Starting /dee2/code/volunteer_pipeline.sh SRR7172081 current disk space = 3087284588544 free memory = 1582636492 SRR7172081 SRAfilesize 8564c5c7fecbcf21a4d1c6692306fc54 SRR7172081.sra SRR7172081.sra file validated SRR7172081 is paired end SRR7172081 is conventional basespace SRR7172081 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172081_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.1475 33.0 33.0 34.0 30.0 34.0 2 32.69875 33.0 33.0 34.0 31.0 34.0 3 32.80425 33.0 33.0 34.0 31.0 34.0 4 32.567 33.0 33.0 33.0 31.0 34.0 5 33.03275 33.0 33.0 34.0 33.0 34.0 6 36.84325 38.0 37.0 38.0 35.0 38.0 7 37.22825 38.0 38.0 38.0 36.0 38.0 8 37.32625 38.0 38.0 38.0 36.0 38.0 9 37.54775 38.0 38.0 38.0 37.0 38.0 10-14 37.55995 38.0 38.0 38.0 37.8 38.0 15-19 37.556650000000005 38.0 38.0 38.0 37.4 38.0 20-24 37.516099999999994 38.0 38.0 38.0 37.6 38.0 25-29 37.4861 38.0 38.0 38.0 38.0 38.0 30-34 37.4473 38.0 38.0 38.0 37.4 38.0 35-39 37.47875 38.0 38.0 38.0 37.4 38.0 40-44 37.43345000000001 38.0 38.0 38.0 37.0 38.0 45-49 37.36475 38.0 38.0 38.0 37.0 38.0 50-54 37.2506 38.0 38.0 38.0 36.4 38.0 55-59 37.12715 38.0 38.0 38.0 36.0 38.0 60-64 37.049549999999996 38.0 38.0 38.0 35.8 38.0 65-69 37.00234999999999 38.0 38.0 38.0 36.0 38.0 70-74 36.96175000000001 38.0 38.0 38.0 35.8 38.0 75-79 36.834900000000005 38.0 38.0 38.0 35.4 38.0 80-84 36.7428 38.0 38.0 38.0 35.0 38.0 85-89 36.6596 38.0 38.0 38.0 34.4 38.0 90-94 36.536750000000005 38.0 38.0 38.0 34.0 38.0 95-99 36.40115 38.0 37.8 38.0 34.0 38.0 100-104 36.29845 38.0 37.2 38.0 34.0 38.0 105-109 36.06515 38.0 37.0 38.0 33.0 38.0 110-114 35.8913 38.0 37.0 38.0 32.0 38.0 115-119 35.7333 38.0 36.8 38.0 31.0 38.0 120-124 35.593650000000004 38.0 36.0 38.0 30.6 38.0 125-129 35.2611 38.0 36.0 38.0 29.4 38.0 130-134 35.0547 38.0 35.4 38.0 28.8 38.0 135-139 34.6005 38.0 35.0 38.0 27.0 38.0 140-144 33.897499999999994 38.0 34.2 38.0 22.2 38.0 145-149 33.28435 38.0 34.0 38.0 19.0 38.0 150-151 29.650875 36.5 28.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 2.0 7 1.0 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 3.0 14 0.0 15 0.0 16 1.0 17 3.0 18 1.0 19 5.0 20 4.0 21 5.0 22 4.0 23 6.0 24 8.0 25 12.0 26 17.0 27 14.0 28 18.0 29 31.0 30 29.0 31 48.0 32 63.0 33 114.0 34 171.0 35 334.0 36 947.0 37 2157.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.529535864978904 17.088607594936708 15.532700421940929 40.84915611814346 2 17.60440110027507 25.93148287071768 39.00975243810953 17.454363590897724 3 17.224999999999998 30.225 27.075 25.474999999999998 4 21.575 36.625 20.974999999999998 20.825 5 20.674999999999997 37.5 24.375 17.45 6 16.0 36.425000000000004 27.200000000000003 20.375 7 12.875 20.599999999999998 46.425 20.1 8 18.35 21.45 28.799999999999997 31.4 9 18.975 22.275 31.25 27.500000000000004 10-14 19.68 30.925000000000004 25.915 23.48 15-19 19.39 29.5 27.355 23.755000000000003 20-24 19.685 29.525000000000002 27.750000000000004 23.04 25-29 19.62 29.675 27.315 23.39 30-34 19.825 30.42 26.745 23.01 35-39 19.835 29.439999999999998 27.139999999999997 23.585 40-44 19.71 29.360000000000003 27.55 23.380000000000003 45-49 20.225 28.93 27.16 23.685000000000002 50-54 19.77 28.945 27.834999999999997 23.45 55-59 19.78 29.585 27.245 23.39 60-64 20.119999999999997 29.4 26.979999999999997 23.5 65-69 19.78 29.455 27.57 23.195 70-74 20.22 28.665000000000003 27.700000000000003 23.415 75-79 19.695 29.175 27.075 24.055 80-84 19.965 29.23 27.555000000000003 23.25 85-89 20.09 28.65 27.705000000000002 23.555 90-94 20.31 28.544999999999998 27.215 23.93 95-99 20.035 28.95 27.694999999999997 23.32 100-104 19.99 29.175 27.755000000000003 23.080000000000002 105-109 20.419999999999998 29.189999999999998 27.485 22.905 110-114 20.27 29.744999999999997 26.96 23.025000000000002 115-119 20.765 29.270000000000003 27.43 22.535 120-124 20.71 28.58 27.634999999999998 23.075000000000003 125-129 21.29 28.34 26.91 23.46 130-134 21.175 29.630000000000003 26.595000000000002 22.6 135-139 20.74 28.494999999999997 26.619999999999997 24.145 140-144 20.955 28.439999999999998 27.255000000000003 23.35 145-149 21.060000000000002 28.23 26.955000000000002 23.755000000000003 150-151 20.474999999999998 28.8625 27.400000000000002 23.2625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 0.5 20 0.5 21 2.0 22 1.5 23 1.0 24 5.0 25 6.5 26 8.0 27 11.5 28 13.5 29 19.0 30 25.5 31 33.0 32 38.5 33 53.5 34 72.0 35 81.5 36 98.0 37 121.5 38 155.5 39 179.5 40 196.5 41 220.0 42 255.5 43 270.0 44 265.0 45 265.0 46 257.0 47 237.0 48 202.5 49 182.5 50 165.0 51 139.0 52 108.0 53 75.5 54 61.0 55 50.5 56 34.5 57 24.0 58 16.0 59 11.5 60 9.5 61 7.5 62 5.0 63 2.5 64 1.5 65 1.0 66 0.0 67 1.0 68 2.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.2 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.32499999999999996 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.4375 0.0 0.0 0.0 0.0 110-111 0.6625 0.0 0.0 0.0 0.0 112-113 0.8625 0.0 0.0 0.0 0.0 114-115 1.0125 0.0 0.0 0.0 0.0 116-117 1.1625 0.0 0.0 0.0 0.0 118-119 1.4625 0.0 0.0 0.0 0.0 120-121 1.7625000000000002 0.0 0.0 0.0 0.0 122-123 2.0 0.0 0.0 0.0 0.0 124-125 2.2875 0.0 0.0 0.0 0.0 126-127 2.5 0.0 0.0 0.0 0.0 128-129 2.9 0.0 0.0 0.0 0.0 130-131 3.3 0.0 0.0 0.0 0.0 132-133 3.6375 0.0 0.0 0.0 0.0 134-135 3.8625 0.0 0.0 0.0 0.0 136-137 4.3 0.0 0.0 0.0 0.0 138-139 4.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCTTGC 10 0.006836113 144.9625 7 TTCCCAA 10 0.006836113 144.9625 7 AAGCAAG 10 0.006836113 144.9625 9 CTTCTTT 20 0.005942617 28.992498 130-134 ATCGGAA 40 0.007666461 18.120312 140-144 >>END_MODULE SRR7172081 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172081_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.245 34.0 33.0 34.0 33.0 34.0 2 33.293 34.0 33.0 34.0 33.0 34.0 3 33.319 34.0 33.0 34.0 33.0 34.0 4 33.3205 34.0 33.0 34.0 33.0 34.0 5 33.33075 34.0 33.0 34.0 33.0 34.0 6 37.39025 38.0 38.0 38.0 38.0 38.0 7 37.49325 38.0 38.0 38.0 38.0 38.0 8 37.49925 38.0 38.0 38.0 38.0 38.0 9 37.447 38.0 38.0 38.0 38.0 38.0 10-14 37.4678 38.0 38.0 38.0 38.0 38.0 15-19 37.44365 38.0 38.0 38.0 38.0 38.0 20-24 37.40665 38.0 38.0 38.0 37.4 38.0 25-29 37.3959 38.0 38.0 38.0 37.2 38.0 30-34 37.40225 38.0 38.0 38.0 37.2 38.0 35-39 37.31395 38.0 38.0 38.0 37.0 38.0 40-44 37.314 38.0 38.0 38.0 37.0 38.0 45-49 37.255 38.0 38.0 38.0 37.0 38.0 50-54 37.2259 38.0 38.0 38.0 37.0 38.0 55-59 37.12285 38.0 38.0 38.0 36.4 38.0 60-64 37.113099999999996 38.0 38.0 38.0 36.4 38.0 65-69 37.0314 38.0 38.0 38.0 36.0 38.0 70-74 36.893750000000004 38.0 38.0 38.0 35.8 38.0 75-79 36.87205 38.0 38.0 38.0 35.6 38.0 80-84 36.72755 38.0 38.0 38.0 35.0 38.0 85-89 36.657300000000006 38.0 38.0 38.0 34.6 38.0 90-94 36.49785 38.0 38.0 38.0 34.2 38.0 95-99 36.4036 38.0 38.0 38.0 34.0 38.0 100-104 36.3403 38.0 38.0 38.0 34.0 38.0 105-109 36.1827 38.0 37.6 38.0 33.6 38.0 110-114 35.977700000000006 38.0 37.0 38.0 33.0 38.0 115-119 35.74575 38.0 37.0 38.0 31.4 38.0 120-124 35.42155 38.0 36.4 38.0 30.0 38.0 125-129 35.146249999999995 38.0 36.0 38.0 29.2 38.0 130-134 34.78985 38.0 35.0 38.0 27.4 38.0 135-139 34.5653 38.0 35.0 38.0 26.2 38.0 140-144 34.17165 38.0 34.6 38.0 24.0 38.0 145-149 33.43985 38.0 34.0 38.0 19.0 38.0 150-151 29.201500000000003 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 1.0 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 2.0 13 1.0 14 1.0 15 4.0 16 2.0 17 1.0 18 3.0 19 5.0 20 7.0 21 5.0 22 7.0 23 7.0 24 6.0 25 14.0 26 19.0 27 31.0 28 29.0 29 27.0 30 37.0 31 49.0 32 64.0 33 81.0 34 148.0 35 253.0 36 756.0 37 2434.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.025000000000002 13.075000000000001 19.075 37.824999999999996 2 23.1 21.75 38.95 16.2 3 20.325 25.45 31.65 22.575 4 23.974999999999998 34.0 20.625 21.4 5 23.9 37.9 21.2 17.0 6 16.650000000000002 37.775 24.9 20.674999999999997 7 16.525000000000002 14.000000000000002 47.475 22.0 8 21.0 21.5 27.450000000000003 30.049999999999997 9 20.9 23.275000000000002 28.975 26.85 10-14 22.74 28.785 26.235000000000003 22.24 15-19 22.985 27.985 27.565 21.465 20-24 23.21 27.675 27.935 21.18 25-29 23.0 28.07 28.050000000000004 20.880000000000003 30-34 23.155 27.915 27.87 21.060000000000002 35-39 23.115 28.15 27.845 20.89 40-44 23.25 28.27 27.534999999999997 20.945 45-49 23.625 27.345000000000002 28.22 20.810000000000002 50-54 23.52 28.144999999999996 27.665 20.669999999999998 55-59 23.380000000000003 28.044999999999998 27.76 20.815 60-64 23.549999999999997 28.000000000000004 27.839999999999996 20.61 65-69 23.885 27.534999999999997 28.115000000000002 20.465 70-74 23.485 27.54 28.115000000000002 20.86 75-79 24.005000000000003 27.82 27.805000000000003 20.369999999999997 80-84 23.549999999999997 28.23 27.794999999999998 20.424999999999997 85-89 23.155 27.650000000000002 28.560000000000002 20.635 90-94 23.36 28.115000000000002 28.194999999999997 20.330000000000002 95-99 23.06 27.6 28.355000000000004 20.985 100-104 23.025000000000002 28.244999999999997 27.87 20.86 105-109 23.765 27.889999999999997 27.700000000000003 20.645 110-114 23.794999999999998 27.83 27.905 20.47 115-119 23.919999999999998 27.735 27.6 20.745 120-124 22.965 28.125 28.044999999999998 20.865000000000002 125-129 23.849999999999998 28.335 27.73 20.085 130-134 24.185000000000002 27.415 28.235 20.165 135-139 23.91 27.965 27.91 20.215 140-144 23.995 28.15 27.435 20.419999999999998 145-149 24.23 27.815 27.72 20.235 150-151 25.0125 27.400000000000002 27.075 20.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 3.0 26 4.5 27 3.5 28 5.5 29 10.0 30 14.5 31 17.5 32 21.5 33 31.0 34 46.0 35 58.5 36 71.5 37 103.5 38 137.0 39 166.0 40 197.5 41 220.5 42 249.5 43 276.5 44 282.0 45 277.0 46 273.0 47 269.0 48 239.5 49 200.5 50 177.5 51 155.5 52 124.0 53 92.0 54 73.0 55 53.0 56 33.5 57 28.0 58 24.0 59 17.0 60 11.0 61 7.5 62 6.5 63 4.0 64 2.0 65 1.0 66 2.0 67 1.5 68 1.5 69 1.5 70 0.0 71 0.0 72 1.0 73 1.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.32499999999999996 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.4375 0.0 0.0 0.0 0.0 110-111 0.6625 0.0 0.0 0.0 0.0 112-113 0.8625 0.0 0.0 0.0 0.0 114-115 1.025 0.0 0.0 0.0 0.0 116-117 1.1875 0.0 0.0 0.0 0.0 118-119 1.4875 0.0 0.0 0.0 0.0 120-121 1.7875 0.0 0.0 0.0 0.0 122-123 2.025 0.0 0.0 0.0 0.0 124-125 2.3 0.0 0.0 0.0 0.0 126-127 2.5 0.0 0.0 0.0 0.0 128-129 2.9 0.0 0.0 0.0 0.0 130-131 3.3 0.0 0.0 0.0 0.0 132-133 3.6375 0.0 0.0 0.0 0.0 134-135 3.8625 0.0 0.0 0.0 0.0 136-137 4.3 0.0 0.0 0.0 0.0 138-139 4.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCGGAA 40 0.0076550315 18.125 140-144 >>END_MODULE Read 521181 spots for SRR7172081.sra Written 521181 spots for SRR7172081.sra Read 521181 spots for SRR7172081.sra Written 521181 spots for SRR7172081.sra Read 521181 spots for SRR7172081.sra Written 521181 spots for SRR7172081.sra Read 521181 spots for SRR7172081.sra Written 521181 spots for SRR7172081.sra Read 521181 spots for SRR7172081.sra Written 521181 spots for SRR7172081.sra Read 521181 spots for SRR7172081.sra Written 521181 spots for SRR7172081.sra Read 521181 spots for SRR7172081.sra Written 521181 spots for SRR7172081.sra Read 521181 spots for SRR7172081.sra Written 521181 spots for SRR7172081.sra Read 521181 spots for SRR7172081.sra Written 521181 spots for SRR7172081.sra Read 521181 spots for SRR7172081.sra Written 521181 spots for SRR7172081.sra Read 521181 spots for SRR7172081.sra Written 521181 spots for SRR7172081.sra Read 521181 spots for SRR7172081.sra Written 521181 spots for SRR7172081.sra Read 521181 spots for SRR7172081.sra Written 521181 spots for SRR7172081.sra Read 521181 spots for SRR7172081.sra Written 521181 spots for SRR7172081.sra Read 521181 spots for SRR7172081.sra Written 521181 spots for SRR7172081.sra Read 521181 spots for SRR7172081.sra Written 521181 spots for SRR7172081.sra Read 521181 spots for SRR7172081.sra Written 521181 spots for SRR7172081.sra Read 521181 spots for SRR7172081.sra Written 521181 spots for SRR7172081.sra Read 521181 spots for SRR7172081.sra Written 521181 spots for SRR7172081.sra Read 521195 spots for SRR7172081.sra Written 521195 spots for SRR7172081.sra SRR ids: ['SRR7172081.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l5g0yg5e SRR7172081.sra spots: 10423634 blocks: [[1, 521181], [521182, 1042362], [1042363, 1563543], [1563544, 2084724], [2084725, 2605905], [2605906, 3127086], [3127087, 3648267], [3648268, 4169448], [4169449, 4690629], [4690630, 5211810], [5211811, 5732991], [5732992, 6254172], [6254173, 6775353], [6775354, 7296534], [7296535, 7817715], [7817716, 8338896], [8338897, 8860077], [8860078, 9381258], [9381259, 9902439], [9902440, 10423634]] SRR7172081 file size 3510527 SRR7172081 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172081 SRR7172081_1.fastq SRR7172081_2.fastq Input file: SRR7172081_1.fastq Paired file: SRR7172081_2.fastq trimmed: SRR7172081-trimmed-pair1.fastq, SRR7172081-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 04:25:01 2025 >> started Fri Feb 14 04:25:13 2025 >> done (11.286s) 10423634 read pairs processed; of these: 4127 ( 0.04%) short read pairs filtered out after trimming by size control 4455 ( 0.04%) empty read pairs filtered out after trimming by size control 10415052 (99.92%) read pairs available; of these: 6076335 (58.34%) trimmed read pairs available after processing 4338717 (41.66%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 3 0.00% 21 0 0.00% 22 1 0.00% 23 1 0.00% 24 3 0.00% 25 3 0.00% 26 0 0.00% 27 1 0.00% 28 2 0.00% 29 5 0.00% 30 1 0.00% 31 6 0.00% 32 0 0.00% 33 1 0.00% 34 4 0.00% 35 3 0.00% 36 5 0.00% 37 2 0.00% 38 3 0.00% 39 11 0.00% 40 1 0.00% 41 6 0.00% 42 9 0.00% 43 7 0.00% 44 10 0.00% 45 12 0.00% 46 10 0.00% 47 12 0.00% 48 9 0.00% 49 11 0.00% 50 12 0.00% 51 15 0.00% 52 20 0.00% 53 22 0.00% 54 29 0.00% 55 28 0.00% 56 25 0.00% 57 36 0.00% 58 32 0.00% 59 35 0.00% 60 53 0.00% 61 44 0.00% 62 55 0.00% 63 66 0.00% 64 90 0.00% 65 79 0.00% 66 113 0.00% 67 120 0.00% 68 125 0.00% 69 146 0.00% 70 162 0.00% 71 195 0.00% 72 220 0.00% 73 251 0.00% 74 305 0.00% 75 320 0.00% 76 402 0.00% 77 434 0.00% 78 518 0.00% 79 604 0.01% 80 622 0.01% 81 782 0.01% 82 904 0.01% 83 1036 0.01% 84 1338 0.01% 85 1533 0.01% 86 1757 0.02% 87 2012 0.02% 88 2291 0.02% 89 2330 0.02% 90 2515 0.02% 91 2751 0.03% 92 2878 0.03% 93 3296 0.03% 94 3617 0.03% 95 3949 0.04% 96 4232 0.04% 97 4466 0.04% 98 4877 0.05% 99 5291 0.05% 100 5650 0.05% 101 6197 0.06% 102 6647 0.06% 103 7093 0.07% 104 7574 0.07% 105 8083 0.08% 106 8706 0.08% 107 9087 0.09% 108 9945 0.10% 109 10563 0.10% 110 11064 0.11% 111 11575 0.11% 112 12276 0.12% 113 13016 0.12% 114 13645 0.13% 115 14620 0.14% 116 15667 0.15% 117 16126 0.15% 118 16951 0.16% 119 17946 0.17% 120 18803 0.18% 121 19817 0.19% 122 20716 0.20% 123 21901 0.21% 124 23229 0.22% 125 24594 0.24% 126 25704 0.25% 127 27415 0.26% 128 29073 0.28% 129 30718 0.29% 130 32791 0.31% 131 34943 0.34% 132 36840 0.35% 133 39975 0.38% 134 42274 0.41% 135 45199 0.43% 136 48897 0.47% 137 52716 0.51% 138 57181 0.55% 139 62761 0.60% 140 69435 0.67% 141 78288 0.75% 142 89979 0.86% 143 104599 1.00% 144 127237 1.22% 145 156485 1.50% 146 206807 1.99% 147 294273 2.83% 148 465230 4.47% 149 864597 8.30% 150 2644250 25.39% 151 4338717 41.66% 10415052 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=39 prefix-density=0.32 prefix-fanout=1.9 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.09 sequence-density-rank=25 fanout-score=335.02 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=32.3 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=4.96 fanout-score-rank=19 prefix-density=0.60 prefix-fanout=3.4 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=26 fanout-score=33.23 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=9.8 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7172081 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 04:26:00 Started mapping on | Feb 14 04:26:00 Finished on | Feb 14 04:27:00 Mapping speed, Million of reads per hour | 624.90 Number of input reads | 10415052 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 9946565 Uniquely mapped reads % | 95.50% Average mapped length | 294.06 Number of splices: Total | 9645320 Number of splices: Annotated (sjdb) | 9475663 Number of splices: GT/AG | 9491692 Number of splices: GC/AG | 120329 Number of splices: AT/AC | 7408 Number of splices: Non-canonical | 25891 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.04% Deletion average length | 2.68 Insertion rate per base | 0.03% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 301514 % of reads mapped to multiple loci | 2.89% Number of reads mapped to too many loci | 30208 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.22% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 171766 171766 171766 N_multimapping 301514 301514 301514 N_noFeature 256414 9845105 302059 N_ambiguous 107076 465 50985 UnstrandedReadsAssigned:9583075 PositiveStrandReadsAssigned:100995 NegativeStrandReadsAssigned:9593521 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172081 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172081-trimmed-pair1.fastq SRR7172081-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,415,052 reads, 9,506,243 reads pseudoaligned [quant] estimated average fragment length: 242.585 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 977 rounds 52401 SRR7172081.ke.tsv 34699 SRR7172081.se.tsv 87100 total ==> SRR7172081.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.42 543 26.557 Potri.005G024800.1.v4.1 1035 793.415 135 14.7828 Potri.004G059700.1.v4.1 961 719.437 13 1.56991 Potri.007G009000.2.v4.1 1416 1174.42 0 0 Potri.003G141000.2.v4.1 2943 2701.42 263 8.45838 Potri.016G087400.1.v4.1 270 76.8429 713.312 806.49 Potri.015G069301.1.v4.1 564 326.2 0 0 Potri.010G195200.1.v4.1 1773 1531.42 143 8.11271 Potri.012G127500.1.v4.1 977 735.426 2625 310.108 ==> SRR7172081.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 49 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 366 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 90 SRR7172081 completed mapping pipeline successfully