6 38.0 15-19 36.846700000000006 38.0 38.0 38.0 36.4 38.0 20-24 36.7745 38.0 38.0 38.0 36.0 38.0 25-29 36.80235 38.0 38.0 38.0 36.0 38.0 30-34 36.8628 38.0 38.0 38.0 36.0 38.0 35-39 36.719550000000005 38.0 38.0 38.0 36.0 38.0 40-44 36.65915 38.0 38.0 38.0 35.8 38.0 45-49 36.7541 38.0 38.0 38.0 36.0 38.0 50-54 36.73635 38.0 38.0 38.0 35.8 38.0 55-59 36.697900000000004 38.0 38.0 38.0 36.0 38.0 60-64 36.637 38.0 38.0 38.0 35.6 38.0 65-69 36.5487 38.0 38.0 38.0 35.2 38.0 70-74 36.455650000000006 38.0 38.0 38.0 34.8 38.0 75-79 36.423849999999995 38.0 38.0 38.0 34.4 38.0 80-84 36.28150000000001 38.0 38.0 38.0 34.0 38.0 85-89 36.09365 38.0 38.0 38.0 33.8 38.0 90-94 35.985949999999995 38.0 38.0 38.0 33.0 38.0 95-99 35.802 38.0 37.6 38.0 32.2 38.0 100-104 35.66495 38.0 37.0 38.0 31.0 38.0 105-109 35.62055 38.0 37.0 38.0 31.0 38.0 110-114 35.57895 38.0 37.0 38.0 31.0 38.0 115-119 35.383449999999996 38.0 37.0 38.0 29.8 38.0 120-124 35.12795 38.0 36.6 38.0 29.0 38.0 125-129 34.8008 38.0 36.0 38.0 28.0 38.0 130-134 34.471050000000005 38.0 35.8 38.0 26.4 38.0 135-139 33.729200000000006 38.0 33.6 38.0 21.2 38.0 140-144 32.933 38.0 33.0 38.0 14.6 38.0 145-149 32.1868 38.0 33.0 38.0 10.4 38.0 150-151 26.689625 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 7.0 4 6.0 5 0.0 6 2.0 7 2.0 8 3.0 9 2.0 10 1.0 11 4.0 12 3.0 13 3.0 14 3.0 15 2.0 16 4.0 17 3.0 18 2.0 19 6.0 20 8.0 21 10.0 22 14.0 23 14.0 24 15.0 25 23.0 26 22.0 27 36.0 28 36.0 29 49.0 30 55.0 31 55.0 32 80.0 33 139.0 34 174.0 35 268.0 36 600.0 37 2337.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.230692076228685 14.66900702106319 20.260782347041122 29.839518555667 2 25.475951903807616 21.367735470941884 34.4188376753507 18.7374749498998 3 20.18532431755572 26.82193839218633 31.605309291259704 21.387427998998245 4 24.486730095142715 33.92588883324987 21.907861792689033 19.679519278918377 5 22.95369211514393 37.571964956195245 21.35168961201502 18.122653316645806 6 18.575 37.325 24.7 19.400000000000002 7 17.250876314471707 16.624937406109165 43.89083625438157 22.233350025037556 8 21.405351337834457 21.530382595648913 27.031757939484873 30.03250812703176 9 22.2 25.15 28.275 24.375 10-14 24.031240612796637 28.517072193852005 26.37428657254431 21.077400620807047 15-19 22.928564272117022 27.722673078849812 28.03326320008015 21.31549944895301 20-24 22.948769261556933 28.10686411847108 27.71162697618571 21.23273964378627 25-29 23.18 28.005000000000003 27.72 21.095 30-34 23.01 27.91 27.61 21.47 35-39 23.330000000000002 27.935 27.73 21.005 40-44 23.330000000000002 27.825 28.065 20.78 45-49 23.865 27.644999999999996 27.735 20.755000000000003 50-54 22.855 28.360000000000003 27.73 21.055 55-59 23.27 27.605 28.465 20.66 60-64 23.365 28.055000000000003 27.944999999999997 20.635 65-69 23.419999999999998 28.27 27.615000000000002 20.695 70-74 23.630000000000003 27.605 28.065 20.7 75-79 23.2061603080154 27.716385819290963 28.241412070603527 20.836041802090104 80-84 23.34 27.115000000000002 28.405 21.14 85-89 23.465 27.534999999999997 28.205000000000002 20.794999999999998 90-94 23.535 28.17 27.74 20.555 95-99 23.4746949389878 27.60552110422084 27.970594118823765 20.949189837967594 100-104 23.32 27.88 28.115000000000002 20.685000000000002 105-109 23.41 27.685 28.16 20.745 110-114 23.275000000000002 27.965 28.015 20.745 115-119 23.935000000000002 27.500000000000004 27.785 20.78 120-124 23.87 27.92 27.939999999999998 20.27 125-129 23.54 28.23 27.750000000000004 20.48 130-134 23.73 27.650000000000002 28.125 20.495 135-139 23.53 27.79 28.185 20.495 140-144 24.6 27.555000000000003 27.884999999999998 19.96 145-149 24.365000000000002 27.779999999999998 27.689999999999998 20.165 150-151 24.6125 27.462500000000002 27.35 20.575 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.5 16 2.0 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 1.5 25 4.0 26 3.5 27 2.5 28 6.5 29 11.0 30 14.0 31 21.0 32 26.0 33 36.5 34 51.5 35 61.0 36 73.5 37 106.0 38 135.0 39 163.0 40 205.0 41 227.5 42 254.0 43 267.0 44 274.0 45 266.5 46 241.5 47 255.0 48 238.0 49 196.5 50 171.5 51 141.0 52 120.0 53 97.0 54 76.5 55 55.5 56 38.5 57 36.0 58 29.5 59 20.0 60 10.0 61 7.5 62 11.5 63 11.5 64 9.0 65 6.0 66 2.5 67 2.5 68 1.5 69 1.5 70 1.5 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.2 3 0.17500000000000002 4 0.15 5 0.125 6 0.0 7 0.15 8 0.025 9 0.0 10-14 0.13 15-19 0.19 20-24 0.06 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.005 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.02 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5475113122172 99.0 2 0.3770739064856712 0.75 3 0.050276520864756154 0.15 4 0.025138260432378077 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.42500000000000004 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.4875 0.0 0.0 0.0 0.0 106-107 0.6375 0.0 0.0 0.0 0.0 108-109 0.725 0.0 0.0 0.0 0.0 110-111 0.875 0.0 0.0 0.0 0.0 112-113 1.0875 0.0 0.0 0.0 0.0 114-115 1.3125 0.0 0.0 0.0 0.0 116-117 1.475 0.0 0.0 0.0 0.0 118-119 1.7374999999999998 0.0 0.0 0.0 0.0 120-121 2.0875000000000004 0.0 0.0 0.0 0.0 122-123 2.3875 0.0 0.0 0.0 0.0 124-125 2.5875 0.0 0.0 0.0 0.0 126-127 2.975 0.0 0.0 0.0 0.0 128-129 3.5374999999999996 0.0 0.0 0.0 0.0 130-131 3.875 0.0 0.0 0.0 0.0 132-133 4.2 0.0 0.0 0.0 0.0 134-135 4.6125 0.0 0.0 0.0 0.0 136-137 5.074999999999999 0.0 0.0 0.0 0.0 138-139 5.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 693385 spots for SRR7172079.sra Written 693385 spots for SRR7172079.sra Read 693385 spots for SRR7172079.sra Written 693385 spots for SRR7172079.sra Read 693385 spots for SRR7172079.sra Written 693385 spots for SRR7172079.sra Read 693385 spots for SRR7172079.sra Written 693385 spots for SRR7172079.sra Read 693385 spots for SRR7172079.sra Written 693385 spots for SRR7172079.sra Read 693385 spots for SRR7172079.sra Written 693385 spots for SRR7172079.sra Read 693385 spots for SRR7172079.sra Written 693385 spots for SRR7172079.sra Read 693385 spots for SRR7172079.sra Written 693385 spots for SRR7172079.sra Read 693385 spots for SRR7172079.sra Written 693385 spots for SRR7172079.sra Read 693385 spots for SRR7172079.sra Written 693385 spots for SRR7172079.sra Read 693385 spots for SRR7172079.sra Written 693385 spots for SRR7172079.sra Read 693385 spots for SRR7172079.sra Written 693385 spots for SRR7172079.sra Read 693385 spots for SRR7172079.sra Written 693385 spots for SRR7172079.sra Read 693385 spots for SRR7172079.sra Written 693385 spots for SRR7172079.sra Read 693385 spots for SRR7172079.sra Written 693385 spots for SRR7172079.sra Read 693385 spots for SRR7172079.sra Written 693385 spots for SRR7172079.sra Read 693385 spots for SRR7172079.sra Written 693385 spots for SRR7172079.sra Read 693404 spots for SRR7172079.sra Written 693404 spots for SRR7172079.sra Read 693385 spots for SRR7172079.sra Written 693385 spots for SRR7172079.sra Read 693385 spots for SRR7172079.sra Written 693385 spots for SRR7172079.sra SRR ids: ['SRR7172079.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_60sgqc8v SRR7172079.sra spots: 13867719 blocks: [[1, 693385], [693386, 1386770], [1386771, 2080155], [2080156, 2773540], [2773541, 3466925], [3466926, 4160310], [4160311, 4853695], [4853696, 5547080], [5547081, 6240465], [6240466, 6933850], [6933851, 7627235], [7627236, 8320620], [8320621, 9014005], [9014006, 9707390], [9707391, 10400775], [10400776, 11094160], [11094161, 11787545], [11787546, 12480930], [12480931, 13174315], [13174316, 13867719]] SRR7172079 file size 4677614 SRR7172079 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172079 SRR7172079_1.fastq SRR7172079_2.fastq Input file: SRR7172079_1.fastq Paired file: SRR7172079_2.fastq trimmed: SRR7172079-trimmed-pair1.fastq, SRR7172079-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 03:31:48 2025 >> started Fri Feb 14 03:32:09 2025 >> done (21.548s) 13867719 read pairs processed; of these: 18674 ( 0.13%) short read pairs filtered out after trimming by size control 14991 ( 0.11%) empty read pairs filtered out after trimming by size control 13834054 (99.76%) read pairs available; of these: 8167842 (59.04%) trimmed read pairs available after processing 5666212 (40.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 6 0.00% 21 4 0.00% 22 9 0.00% 23 7 0.00% 24 11 0.00% 25 9 0.00% 26 10 0.00% 27 6 0.00% 28 9 0.00% 29 9 0.00% 30 8 0.00% 31 5 0.00% 32 6 0.00% 33 7 0.00% 34 16 0.00% 35 14 0.00% 36 6 0.00% 37 9 0.00% 38 7 0.00% 39 9 0.00% 40 15 0.00% 41 15 0.00% 42 10 0.00% 43 14 0.00% 44 10 0.00% 45 16 0.00% 46 17 0.00% 47 17 0.00% 48 19 0.00% 49 24 0.00% 50 41 0.00% 51 32 0.00% 52 39 0.00% 53 45 0.00% 54 47 0.00% 55 66 0.00% 56 100 0.00% 57 414 0.00% 58 216 0.00% 59 217 0.00% 60 198 0.00% 61 108 0.00% 62 167 0.00% 63 160 0.00% 64 198 0.00% 65 203 0.00% 66 222 0.00% 67 303 0.00% 68 320 0.00% 69 338 0.00% 70 357 0.00% 71 361 0.00% 72 486 0.00% 73 625 0.00% 74 609 0.00% 75 772 0.01% 76 900 0.01% 77 1253 0.01% 78 1651 0.01% 79 1363 0.01% 80 1579 0.01% 81 1644 0.01% 82 1901 0.01% 83 2423 0.02% 84 4629 0.03% 85 5096 0.04% 86 5237 0.04% 87 5118 0.04% 88 5157 0.04% 89 5060 0.04% 90 5456 0.04% 91 5745 0.04% 92 6040 0.04% 93 6625 0.05% 94 7190 0.05% 95 7554 0.05% 96 8396 0.06% 97 9138 0.07% 98 9500 0.07% 99 10091 0.07% 100 10769 0.08% 101 11960 0.09% 102 12236 0.09% 103 13161 0.10% 104 13830 0.10% 105 15123 0.11% 106 15687 0.11% 107 16448 0.12% 108 17278 0.12% 109 18075 0.13% 110 19257 0.14% 111 20152 0.15% 112 21420 0.15% 113 22594 0.16% 114 23450 0.17% 115 24602 0.18% 116 25728 0.19% 117 27056 0.20% 118 28813 0.21% 119 29824 0.22% 120 31456 0.23% 121 32929 0.24% 122 34652 0.25% 123 36721 0.27% 124 38720 0.28% 125 40742 0.29% 126 42683 0.31% 127 45167 0.33% 128 46296 0.33% 129 48798 0.35% 130 51381 0.37% 131 53291 0.39% 132 55754 0.40% 133 59308 0.43% 134 62436 0.45% 135 66246 0.48% 136 71355 0.52% 137 75580 0.55% 138 82254 0.59% 139 89281 0.65% 140 96789 0.70% 141 106390 0.77% 142 120892 0.87% 143 135472 0.98% 144 158249 1.14% 145 191423 1.38% 146 239812 1.73% 147 319318 2.31% 148 472583 3.42% 149 904074 6.54% 150 3844610 27.79% 151 5666212 40.96% 13834054 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.70 fanout-score-rank=29 prefix-density=0.25 prefix-fanout=2.4 sequence=CCGCACTTGCAGCC criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=45.19 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=7.9 sequence=CATCAATGGCACTCTCTCACAGCCAATAACTTCAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACATTATTTTTAGAAATCCCATACTGCCACCGAATATTCAGTCCTTTAAGAAATCGAACAGCATACCCAACATAGTAAAAACCATCAATAATGCAAATACCGTTACCACAAGTGCAAATACTCC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.93 fanout-score-rank=17 prefix-density=0.48 prefix-fanout=2.9 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=17 fanout-score=15.48 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=8.4 sequence=TGGAGGTGGAGAGC SRR7172079 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 03:33:05 Started mapping on | Feb 14 03:33:06 Finished on | Feb 14 03:36:49 Mapping speed, Million of reads per hour | 223.33 Number of input reads | 13834054 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 12130044 Uniquely mapped reads % | 87.68% Average mapped length | 292.92 Number of splices: Total | 11221404 Number of splices: Annotated (sjdb) | 11008452 Number of splices: GT/AG | 11045483 Number of splices: GC/AG | 133980 Number of splices: AT/AC | 7694 Number of splices: Non-canonical | 34247 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.04% Deletion average length | 2.26 Insertion rate per base | 0.03% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 338678 % of reads mapped to multiple loci | 2.45% Number of reads mapped to too many loci | 45318 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.41% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1384464 1384464 1384464 N_multimapping 338678 338678 338678 N_noFeature 305810 11988840 361390 N_ambiguous 145054 641 59027 UnstrandedReadsAssigned:11679180 PositiveStrandReadsAssigned:140563 NegativeStrandReadsAssigned:11709627 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172079 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172079-trimmed-pair1.fastq SRR7172079-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,834,054 reads, 11,643,852 reads pseudoaligned [quant] estimated average fragment length: 241.811 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,164 rounds 52401 SRR7172079.ke.tsv 34699 SRR7172079.se.tsv 87100 total ==> SRR7172079.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.19 1451 64.9775 Potri.005G024800.1.v4.1 1035 794.189 1676 167.95 Potri.004G059700.1.v4.1 961 720.204 2 0.221006 Potri.007G009000.2.v4.1 1416 1175.19 0 0 Potri.003G141000.2.v4.1 2943 2702.19 554.524 16.3318 Potri.016G087400.1.v4.1 270 80.3493 945 936.007 Potri.015G069301.1.v4.1 564 327.132 0 0 Potri.010G195200.1.v4.1 1773 1532.19 909 47.2151 Potri.012G127500.1.v4.1 977 736.199 7693 831.629 ==> SRR7172079.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 501 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 116 Potri.001G452600.v4.1 137 SRR7172079 completed mapping pipeline successfully