Starting /dee2/code/volunteer_pipeline.sh SRR7172082 current disk space = 3112343506944 free memory = 1305806652 SRR7172082 SRAfilesize 356a1af37e107132b44f11635a267150 SRR7172082.sra SRR7172082.sra file validated SRR7172082 is paired end SRR7172082 is conventional basespace SRR7172082 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172082_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.863 33.0 32.0 34.0 28.0 34.0 2 30.19825 32.0 30.0 33.0 25.0 33.0 3 31.92575 33.0 31.0 33.0 28.0 34.0 4 32.56225 33.0 33.0 34.0 31.0 34.0 5 32.885 33.0 33.0 34.0 31.0 34.0 6 36.62125 38.0 37.0 38.0 34.0 38.0 7 36.811 38.0 37.0 38.0 34.0 38.0 8 37.36075 38.0 38.0 38.0 37.0 38.0 9 37.36975 38.0 38.0 38.0 37.0 38.0 10-14 37.4178 38.0 38.0 38.0 37.0 38.0 15-19 37.4566 38.0 38.0 38.0 37.0 38.0 20-24 37.44180000000001 38.0 38.0 38.0 37.0 38.0 25-29 37.4649 38.0 38.0 38.0 37.0 38.0 30-34 37.3952 38.0 38.0 38.0 37.0 38.0 35-39 37.3762 38.0 38.0 38.0 37.0 38.0 40-44 37.321149999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.204449999999994 38.0 38.0 38.0 36.2 38.0 50-54 37.128299999999996 38.0 38.0 38.0 36.0 38.0 55-59 37.0392 38.0 38.0 38.0 36.0 38.0 60-64 36.99325 38.0 38.0 38.0 35.6 38.0 65-69 36.891999999999996 38.0 38.0 38.0 35.0 38.0 70-74 36.81535 38.0 38.0 38.0 35.0 38.0 75-79 36.7412 38.0 38.0 38.0 34.6 38.0 80-84 36.67965 38.0 38.0 38.0 34.4 38.0 85-89 36.48565 38.0 37.6 38.0 34.0 38.0 90-94 36.3981 38.0 37.2 38.0 34.0 38.0 95-99 36.3169 38.0 37.0 38.0 33.6 38.0 100-104 36.0943 38.0 37.0 38.0 33.0 38.0 105-109 35.79615 38.0 36.8 38.0 31.0 38.0 110-114 35.52069999999999 38.0 36.0 38.0 30.2 38.0 115-119 35.4928 38.0 36.0 38.0 30.2 38.0 120-124 35.20844999999999 38.0 35.8 38.0 29.2 38.0 125-129 34.945800000000006 38.0 35.0 38.0 27.6 38.0 130-134 34.69265 38.0 35.0 38.0 27.2 38.0 135-139 34.247550000000004 38.0 34.8 38.0 24.0 38.0 140-144 33.63065 38.0 34.0 38.0 21.6 38.0 145-149 32.7907 38.0 33.6 38.0 16.8 38.0 150-151 28.843625 36.0 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 1.0 15 1.0 16 0.0 17 3.0 18 2.0 19 3.0 20 3.0 21 8.0 22 1.0 23 8.0 24 10.0 25 13.0 26 15.0 27 31.0 28 30.0 29 28.0 30 41.0 31 56.0 32 85.0 33 108.0 34 218.0 35 441.0 36 1092.0 37 1801.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.817605075337035 18.054454136928364 13.983610890827386 38.144329896907216 2 18.5 24.575 39.45 17.474999999999998 3 18.224999999999998 30.725 27.55 23.5 4 21.975 37.175000000000004 21.175 19.675 5 20.175 37.574999999999996 24.3 17.95 6 16.6 36.175000000000004 24.925 22.3 7 13.3 20.424999999999997 46.2 20.075000000000003 8 18.25 21.95 28.15 31.65 9 18.05 21.6 32.375 27.975 10-14 19.830000000000002 30.099999999999998 26.25 23.82 15-19 20.0 29.15 27.779999999999998 23.07 20-24 20.03 28.615000000000002 28.105000000000004 23.25 25-29 19.475 29.265 28.189999999999998 23.07 30-34 19.869999999999997 29.270000000000003 28.065 22.795 35-39 19.49 28.895 27.905 23.71 40-44 19.975 29.01 27.52 23.494999999999997 45-49 20.055 28.59 27.805000000000003 23.549999999999997 50-54 20.275000000000002 29.160000000000004 27.58 22.985 55-59 20.265 29.25 27.725 22.759999999999998 60-64 19.785 29.099999999999998 27.450000000000003 23.665 65-69 19.830000000000002 28.549999999999997 28.360000000000003 23.26 70-74 20.8 28.810000000000002 27.245 23.145 75-79 19.865 29.17 27.534999999999997 23.43 80-84 20.355 28.835 27.55 23.26 85-89 20.385 28.794999999999998 27.694999999999997 23.125 90-94 20.24 28.95 27.505000000000003 23.305 95-99 20.025000000000002 28.88 27.750000000000004 23.345 100-104 20.23 28.634999999999998 27.11 24.025 105-109 20.955 28.09 27.46 23.494999999999997 110-114 20.674999999999997 28.565 27.175 23.585 115-119 21.175 28.23 27.765 22.830000000000002 120-124 21.065 28.144999999999996 27.515 23.275000000000002 125-129 20.895 28.89 26.83 23.385 130-134 20.915 28.535 27.365000000000002 23.185 135-139 20.73 28.215 27.295 23.76 140-144 20.59 28.475 27.12 23.815 145-149 20.895 28.470000000000002 27.075 23.56 150-151 21.75 27.725 27.175 23.35 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 1.0 22 1.0 23 3.0 24 3.0 25 2.0 26 5.0 27 8.5 28 8.5 29 17.0 30 30.5 31 36.0 32 47.0 33 58.0 34 65.5 35 81.5 36 102.0 37 120.0 38 158.0 39 199.5 40 215.0 41 238.5 42 241.0 43 234.5 44 252.5 45 266.5 46 258.0 47 235.0 48 217.0 49 184.5 50 149.5 51 131.0 52 114.5 53 87.0 54 57.0 55 44.0 56 37.0 57 25.5 58 20.0 59 14.5 60 6.5 61 5.0 62 5.0 63 4.0 64 4.0 65 2.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.425 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.5375 0.0 0.0 0.0 0.0 106-107 0.6375 0.0 0.0 0.0 0.0 108-109 0.7124999999999999 0.0 0.0 0.0 0.0 110-111 0.7875000000000001 0.0 0.0 0.0 0.0 112-113 0.8 0.0 0.0 0.0 0.0 114-115 0.925 0.0 0.0 0.0 0.0 116-117 1.0499999999999998 0.0 0.0 0.0 0.0 118-119 1.1625 0.0 0.0 0.0 0.0 120-121 1.2999999999999998 0.0 0.0 0.0 0.0 122-123 1.475 0.0 0.0 0.0 0.0 124-125 1.6875 0.0 0.0 0.0 0.0 126-127 1.8125 0.0 0.0 0.0 0.0 128-129 1.975 0.0 0.0 0.0 0.0 130-131 2.2 0.0 0.0 0.0 0.0 132-133 2.425 0.0 0.0 0.0 0.0 134-135 2.8499999999999996 0.0 0.0 0.0 0.0 136-137 3.05 0.0 0.0 0.0 0.0 138-139 3.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 40 0.007674091 18.117188 40-44 >>END_MODULE SRR7172082 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172082_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0515 33.0 33.0 34.0 32.0 34.0 2 33.1725 34.0 33.0 34.0 33.0 34.0 3 33.22125 34.0 33.0 34.0 33.0 34.0 4 33.216 34.0 33.0 34.0 33.0 34.0 5 33.179 34.0 33.0 34.0 33.0 34.0 6 37.34625 38.0 38.0 38.0 37.0 38.0 7 37.44475 38.0 38.0 38.0 37.0 38.0 8 37.37275 38.0 38.0 38.0 37.0 38.0 9 37.4065 38.0 38.0 38.0 37.0 38.0 10-14 37.43245 38.0 38.0 38.0 37.2 38.0 15-19 37.3876 38.0 38.0 38.0 37.2 38.0 20-24 37.3555 38.0 38.0 38.0 37.0 38.0 25-29 37.3041 38.0 38.0 38.0 37.0 38.0 30-34 37.2804 38.0 38.0 38.0 37.0 38.0 35-39 37.157 38.0 38.0 38.0 36.6 38.0 40-44 37.17815 38.0 38.0 38.0 36.8 38.0 45-49 37.17295 38.0 38.0 38.0 36.6 38.0 50-54 37.11845 38.0 38.0 38.0 36.2 38.0 55-59 37.0978 38.0 38.0 38.0 36.0 38.0 60-64 36.9933 38.0 38.0 38.0 36.0 38.0 65-69 36.96894999999999 38.0 38.0 38.0 35.8 38.0 70-74 36.838800000000006 38.0 38.0 38.0 35.0 38.0 75-79 36.7371 38.0 38.0 38.0 35.0 38.0 80-84 36.6107 38.0 38.0 38.0 34.2 38.0 85-89 36.5066 38.0 38.0 38.0 34.0 38.0 90-94 36.39665 38.0 38.0 38.0 33.8 38.0 95-99 36.26005 38.0 37.6 38.0 33.8 38.0 100-104 36.194849999999995 38.0 37.0 38.0 33.4 38.0 105-109 35.9525 38.0 37.0 38.0 32.2 38.0 110-114 35.717999999999996 38.0 37.0 38.0 31.0 38.0 115-119 35.5124 38.0 36.2 38.0 30.6 38.0 120-124 35.2998 38.0 36.0 38.0 29.6 38.0 125-129 34.7987 38.0 35.2 38.0 27.4 38.0 130-134 34.4178 38.0 35.0 38.0 24.8 38.0 135-139 34.082100000000004 38.0 34.8 38.0 23.0 38.0 140-144 33.363150000000005 38.0 33.8 38.0 18.6 38.0 145-149 32.46515 38.0 33.4 38.0 13.6 38.0 150-151 28.102625 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 0.0 5 1.0 6 0.0 7 1.0 8 1.0 9 0.0 10 2.0 11 0.0 12 1.0 13 0.0 14 2.0 15 0.0 16 0.0 17 2.0 18 4.0 19 2.0 20 3.0 21 9.0 22 5.0 23 13.0 24 8.0 25 8.0 26 22.0 27 31.0 28 21.0 29 41.0 30 51.0 31 69.0 32 86.0 33 119.0 34 177.0 35 345.0 36 841.0 37 2131.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.800000000000004 14.274999999999999 16.6 35.325 2 22.975 23.45 37.675 15.9 3 20.65 27.325 30.375000000000004 21.65 4 23.200000000000003 35.75 20.974999999999998 20.075000000000003 5 22.5 36.7 21.8 19.0 6 17.375 39.225 24.5 18.9 7 16.325 15.525 46.6 21.55 8 19.7 21.7 28.349999999999998 30.25 9 21.625 23.325000000000003 28.349999999999998 26.700000000000003 10-14 22.755 28.000000000000004 26.83 22.415 15-19 22.345000000000002 27.765 27.815 22.075 20-24 22.145 28.43 27.62 21.805 25-29 22.634999999999998 28.499999999999996 27.785 21.08 30-34 22.43 28.51 27.875 21.185000000000002 35-39 22.825 28.044999999999998 27.515 21.615000000000002 40-44 22.975 28.055000000000003 27.810000000000002 21.16 45-49 22.8 28.044999999999998 28.044999999999998 21.11 50-54 23.025000000000002 28.044999999999998 27.85 21.08 55-59 23.305 27.355 27.965 21.375 60-64 23.46 28.244999999999997 27.250000000000004 21.044999999999998 65-69 23.294999999999998 27.565 28.025 21.115000000000002 70-74 23.695 27.88 27.575 20.849999999999998 75-79 23.445 27.994999999999997 27.71 20.849999999999998 80-84 23.425 28.65 27.229999999999997 20.695 85-89 23.075000000000003 27.694999999999997 28.28 20.95 90-94 23.26 28.24 27.715 20.785 95-99 23.68 28.08 27.68 20.560000000000002 100-104 23.674999999999997 27.915 27.889999999999997 20.52 105-109 23.585 27.565 28.1 20.75 110-114 23.005 27.92 28.449999999999996 20.625 115-119 23.150000000000002 27.79 28.144999999999996 20.915 120-124 23.035 28.355000000000004 28.22 20.39 125-129 23.865 28.23 27.800000000000004 20.105 130-134 23.615 28.42 27.805000000000003 20.16 135-139 23.965 27.82 27.839999999999996 20.375 140-144 24.16 27.884999999999998 27.72 20.235 145-149 24.060000000000002 28.205000000000002 27.52 20.215 150-151 24.325 27.6625 27.700000000000003 20.3125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 1.5 24 1.0 25 1.0 26 2.0 27 5.0 28 5.0 29 8.0 30 12.0 31 18.5 32 26.5 33 34.0 34 44.5 35 51.5 36 70.5 37 97.5 38 121.5 39 152.0 40 183.0 41 226.0 42 250.5 43 274.5 44 305.0 45 303.0 46 290.0 47 266.5 48 234.5 49 214.5 50 184.0 51 139.5 52 114.0 53 86.5 54 65.0 55 56.5 56 45.5 57 37.5 58 24.0 59 11.5 60 7.5 61 4.0 62 5.0 63 4.0 64 3.0 65 3.0 66 1.0 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54739753583102 98.97500000000001 2 0.4023133014835303 0.8 3 0.025144581342720643 0.075 4 0.0 0.0 5 0.0 0.0 6 0.025144581342720643 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.525 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.0 0.0 110-111 0.75 0.0 0.0 0.0 0.0 112-113 0.775 0.0 0.0 0.0 0.0 114-115 0.875 0.0 0.0 0.0 0.0 116-117 1.0 0.0 0.0 0.0 0.0 118-119 1.1375000000000002 0.0 0.0 0.0 0.0 120-121 1.275 0.0 0.0 0.0 0.0 122-123 1.45 0.0 0.0 0.0 0.0 124-125 1.6625 0.0 0.0 0.0 0.0 126-127 1.7875 0.0 0.0 0.0 0.0 128-129 1.9375 0.0 0.0 0.0 0.0 130-131 2.1500000000000004 0.0 0.0 0.0 0.0 132-133 2.4 0.0 0.0 0.0 0.0 134-135 2.825 0.0 0.0 0.0 0.0 136-137 3.0375 0.0 0.0 0.0 0.0 138-139 3.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGCTCC 10 0.006830828 145.0 9 AATACAT 10 0.006830828 145.0 5 >>END_MODULE Read 668211 spots for SRR7172082.sra Written 668211 spots for SRR7172082.sra Read 668211 spots for SRR7172082.sra Written 668211 spots for SRR7172082.sra Read 668211 spots for SRR7172082.sra Written 668211 spots for SRR7172082.sra Read 668211 spots for SRR7172082.sra Written 668211 spots for SRR7172082.sra Read 668211 spots for SRR7172082.sra Written 668211 spots for SRR7172082.sra Read 668211 spots for SRR7172082.sra Written 668211 spots for SRR7172082.sra Read 668211 spots for SRR7172082.sra Written 668211 spots for SRR7172082.sra Read 668211 spots for SRR7172082.sra Written 668211 spots for SRR7172082.sra Read 668211 spots for SRR7172082.sra Written 668211 spots for SRR7172082.sra Read 668211 spots for SRR7172082.sra Written 668211 spots for SRR7172082.sra Read 668211 spots for SRR7172082.sra Written 668211 spots for SRR7172082.sra Read 668211 spots for SRR7172082.sra Written 668211 spots for SRR7172082.sra Read 668211 spots for SRR7172082.sra Written 668211 spots for SRR7172082.sra Read 668211 spots for SRR7172082.sra Written 668211 spots for SRR7172082.sra Read 668211 spots for SRR7172082.sra Written 668211 spots for SRR7172082.sra Read 668211 spots for SRR7172082.sra Written 668211 spots for SRR7172082.sra Read 668211 spots for SRR7172082.sra Written 668211 spots for SRR7172082.sra Read 668211 spots for SRR7172082.sra Written 668211 spots for SRR7172082.sra Read 668211 spots for SRR7172082.sra Written 668211 spots for SRR7172082.sra Read 668220 spots for SRR7172082.sra Written 668220 spots for SRR7172082.sra SRR ids: ['SRR7172082.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4pwjmysm SRR7172082.sra spots: 13364229 blocks: [[1, 668211], [668212, 1336422], [1336423, 2004633], [2004634, 2672844], [2672845, 3341055], [3341056, 4009266], [4009267, 4677477], [4677478, 5345688], [5345689, 6013899], [6013900, 6682110], [6682111, 7350321], [7350322, 8018532], [8018533, 8686743], [8686744, 9354954], [9354955, 10023165], [10023166, 10691376], [10691377, 11359587], [11359588, 12027798], [12027799, 12696009], [12696010, 13364229]] SRR7172082 file size 4506998 SRR7172082 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172082 SRR7172082_1.fastq SRR7172082_2.fastq Input file: SRR7172082_1.fastq Paired file: SRR7172082_2.fastq trimmed: SRR7172082-trimmed-pair1.fastq, SRR7172082-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 16:05:03 2025 >> started Fri Feb 14 16:05:20 2025 >> done (16.851s) 13364229 read pairs processed; of these: 4336 ( 0.03%) short read pairs filtered out after trimming by size control 6400 ( 0.05%) empty read pairs filtered out after trimming by size control 13353493 (99.92%) read pairs available; of these: 8254249 (61.81%) trimmed read pairs available after processing 5099244 (38.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 2 0.00% 21 1 0.00% 22 5 0.00% 23 3 0.00% 24 5 0.00% 25 2 0.00% 26 2 0.00% 27 2 0.00% 28 3 0.00% 29 2 0.00% 30 2 0.00% 31 4 0.00% 32 4 0.00% 33 4 0.00% 34 3 0.00% 35 4 0.00% 36 2 0.00% 37 6 0.00% 38 3 0.00% 39 4 0.00% 40 3 0.00% 41 4 0.00% 42 4 0.00% 43 8 0.00% 44 9 0.00% 45 11 0.00% 46 14 0.00% 47 12 0.00% 48 10 0.00% 49 15 0.00% 50 16 0.00% 51 12 0.00% 52 10 0.00% 53 30 0.00% 54 26 0.00% 55 32 0.00% 56 38 0.00% 57 40 0.00% 58 47 0.00% 59 56 0.00% 60 64 0.00% 61 74 0.00% 62 88 0.00% 63 69 0.00% 64 83 0.00% 65 92 0.00% 66 123 0.00% 67 115 0.00% 68 150 0.00% 69 166 0.00% 70 201 0.00% 71 192 0.00% 72 228 0.00% 73 287 0.00% 74 330 0.00% 75 377 0.00% 76 463 0.00% 77 521 0.00% 78 527 0.00% 79 569 0.00% 80 642 0.00% 81 784 0.01% 82 937 0.01% 83 1043 0.01% 84 1305 0.01% 85 1599 0.01% 86 1778 0.01% 87 2083 0.02% 88 2220 0.02% 89 2380 0.02% 90 2624 0.02% 91 2807 0.02% 92 3119 0.02% 93 3462 0.03% 94 3590 0.03% 95 3894 0.03% 96 4242 0.03% 97 4619 0.03% 98 4966 0.04% 99 5362 0.04% 100 6012 0.05% 101 6383 0.05% 102 6895 0.05% 103 7370 0.06% 104 8233 0.06% 105 8694 0.07% 106 9513 0.07% 107 10139 0.08% 108 10774 0.08% 109 11494 0.09% 110 12242 0.09% 111 13030 0.10% 112 13922 0.10% 113 15035 0.11% 114 15916 0.12% 115 17265 0.13% 116 18113 0.14% 117 19107 0.14% 118 20296 0.15% 119 21509 0.16% 120 22414 0.17% 121 24304 0.18% 122 25417 0.19% 123 27271 0.20% 124 29231 0.22% 125 31136 0.23% 126 33212 0.25% 127 35575 0.27% 128 37751 0.28% 129 40873 0.31% 130 43468 0.33% 131 46763 0.35% 132 50506 0.38% 133 54944 0.41% 134 59505 0.45% 135 64404 0.48% 136 70093 0.52% 137 77247 0.58% 138 85552 0.64% 139 94919 0.71% 140 104920 0.79% 141 118830 0.89% 142 137536 1.03% 143 162883 1.22% 144 197862 1.48% 145 247255 1.85% 146 325232 2.44% 147 451092 3.38% 148 687166 5.15% 149 1211531 9.07% 150 3344780 25.05% 151 5099244 38.19% 13353493 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=5.00 fanout-score-rank=18 prefix-density=0.87 prefix-fanout=1.9 sequence=TTCTCAGCACCGAAGTCCATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=27 fanout-score=133.91 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=22.9 sequence=CCACCACCATGGGCT criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=4.03 fanout-score-rank=25 prefix-density=0.72 prefix-fanout=2.1 sequence=TTTCTCAGAGAACACCACAACTGAGACAATCAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=29.12 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=5.3 sequence=ACCAGCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCCTATTTTACCTGCAGAAAATGTCTGGCTGTAGCTGTGGCTCTGACTGCAAGTGTGGCAGTGGCTGCAAATGTGGCATGTACCCTGACTTAGGTTTCTCAGAGA SRR7172082 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 16:06:16 Started mapping on | Feb 14 16:06:16 Finished on | Feb 14 16:08:19 Mapping speed, Million of reads per hour | 390.83 Number of input reads | 13353493 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 12520541 Uniquely mapped reads % | 93.76% Average mapped length | 293.94 Number of splices: Total | 12409910 Number of splices: Annotated (sjdb) | 12203058 Number of splices: GT/AG | 12216760 Number of splices: GC/AG | 154108 Number of splices: AT/AC | 9022 Number of splices: Non-canonical | 30020 Mismatch rate per base, % | 0.47% Deletion rate per base | 0.04% Deletion average length | 2.43 Insertion rate per base | 0.02% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 384123 % of reads mapped to multiple loci | 2.88% Number of reads mapped to too many loci | 28016 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.07% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 454843 454843 454843 N_multimapping 384123 384123 384123 N_noFeature 306722 12407460 353876 N_ambiguous 131333 617 65049 UnstrandedReadsAssigned:12082486 PositiveStrandReadsAssigned:112464 NegativeStrandReadsAssigned:12101616 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172082 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172082-trimmed-pair1.fastq SRR7172082-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,353,493 reads, 11,945,604 reads pseudoaligned [quant] estimated average fragment length: 251.352 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,067 rounds 52401 SRR7172082.ke.tsv 34699 SRR7172082.se.tsv 87100 total ==> SRR7172082.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1767.65 819 33.5654 Potri.005G024800.1.v4.1 1035 784.648 215 19.8503 Potri.004G059700.1.v4.1 961 710.668 26 2.65039 Potri.007G009000.2.v4.1 1416 1165.65 0 0 Potri.003G141000.2.v4.1 2943 2692.65 438.302 11.7923 Potri.016G087400.1.v4.1 270 73.8714 1072 1051.29 Potri.015G069301.1.v4.1 564 317.786 0 0 Potri.010G195200.1.v4.1 1773 1522.65 163 7.75518 Potri.012G127500.1.v4.1 977 726.663 3724 371.262 ==> SRR7172082.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 38 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 349 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 124 SRR7172082 completed mapping pipeline successfully