Starting /dee2/code/volunteer_pipeline.sh SRR7172083 current disk space = 3110559252480 free memory = 1578849160 SRR7172083 SRAfilesize 0cbffd5c43966f2823192d4f43f7cca9 SRR7172083.sra SRR7172083.sra file validated SRR7172083 is paired end SRR7172083 is conventional basespace SRR7172083 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172083_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.37225 33.0 33.0 34.0 32.0 34.0 2 32.95375 34.0 33.0 34.0 31.0 34.0 3 32.12025 33.0 32.0 33.0 30.0 34.0 4 32.63625 33.0 33.0 33.0 32.0 34.0 5 33.15025 33.0 33.0 34.0 33.0 34.0 6 36.79925 38.0 37.0 38.0 35.0 38.0 7 37.23575 38.0 38.0 38.0 36.0 38.0 8 37.441 38.0 38.0 38.0 36.0 38.0 9 37.64425 38.0 38.0 38.0 38.0 38.0 10-14 37.68555 38.0 38.0 38.0 38.0 38.0 15-19 37.71755 38.0 38.0 38.0 38.0 38.0 20-24 37.679199999999994 38.0 38.0 38.0 38.0 38.0 25-29 37.680949999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.647450000000006 38.0 38.0 38.0 38.0 38.0 35-39 37.64895 38.0 38.0 38.0 38.0 38.0 40-44 37.60335 38.0 38.0 38.0 38.0 38.0 45-49 37.58605 38.0 38.0 38.0 38.0 38.0 50-54 37.46655 38.0 38.0 38.0 37.2 38.0 55-59 37.4332 38.0 38.0 38.0 37.0 38.0 60-64 37.4029 38.0 38.0 38.0 37.0 38.0 65-69 37.27654999999999 38.0 38.0 38.0 36.8 38.0 70-74 37.29075 38.0 38.0 38.0 37.0 38.0 75-79 37.18175000000001 38.0 38.0 38.0 36.2 38.0 80-84 37.1948 38.0 38.0 38.0 36.0 38.0 85-89 37.1022 38.0 38.0 38.0 36.0 38.0 90-94 36.993199999999995 38.0 38.0 38.0 35.8 38.0 95-99 36.883750000000006 38.0 38.0 38.0 35.4 38.0 100-104 36.7099 38.0 38.0 38.0 34.8 38.0 105-109 36.50605 38.0 38.0 38.0 34.0 38.0 110-114 36.368 38.0 37.8 38.0 33.8 38.0 115-119 36.173899999999996 38.0 37.0 38.0 33.2 38.0 120-124 36.1625 38.0 37.0 38.0 33.4 38.0 125-129 35.9313 38.0 37.0 38.0 32.6 38.0 130-134 35.60875 38.0 36.4 38.0 31.8 38.0 135-139 35.186400000000006 38.0 35.4 38.0 29.6 38.0 140-144 35.04005 38.0 35.6 38.0 29.0 38.0 145-149 34.362300000000005 38.0 35.0 38.0 26.4 38.0 150-151 30.552 36.5 29.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 0.0 15 1.0 16 2.0 17 1.0 18 2.0 19 3.0 20 3.0 21 3.0 22 4.0 23 7.0 24 7.0 25 5.0 26 6.0 27 11.0 28 12.0 29 20.0 30 21.0 31 32.0 32 49.0 33 62.0 34 133.0 35 281.0 36 768.0 37 2566.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.368016944665076 16.309240137675403 15.620863118877415 37.7018797987821 2 20.05 24.474999999999998 38.550000000000004 16.925 3 18.025 28.999999999999996 27.325 25.650000000000002 4 21.5 36.975 19.875 21.65 5 20.7 36.6 24.3 18.4 6 15.125 36.75 26.424999999999997 21.7 7 12.55 21.025 45.800000000000004 20.625 8 18.25 21.349999999999998 28.249999999999996 32.15 9 17.775 22.425 32.300000000000004 27.500000000000004 10-14 19.08 29.765000000000004 26.325 24.83 15-19 19.525000000000002 28.73 27.779999999999998 23.965 20-24 19.634999999999998 28.78 28.485 23.1 25-29 19.395 28.754999999999995 28.110000000000003 23.74 30-34 19.585 29.189999999999998 27.689999999999998 23.535 35-39 19.59 28.689999999999998 28.544999999999998 23.175 40-44 20.31 28.62 27.325 23.745 45-49 19.575 28.804999999999996 27.91 23.71 50-54 20.26 28.084999999999997 28.175 23.48 55-59 19.85 28.565 28.01 23.575 60-64 19.919999999999998 28.23 28.305000000000003 23.544999999999998 65-69 19.994999999999997 28.689999999999998 28.044999999999998 23.27 70-74 20.225 28.48 27.565 23.73 75-79 19.96 28.675 27.48 23.885 80-84 19.955000000000002 28.59 27.87 23.585 85-89 19.36 28.9 27.750000000000004 23.990000000000002 90-94 20.015 28.265 27.82 23.9 95-99 20.380000000000003 28.575 27.375 23.669999999999998 100-104 20.155 28.225 27.794999999999998 23.825 105-109 19.805 28.499999999999996 28.144999999999996 23.549999999999997 110-114 20.01 27.644999999999996 28.285 24.060000000000002 115-119 19.939999999999998 28.610000000000003 28.205000000000002 23.244999999999997 120-124 20.485 27.589999999999996 28.565 23.36 125-129 20.47 28.275 27.43 23.825 130-134 20.305 28.505000000000003 27.6 23.59 135-139 20.72 27.875 27.725 23.68 140-144 20.835 28.12 27.384999999999998 23.66 145-149 20.830000000000002 29.054999999999996 26.77 23.345 150-151 21.2 28.287499999999998 25.9875 24.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.5 19 1.0 20 0.0 21 2.0 22 2.0 23 0.0 24 2.5 25 3.0 26 4.5 27 6.5 28 8.5 29 13.5 30 23.5 31 31.5 32 32.5 33 46.5 34 56.5 35 81.0 36 110.0 37 126.5 38 149.5 39 168.5 40 201.5 41 232.5 42 260.5 43 265.5 44 273.5 45 283.0 46 269.5 47 247.0 48 217.0 49 185.5 50 151.5 51 126.0 52 97.5 53 80.5 54 66.5 55 44.5 56 27.5 57 21.5 58 18.5 59 14.5 60 13.5 61 9.5 62 4.0 63 3.0 64 2.5 65 3.0 66 3.0 67 1.0 68 0.5 69 0.5 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.42500000000000004 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.6375 0.0 0.0 0.0 0.0 112-113 0.725 0.0 0.0 0.0 0.0 114-115 0.8125 0.0 0.0 0.0 0.0 116-117 0.9624999999999999 0.0 0.0 0.0 0.0 118-119 1.1375 0.0 0.0 0.0 0.0 120-121 1.2875 0.0 0.0 0.0 0.0 122-123 1.5625 0.0 0.0 0.0 0.0 124-125 1.7374999999999998 0.0 0.0 0.0 0.0 126-127 2.125 0.0 0.0 0.0 0.0 128-129 2.3125 0.0 0.0 0.0 0.0 130-131 2.6624999999999996 0.0 0.0 0.0 0.0 132-133 2.9875 0.0 0.0 0.0 0.0 134-135 3.1875 0.0 0.0 0.0 0.0 136-137 3.475 0.0 0.0 0.0 0.0 138-139 3.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172083 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172083_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.33425 34.0 33.0 34.0 33.0 34.0 2 33.4455 34.0 33.0 34.0 33.0 34.0 3 33.45825 34.0 33.0 34.0 33.0 34.0 4 33.3955 34.0 33.0 34.0 33.0 34.0 5 33.44475 34.0 33.0 34.0 33.0 34.0 6 37.6365 38.0 38.0 38.0 38.0 38.0 7 37.68375 38.0 38.0 38.0 38.0 38.0 8 37.676 38.0 38.0 38.0 38.0 38.0 9 37.62825 38.0 38.0 38.0 38.0 38.0 10-14 37.63075 38.0 38.0 38.0 38.0 38.0 15-19 37.619749999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.60510000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.58105 38.0 38.0 38.0 38.0 38.0 30-34 37.525999999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.485800000000005 38.0 38.0 38.0 38.0 38.0 40-44 37.463100000000004 38.0 38.0 38.0 37.8 38.0 45-49 37.468650000000004 38.0 38.0 38.0 37.6 38.0 50-54 37.446000000000005 38.0 38.0 38.0 37.2 38.0 55-59 37.3651 38.0 38.0 38.0 37.0 38.0 60-64 37.298950000000005 38.0 38.0 38.0 37.0 38.0 65-69 37.21665 38.0 38.0 38.0 36.8 38.0 70-74 37.1879 38.0 38.0 38.0 36.8 38.0 75-79 37.07375 38.0 38.0 38.0 36.2 38.0 80-84 37.04875 38.0 38.0 38.0 36.0 38.0 85-89 36.929050000000004 38.0 38.0 38.0 35.6 38.0 90-94 36.851749999999996 38.0 38.0 38.0 35.6 38.0 95-99 36.7537 38.0 38.0 38.0 35.2 38.0 100-104 36.71265 38.0 38.0 38.0 34.8 38.0 105-109 36.5515 38.0 38.0 38.0 34.2 38.0 110-114 36.377750000000006 38.0 38.0 38.0 34.0 38.0 115-119 36.1825 38.0 37.6 38.0 33.6 38.0 120-124 35.9681 38.0 37.2 38.0 33.2 38.0 125-129 35.629999999999995 38.0 36.4 38.0 31.8 38.0 130-134 35.34125 38.0 36.0 38.0 31.0 38.0 135-139 35.10690000000001 38.0 35.8 38.0 28.6 38.0 140-144 34.725 38.0 35.0 38.0 28.0 38.0 145-149 34.099650000000004 38.0 34.2 38.0 25.8 38.0 150-151 30.297375 36.0 29.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 2.0 10 0.0 11 0.0 12 0.0 13 2.0 14 0.0 15 1.0 16 2.0 17 2.0 18 2.0 19 4.0 20 3.0 21 3.0 22 8.0 23 2.0 24 8.0 25 9.0 26 13.0 27 19.0 28 23.0 29 20.0 30 25.0 31 43.0 32 52.0 33 69.0 34 123.0 35 237.0 36 653.0 37 2673.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.4 12.825000000000001 19.325 35.449999999999996 2 22.325 21.4 39.15 17.125 3 19.075 27.200000000000003 32.550000000000004 21.175 4 24.575 33.775 20.9 20.75 5 23.799999999999997 36.575 22.3 17.325 6 18.2 37.375 24.875 19.55 7 17.8 15.375 45.824999999999996 21.0 8 19.650000000000002 21.175 29.575000000000003 29.599999999999998 9 21.85 23.025000000000002 29.625 25.5 10-14 22.759999999999998 29.020000000000003 26.3 21.92 15-19 23.165 27.21 29.020000000000003 20.605 20-24 22.46 28.749999999999996 28.275 20.515 25-29 22.509999999999998 28.38 28.335 20.775 30-34 22.725 28.115000000000002 28.560000000000002 20.599999999999998 35-39 23.115 28.49 27.755000000000003 20.64 40-44 22.98 27.950000000000003 28.444999999999997 20.625 45-49 22.895 28.215 28.110000000000003 20.78 50-54 23.185 28.384999999999998 28.215 20.215 55-59 23.235 27.555000000000003 28.705000000000002 20.505000000000003 60-64 23.73 28.044999999999998 28.194999999999997 20.03 65-69 22.855 28.875 27.855 20.415 70-74 23.51 28.655 27.68 20.155 75-79 23.155 28.499999999999996 27.445000000000004 20.9 80-84 23.055 27.875 28.43 20.64 85-89 22.835 28.634999999999998 27.994999999999997 20.535 90-94 23.435 27.74 28.02 20.805 95-99 23.13 27.805000000000003 28.435 20.630000000000003 100-104 23.695 28.26 27.639999999999997 20.405 105-109 23.655 27.975 27.855 20.515 110-114 23.635 27.515 28.155 20.695 115-119 23.14 28.165000000000003 28.12 20.575 120-124 23.845 27.975 28.244999999999997 19.935 125-129 23.57 28.205000000000002 27.800000000000004 20.424999999999997 130-134 23.549999999999997 28.09 27.834999999999997 20.525 135-139 24.48 28.205000000000002 27.32 19.994999999999997 140-144 24.685000000000002 27.644999999999996 27.744999999999997 19.925 145-149 25.05 27.944999999999997 27.47 19.535 150-151 24.7375 27.725 27.375 20.1625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 2.0 23 2.0 24 2.5 25 2.5 26 3.0 27 7.5 28 8.0 29 8.0 30 14.5 31 23.0 32 28.5 33 36.0 34 58.5 35 75.0 36 85.0 37 104.0 38 129.0 39 169.0 40 213.0 41 243.0 42 277.5 43 283.5 44 286.5 45 302.5 46 272.0 47 226.5 48 216.5 49 198.5 50 163.5 51 140.0 52 107.5 53 83.5 54 60.0 55 40.5 56 32.5 57 20.5 58 14.5 59 15.5 60 14.0 61 7.0 62 5.0 63 6.0 64 3.0 65 1.5 66 0.5 67 0.5 68 0.5 69 1.0 70 0.5 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.42500000000000004 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.6375 0.0 0.0 0.0 0.0 112-113 0.725 0.0 0.0 0.0 0.0 114-115 0.8125 0.0 0.0 0.0 0.0 116-117 0.9624999999999999 0.0 0.0 0.0 0.0 118-119 1.1375 0.0 0.0 0.0 0.0 120-121 1.2999999999999998 0.0 0.0 0.0 0.0 122-123 1.5375 0.0 0.0 0.0 0.0 124-125 1.7125 0.0 0.0 0.0 0.0 126-127 2.075 0.0 0.0 0.0 0.0 128-129 2.2625 0.0 0.0 0.0 0.0 130-131 2.5875000000000004 0.0 0.0 0.0 0.0 132-133 2.9125 0.0 0.0 0.0 0.0 134-135 3.1125 0.0 0.0 0.0 0.0 136-137 3.4124999999999996 0.0 0.0 0.0 0.0 138-139 3.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGAAAG 10 0.006830828 145.0 7 >>END_MODULE Read 506408 spots for SRR7172083.sra Written 506408 spots for SRR7172083.sra Read 506408 spots for SRR7172083.sra Written 506408 spots for SRR7172083.sra Read 506408 spots for SRR7172083.sra Written 506408 spots for SRR7172083.sra Read 506408 spots for SRR7172083.sra Written 506408 spots for SRR7172083.sra Read 506408 spots for SRR7172083.sra Written 506408 spots for SRR7172083.sra Read 506408 spots for SRR7172083.sra Written 506408 spots for SRR7172083.sra Read 506408 spots for SRR7172083.sra Written 506408 spots for SRR7172083.sra Read 506408 spots for SRR7172083.sra Written 506408 spots for SRR7172083.sra Read 506408 spots for SRR7172083.sra Written 506408 spots for SRR7172083.sra Read 506408 spots for SRR7172083.sra Written 506408 spots for SRR7172083.sra Read 506408 spots for SRR7172083.sra Written 506408 spots for SRR7172083.sra Read 506408 spots for SRR7172083.sra Written 506408 spots for SRR7172083.sra Read 506408 spots for SRR7172083.sra Written 506408 spots for SRR7172083.sra Read 506408 spots for SRR7172083.sra Written 506408 spots for SRR7172083.sra Read 506427 spots for SRR7172083.sra Written 506427 spots for SRR7172083.sra Read 506408 spots for SRR7172083.sra Written 506408 spots for SRR7172083.sra Read 506408 spots for SRR7172083.sra Written 506408 spots for SRR7172083.sra Read 506408 spots for SRR7172083.sra Written 506408 spots for SRR7172083.sra Read 506408 spots for SRR7172083.sra Written 506408 spots for SRR7172083.sra Read 506408 spots for SRR7172083.sra Written 506408 spots for SRR7172083.sra SRR ids: ['SRR7172083.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b2mhh_61 SRR7172083.sra spots: 10128179 blocks: [[1, 506408], [506409, 1012816], [1012817, 1519224], [1519225, 2025632], [2025633, 2532040], [2532041, 3038448], [3038449, 3544856], [3544857, 4051264], [4051265, 4557672], [4557673, 5064080], [5064081, 5570488], [5570489, 6076896], [6076897, 6583304], [6583305, 7089712], [7089713, 7596120], [7596121, 8102528], [8102529, 8608936], [8608937, 9115344], [9115345, 9621752], [9621753, 10128179]] SRR7172083 file size 3410407 SRR7172083 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172083 SRR7172083_1.fastq SRR7172083_2.fastq Input file: SRR7172083_1.fastq Paired file: SRR7172083_2.fastq trimmed: SRR7172083-trimmed-pair1.fastq, SRR7172083-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 18:39:18 2025 >> started Fri Feb 14 18:39:41 2025 >> done (22.866s) 10128179 read pairs processed; of these: 2737 ( 0.03%) short read pairs filtered out after trimming by size control 2214 ( 0.02%) empty read pairs filtered out after trimming by size control 10123228 (99.95%) read pairs available; of these: 4929040 (48.69%) trimmed read pairs available after processing 5194188 (51.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 0 0.00% 20 1 0.00% 21 1 0.00% 22 1 0.00% 23 1 0.00% 24 3 0.00% 25 2 0.00% 26 3 0.00% 27 3 0.00% 28 5 0.00% 29 6 0.00% 30 3 0.00% 31 2 0.00% 32 2 0.00% 33 2 0.00% 34 1 0.00% 35 6 0.00% 36 1 0.00% 37 4 0.00% 38 3 0.00% 39 5 0.00% 40 6 0.00% 41 2 0.00% 42 3 0.00% 43 1 0.00% 44 1 0.00% 45 4 0.00% 46 5 0.00% 47 7 0.00% 48 9 0.00% 49 9 0.00% 50 13 0.00% 51 8 0.00% 52 15 0.00% 53 17 0.00% 54 17 0.00% 55 20 0.00% 56 25 0.00% 57 21 0.00% 58 29 0.00% 59 24 0.00% 60 27 0.00% 61 45 0.00% 62 42 0.00% 63 59 0.00% 64 62 0.00% 65 47 0.00% 66 75 0.00% 67 78 0.00% 68 95 0.00% 69 96 0.00% 70 121 0.00% 71 117 0.00% 72 156 0.00% 73 202 0.00% 74 211 0.00% 75 289 0.00% 76 338 0.00% 77 372 0.00% 78 348 0.00% 79 391 0.00% 80 460 0.00% 81 511 0.01% 82 585 0.01% 83 696 0.01% 84 949 0.01% 85 1122 0.01% 86 1299 0.01% 87 1438 0.01% 88 1674 0.02% 89 1639 0.02% 90 1935 0.02% 91 2076 0.02% 92 2169 0.02% 93 2436 0.02% 94 2660 0.03% 95 2892 0.03% 96 3090 0.03% 97 3431 0.03% 98 3701 0.04% 99 3969 0.04% 100 4125 0.04% 101 4568 0.05% 102 4970 0.05% 103 5224 0.05% 104 5568 0.06% 105 6083 0.06% 106 6474 0.06% 107 6934 0.07% 108 7294 0.07% 109 7764 0.08% 110 8314 0.08% 111 8589 0.08% 112 9198 0.09% 113 9700 0.10% 114 10183 0.10% 115 10932 0.11% 116 11547 0.11% 117 12307 0.12% 118 12716 0.13% 119 13645 0.13% 120 14003 0.14% 121 15048 0.15% 122 15532 0.15% 123 16453 0.16% 124 17478 0.17% 125 18383 0.18% 126 19588 0.19% 127 20923 0.21% 128 21921 0.22% 129 23313 0.23% 130 24352 0.24% 131 26067 0.26% 132 27723 0.27% 133 29636 0.29% 134 31391 0.31% 135 33207 0.33% 136 35567 0.35% 137 38527 0.38% 138 41146 0.41% 139 44860 0.44% 140 48900 0.48% 141 53622 0.53% 142 60777 0.60% 143 69988 0.69% 144 82992 0.82% 145 101387 1.00% 146 131359 1.30% 147 186617 1.84% 148 302497 2.99% 149 628414 6.21% 150 2539037 25.08% 151 5194188 51.31% 10123228 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=4.75 fanout-score-rank=24 prefix-density=0.27 prefix-fanout=3.7 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=23 fanout-score=62.75 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=16.7 sequence=TCATCCTCATCA criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=34 prefix-density=0.40 prefix-fanout=2.1 sequence=GGCAGTGGCTGCAAATGTGGCATGTACCCTGACTTAGGTTTCTCAGAGAACACCACAACTGAGACAATCATTGCAGGT criterion=fanout-score sequence-density=0.08 sequence-density-rank=29 fanout-score=122.91 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=22.3 sequence=TGATGAGGATGA SRR7172083 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 18:40:44 Started mapping on | Feb 14 18:40:44 Finished on | Feb 14 18:41:54 Mapping speed, Million of reads per hour | 520.62 Number of input reads | 10123228 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 9614641 Uniquely mapped reads % | 94.98% Average mapped length | 295.81 Number of splices: Total | 9415245 Number of splices: Annotated (sjdb) | 9219317 Number of splices: GT/AG | 9256075 Number of splices: GC/AG | 122412 Number of splices: AT/AC | 7224 Number of splices: Non-canonical | 29534 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.04% Deletion average length | 2.40 Insertion rate per base | 0.03% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 270829 % of reads mapped to multiple loci | 2.68% Number of reads mapped to too many loci | 29205 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.98% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 241764 241764 241764 N_multimapping 270829 270829 270829 N_noFeature 342521 9520252 389344 N_ambiguous 102522 959 54191 UnstrandedReadsAssigned:9169598 PositiveStrandReadsAssigned:93430 NegativeStrandReadsAssigned:9171106 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172083 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172083-trimmed-pair1.fastq SRR7172083-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,123,228 reads, 9,086,227 reads pseudoaligned [quant] estimated average fragment length: 258.844 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,133 rounds 52401 SRR7172083.ke.tsv 34699 SRR7172083.se.tsv 87100 total ==> SRR7172083.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1760.16 1070 65.2972 Potri.005G024800.1.v4.1 1035 777.156 177 24.464 Potri.004G059700.1.v4.1 961 703.244 76 11.6083 Potri.007G009000.2.v4.1 1416 1158.16 0 0 Potri.003G141000.2.v4.1 2943 2685.16 273.434 10.9382 Potri.016G087400.1.v4.1 270 73.672 470 685.262 Potri.015G069301.1.v4.1 564 313.297 0 0 Potri.010G195200.1.v4.1 1773 1515.16 329.911 23.3884 Potri.012G127500.1.v4.1 977 719.198 7484 1117.76 ==> SRR7172083.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 26 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 299 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 193 SRR7172083 completed mapping pipeline successfully