Starting /dee2/code/volunteer_pipeline.sh SRR7172084 current disk space = 3088292380672 free memory = 1442555752 SRR7172084 SRAfilesize e8a61d2b6fec6e2d20f6dea5c8a607f9 SRR7172084.sra SRR7172084.sra file validated SRR7172084 is paired end SRR7172084 is conventional basespace SRR7172084 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172084_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.83125 33.0 32.0 33.0 27.0 34.0 2 31.79875 33.0 32.0 33.0 28.0 34.0 3 31.68225 33.0 31.0 33.0 28.0 34.0 4 32.44675 33.0 33.0 33.0 31.0 34.0 5 32.23475 33.0 33.0 33.0 31.0 34.0 6 35.915 37.0 36.0 38.0 33.0 38.0 7 37.03725 38.0 37.0 38.0 35.0 38.0 8 37.26775 38.0 38.0 38.0 36.0 38.0 9 37.3405 38.0 38.0 38.0 36.0 38.0 10-14 37.3452 38.0 38.0 38.0 36.6 38.0 15-19 37.37180000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.349450000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.38005 38.0 38.0 38.0 37.0 38.0 30-34 37.35235 38.0 38.0 38.0 37.0 38.0 35-39 37.279149999999994 38.0 38.0 38.0 36.4 38.0 40-44 37.2159 38.0 38.0 38.0 36.2 38.0 45-49 37.1648 38.0 38.0 38.0 36.2 38.0 50-54 37.01095 38.0 38.0 38.0 36.0 38.0 55-59 36.90685 38.0 38.0 38.0 35.0 38.0 60-64 36.81025 38.0 38.0 38.0 34.8 38.0 65-69 36.751400000000004 38.0 38.0 38.0 34.4 38.0 70-74 36.662349999999996 38.0 38.0 38.0 34.2 38.0 75-79 36.552 38.0 37.6 38.0 34.0 38.0 80-84 36.4418 38.0 37.4 38.0 34.0 38.0 85-89 36.22935 38.0 37.0 38.0 33.4 38.0 90-94 36.158550000000005 38.0 37.0 38.0 33.2 38.0 95-99 35.9832 38.0 37.0 38.0 32.4 38.0 100-104 35.6757 38.0 36.4 38.0 31.0 38.0 105-109 35.38745 38.0 36.0 38.0 29.8 38.0 110-114 35.24505 38.0 35.8 38.0 28.8 38.0 115-119 35.220749999999995 38.0 35.6 38.0 29.0 38.0 120-124 34.82135 38.0 35.0 38.0 27.4 38.0 125-129 34.544799999999995 38.0 35.0 38.0 26.6 38.0 130-134 34.2701 38.0 34.4 38.0 24.6 38.0 135-139 33.75885 38.0 34.0 38.0 22.4 38.0 140-144 32.995799999999996 38.0 33.2 38.0 14.8 38.0 145-149 32.125 36.4 32.8 38.0 13.8 38.0 150-151 28.039375 35.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 2.0 15 2.0 16 4.0 17 3.0 18 0.0 19 4.0 20 4.0 21 7.0 22 8.0 23 10.0 24 7.0 25 14.0 26 15.0 27 13.0 28 30.0 29 29.0 30 49.0 31 76.0 32 110.0 33 164.0 34 279.0 35 498.0 36 1136.0 37 1533.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.942287513116476 18.52046169989507 13.53620146904512 33.001049317943334 2 20.80520130032508 24.63115778944736 34.658664666166544 19.904976244061015 3 18.224999999999998 31.45 28.4 21.925 4 21.224999999999998 35.699999999999996 23.75 19.325 5 21.175 36.525 23.724999999999998 18.575 6 17.375 37.95 23.425 21.25 7 13.775 20.275000000000002 45.15 20.8 8 17.65 22.425 28.4 31.525 9 18.2 23.3 30.025000000000002 28.475 10-14 20.055 29.265 26.71 23.97 15-19 20.375 29.220000000000002 27.034999999999997 23.369999999999997 20-24 20.355 28.765 27.955000000000002 22.925 25-29 20.085 29.275000000000002 27.71 22.93 30-34 20.025000000000002 28.99 27.800000000000004 23.185 35-39 20.48 28.64 27.565 23.315 40-44 19.915 28.895 27.87 23.32 45-49 20.685000000000002 28.865000000000002 27.500000000000004 22.95 50-54 20.385 29.459999999999997 27.13 23.025000000000002 55-59 19.775000000000002 28.804999999999996 28.275 23.145 60-64 20.07 28.93 27.615000000000002 23.385 65-69 20.21 28.310000000000002 27.939999999999998 23.54 70-74 20.41 28.82 27.025 23.745 75-79 20.115 29.17 27.195000000000004 23.52 80-84 20.36 28.749999999999996 27.395000000000003 23.494999999999997 85-89 20.685000000000002 28.904999999999998 27.529999999999998 22.88 90-94 20.695 28.799999999999997 27.71 22.795 95-99 20.68 28.77 27.405 23.145 100-104 20.565 28.775000000000002 27.689999999999998 22.97 105-109 20.855 28.21 27.775 23.16 110-114 20.97 28.235 27.275 23.52 115-119 20.919999999999998 28.93 27.150000000000002 23.0 120-124 21.335 28.084999999999997 27.13 23.45 125-129 21.32 28.275 26.955000000000002 23.45 130-134 21.32 28.46 26.135 24.085 135-139 21.490000000000002 28.13 26.75 23.630000000000003 140-144 21.015 28.23 26.66 24.095 145-149 21.08 28.505000000000003 26.5 23.915 150-151 21.175 28.325 26.4125 24.087500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 1.0 18 1.0 19 2.5 20 2.5 21 0.5 22 1.0 23 2.5 24 3.5 25 3.0 26 4.0 27 7.0 28 13.5 29 18.0 30 22.0 31 25.5 32 44.0 33 60.5 34 63.0 35 88.5 36 116.5 37 122.0 38 146.5 39 172.5 40 194.0 41 226.5 42 254.5 43 253.5 44 245.5 45 251.5 46 245.5 47 232.0 48 203.5 49 180.5 50 161.5 51 135.5 52 111.5 53 91.0 54 70.0 55 52.5 56 38.5 57 31.0 58 21.0 59 13.0 60 17.5 61 13.0 62 6.0 63 6.5 64 4.5 65 3.5 66 4.0 67 3.0 68 2.0 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.7 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.89987484355444 99.775 2 0.0750938673341677 0.15 3 0.025031289111389236 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1625 0.0 0.0 0.0 0.0 90-91 0.23750000000000002 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.9 0.0 0.0 0.0 0.0 104-105 1.1375000000000002 0.0 0.0 0.0 0.0 106-107 1.4125 0.0 0.0 0.0 0.0 108-109 1.65 0.0 0.0 0.0 0.0 110-111 2.0125 0.0 0.0 0.0 0.0 112-113 2.3125 0.0 0.0 0.0 0.0 114-115 2.6 0.0 0.0 0.0 0.0 116-117 3.0250000000000004 0.0 0.0 0.0 0.0 118-119 3.35 0.0 0.0 0.0 0.0 120-121 3.9125 0.0 0.0 0.0 0.0 122-123 4.4 0.0 0.0 0.0 0.0 124-125 4.85 0.0 0.0 0.0 0.0 126-127 5.325 0.0 0.0 0.0 0.0 128-129 5.8125 0.0 0.0 0.0 0.0 130-131 6.4 0.0 0.0 0.0 0.0 132-133 6.800000000000001 0.0 0.0 0.0 0.0 134-135 7.4 0.0 0.0 0.0 0.0 136-137 7.8875 0.0 0.0 0.0 0.0 138-139 8.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCAGG 10 0.0068343505 144.975 9 >>END_MODULE SRR7172084 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172084_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9715 33.0 33.0 34.0 32.0 34.0 2 33.11925 34.0 33.0 34.0 33.0 34.0 3 33.184 34.0 33.0 34.0 33.0 34.0 4 33.13875 34.0 33.0 34.0 33.0 34.0 5 33.21625 34.0 33.0 34.0 33.0 34.0 6 37.311 38.0 38.0 38.0 37.0 38.0 7 37.4405 38.0 38.0 38.0 37.0 38.0 8 37.41425 38.0 38.0 38.0 38.0 38.0 9 37.40825 38.0 38.0 38.0 37.0 38.0 10-14 37.41185 38.0 38.0 38.0 37.2 38.0 15-19 37.393950000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.34804999999999 38.0 38.0 38.0 37.0 38.0 25-29 37.3033 38.0 38.0 38.0 37.0 38.0 30-34 37.324749999999995 38.0 38.0 38.0 37.0 38.0 35-39 37.192899999999995 38.0 38.0 38.0 36.8 38.0 40-44 37.26825 38.0 38.0 38.0 37.0 38.0 45-49 37.196450000000006 38.0 38.0 38.0 37.0 38.0 50-54 37.1412 38.0 38.0 38.0 36.4 38.0 55-59 37.0768 38.0 38.0 38.0 36.0 38.0 60-64 37.05925 38.0 38.0 38.0 36.0 38.0 65-69 36.963800000000006 38.0 38.0 38.0 36.0 38.0 70-74 36.857749999999996 38.0 38.0 38.0 35.6 38.0 75-79 36.787 38.0 38.0 38.0 35.2 38.0 80-84 36.64834999999999 38.0 38.0 38.0 34.6 38.0 85-89 36.53305 38.0 38.0 38.0 34.2 38.0 90-94 36.370999999999995 38.0 38.0 38.0 34.0 38.0 95-99 36.228300000000004 38.0 37.8 38.0 33.8 38.0 100-104 36.1614 38.0 37.0 38.0 33.4 38.0 105-109 35.930350000000004 38.0 37.0 38.0 32.8 38.0 110-114 35.742599999999996 38.0 37.0 38.0 31.2 38.0 115-119 35.603699999999996 38.0 36.6 38.0 31.0 38.0 120-124 35.2482 38.0 36.0 38.0 29.2 38.0 125-129 34.7852 38.0 35.0 38.0 27.4 38.0 130-134 34.49640000000001 38.0 35.0 38.0 26.6 38.0 135-139 34.22475 38.0 34.8 38.0 24.0 38.0 140-144 33.60699999999999 38.0 34.0 38.0 21.8 38.0 145-149 32.461650000000006 38.0 32.8 38.0 13.6 38.0 150-151 28.110875 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 2.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 2.0 13 2.0 14 0.0 15 1.0 16 0.0 17 1.0 18 2.0 19 5.0 20 5.0 21 5.0 22 6.0 23 11.0 24 6.0 25 15.0 26 18.0 27 18.0 28 23.0 29 39.0 30 50.0 31 66.0 32 64.0 33 108.0 34 175.0 35 356.0 36 902.0 37 2110.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.95 15.575 15.9 28.575 2 25.35 22.075 33.7 18.875 3 19.650000000000002 27.700000000000003 31.65 21.0 4 23.7 34.325 21.224999999999998 20.75 5 23.175 37.2 21.2 18.425 6 18.45 37.0 23.825 20.724999999999998 7 18.125 16.8 43.9 21.175 8 20.724999999999998 21.075 26.974999999999998 31.225 9 21.05 24.975 28.000000000000004 25.974999999999998 10-14 22.770000000000003 28.615000000000002 26.369999999999997 22.245 15-19 23.215 28.03 27.525 21.23 20-24 22.675 28.38 27.67 21.275 25-29 22.6 28.854999999999997 27.250000000000004 21.295 30-34 22.895 27.345000000000002 27.99 21.77 35-39 22.91 27.810000000000002 27.79 21.490000000000002 40-44 23.044999999999998 26.945000000000004 28.455000000000002 21.555 45-49 22.945 27.435 28.43 21.19 50-54 23.23 28.325 27.794999999999998 20.65 55-59 23.48 27.694999999999997 28.095 20.73 60-64 23.68 27.26 28.349999999999998 20.71 65-69 23.799999999999997 27.639999999999997 27.825 20.735 70-74 23.87 27.565 27.455000000000002 21.11 75-79 23.265 27.575 28.360000000000003 20.8 80-84 23.055 27.62 28.08 21.245 85-89 23.419999999999998 27.985 27.744999999999997 20.849999999999998 90-94 23.080000000000002 28.355000000000004 28.225 20.34 95-99 23.51 27.275 28.26 20.955 100-104 24.075 27.575 27.435 20.915 105-109 23.630000000000003 27.905 28.01 20.455000000000002 110-114 23.965 28.005000000000003 27.905 20.125 115-119 24.02 27.88 27.72 20.380000000000003 120-124 24.4 27.845 27.284999999999997 20.47 125-129 24.54 27.689999999999998 27.805000000000003 19.965 130-134 23.98 28.465 27.505000000000003 20.05 135-139 24.759999999999998 28.084999999999997 26.805 20.349999999999998 140-144 25.169999999999998 27.575 27.38 19.875 145-149 24.9 27.505000000000003 27.605 19.99 150-151 25.775 26.924999999999997 27.0625 20.2375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 2.0 24 2.0 25 2.5 26 2.5 27 4.0 28 7.5 29 8.5 30 13.0 31 18.5 32 22.5 33 33.5 34 45.5 35 54.0 36 82.0 37 115.5 38 126.0 39 153.5 40 185.5 41 216.5 42 263.5 43 283.0 44 274.0 45 286.0 46 263.5 47 233.5 48 238.5 49 200.0 50 154.5 51 138.0 52 125.0 53 98.5 54 73.5 55 63.0 56 50.5 57 34.5 58 31.5 59 27.5 60 16.0 61 11.0 62 9.5 63 6.5 64 4.0 65 3.5 66 3.5 67 1.5 68 1.0 69 1.5 70 1.0 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.5874999999999999 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 1.0499999999999998 0.0 0.0 0.0 0.0 106-107 1.35 0.0 0.0 0.0 0.0 108-109 1.5875 0.0 0.0 0.0 0.0 110-111 1.9125 0.0 0.0 0.0 0.0 112-113 2.2125 0.0 0.0 0.0 0.0 114-115 2.5374999999999996 0.0 0.0 0.0 0.0 116-117 2.925 0.0 0.0 0.0 0.0 118-119 3.275 0.0 0.0 0.0 0.0 120-121 3.8125 0.0 0.0 0.0 0.0 122-123 4.2625 0.0 0.0 0.0 0.0 124-125 4.725 0.0 0.0 0.0 0.0 126-127 5.225 0.0 0.0 0.0 0.0 128-129 5.7125 0.0 0.0 0.0 0.0 130-131 6.2625 0.0 0.0 0.0 0.0 132-133 6.6625 0.0 0.0 0.0 0.0 134-135 7.3125 0.0 0.0 0.0 0.0 136-137 7.9 0.0 0.0 0.0 0.0 138-139 8.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATTACG 10 0.006830828 145.0 4 CACTTGC 10 0.006830828 145.0 3 >>END_MODULE Read 544334 spots for SRR7172084.sra Written 544334 spots for SRR7172084.sra Read 544334 spots for SRR7172084.sra Written 544334 spots for SRR7172084.sra Read 544334 spots for SRR7172084.sra Written 544334 spots for SRR7172084.sra Read 544334 spots for SRR7172084.sra Written 544334 spots for SRR7172084.sra Read 544334 spots for SRR7172084.sra Written 544334 spots for SRR7172084.sra Read 544334 spots for SRR7172084.sra Written 544334 spots for SRR7172084.sra Read 544334 spots for SRR7172084.sra Written 544334 spots for SRR7172084.sra Read 544334 spots for SRR7172084.sra Written 544334 spots for SRR7172084.sra Read 544334 spots for SRR7172084.sra Written 544334 spots for SRR7172084.sra Read 544334 spots for SRR7172084.sra Written 544334 spots for SRR7172084.sra Read 544334 spots for SRR7172084.sra Written 544334 spots for SRR7172084.sra Read 544334 spots for SRR7172084.sra Written 544334 spots for SRR7172084.sra Read 544334 spots for SRR7172084.sra Written 544334 spots for SRR7172084.sra Read 544334 spots for SRR7172084.sra Written 544334 spots for SRR7172084.sra Read 544334 spots for SRR7172084.sra Written 544334 spots for SRR7172084.sra Read 544334 spots for SRR7172084.sra Written 544334 spots for SRR7172084.sra Read 544334 spots for SRR7172084.sra Written 544334 spots for SRR7172084.sra Read 544334 spots for SRR7172084.sra Written 544334 spots for SRR7172084.sra Read 544334 spots for SRR7172084.sra Written 544334 spots for SRR7172084.sra Read 544334 spots for SRR7172084.sra Written 544334 spots for SRR7172084.sra SRR ids: ['SRR7172084.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fguv5f8x SRR7172084.sra spots: 10886680 blocks: [[1, 544334], [544335, 1088668], [1088669, 1633002], [1633003, 2177336], [2177337, 2721670], [2721671, 3266004], [3266005, 3810338], [3810339, 4354672], [4354673, 4899006], [4899007, 5443340], [5443341, 5987674], [5987675, 6532008], [6532009, 7076342], [7076343, 7620676], [7620677, 8165010], [8165011, 8709344], [8709345, 9253678], [9253679, 9798012], [9798013, 10342346], [10342347, 10886680]] SRR7172084 file size 3667438 SRR7172084 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172084 SRR7172084_1.fastq SRR7172084_2.fastq Input file: SRR7172084_1.fastq Paired file: SRR7172084_2.fastq trimmed: SRR7172084-trimmed-pair1.fastq, SRR7172084-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 03:27:19 2025 >> started Fri Feb 14 03:27:32 2025 >> done (13.580s) 10886680 read pairs processed; of these: 8148 ( 0.07%) short read pairs filtered out after trimming by size control 4813 ( 0.04%) empty read pairs filtered out after trimming by size control 10873719 (99.88%) read pairs available; of these: 7488773 (68.87%) trimmed read pairs available after processing 3384946 (31.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 0 0.00% 20 3 0.00% 21 3 0.00% 22 3 0.00% 23 1 0.00% 24 5 0.00% 25 1 0.00% 26 7 0.00% 27 5 0.00% 28 2 0.00% 29 5 0.00% 30 4 0.00% 31 5 0.00% 32 5 0.00% 33 5 0.00% 34 5 0.00% 35 2 0.00% 36 12 0.00% 37 4 0.00% 38 5 0.00% 39 6 0.00% 40 6 0.00% 41 11 0.00% 42 7 0.00% 43 14 0.00% 44 15 0.00% 45 15 0.00% 46 24 0.00% 47 26 0.00% 48 11 0.00% 49 25 0.00% 50 26 0.00% 51 39 0.00% 52 38 0.00% 53 38 0.00% 54 54 0.00% 55 56 0.00% 56 57 0.00% 57 72 0.00% 58 78 0.00% 59 88 0.00% 60 97 0.00% 61 107 0.00% 62 148 0.00% 63 138 0.00% 64 165 0.00% 65 184 0.00% 66 196 0.00% 67 244 0.00% 68 258 0.00% 69 291 0.00% 70 338 0.00% 71 413 0.00% 72 484 0.00% 73 563 0.01% 74 610 0.01% 75 703 0.01% 76 814 0.01% 77 866 0.01% 78 996 0.01% 79 1162 0.01% 80 1352 0.01% 81 1647 0.02% 82 1801 0.02% 83 2128 0.02% 84 2726 0.03% 85 3306 0.03% 86 3536 0.03% 87 3966 0.04% 88 4210 0.04% 89 4620 0.04% 90 4960 0.05% 91 5302 0.05% 92 5907 0.05% 93 6420 0.06% 94 7092 0.07% 95 7792 0.07% 96 8275 0.08% 97 8961 0.08% 98 9491 0.09% 99 10266 0.09% 100 11134 0.10% 101 12012 0.11% 102 13102 0.12% 103 14128 0.13% 104 14969 0.14% 105 16220 0.15% 106 17216 0.16% 107 18035 0.17% 108 18732 0.17% 109 20009 0.18% 110 20916 0.19% 111 22295 0.21% 112 23315 0.21% 113 24615 0.23% 114 26212 0.24% 115 27370 0.25% 116 28790 0.26% 117 29561 0.27% 118 30551 0.28% 119 31864 0.29% 120 33389 0.31% 121 34734 0.32% 122 36390 0.33% 123 38594 0.35% 124 40247 0.37% 125 42350 0.39% 126 44484 0.41% 127 46801 0.43% 128 48461 0.45% 129 51179 0.47% 130 54029 0.50% 131 57230 0.53% 132 61121 0.56% 133 65067 0.60% 134 70195 0.65% 135 74845 0.69% 136 81260 0.75% 137 88531 0.81% 138 95809 0.88% 139 105789 0.97% 140 117006 1.08% 141 131317 1.21% 142 149713 1.38% 143 174307 1.60% 144 206918 1.90% 145 252545 2.32% 146 319567 2.94% 147 423751 3.90% 148 607523 5.59% 149 990443 9.11% 150 2410805 22.17% 151 3384946 31.13% 10873719 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=5.78 fanout-score-rank=12 prefix-density=0.59 prefix-fanout=3.3 sequence=TTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGA criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=28.83 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=5.2 sequence=TTGTCAATGGTATCAGAGCTCTCCACCTCCAAGGTGATGGTCT criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=28 prefix-density=0.38 prefix-fanout=2.0 sequence=GGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=23 fanout-score=33.93 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=10.7 sequence=GAGGTTGAGTACAGGTGCTTTGTTGG SRR7172084 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 03:28:20 Started mapping on | Feb 14 03:28:21 Finished on | Feb 14 03:30:12 Mapping speed, Million of reads per hour | 352.66 Number of input reads | 10873719 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 9891721 Uniquely mapped reads % | 90.97% Average mapped length | 289.68 Number of splices: Total | 9023224 Number of splices: Annotated (sjdb) | 8840014 Number of splices: GT/AG | 8871627 Number of splices: GC/AG | 115499 Number of splices: AT/AC | 7779 Number of splices: Non-canonical | 28319 Mismatch rate per base, % | 0.53% Deletion rate per base | 0.04% Deletion average length | 2.11 Insertion rate per base | 0.02% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 291793 % of reads mapped to multiple loci | 2.68% Number of reads mapped to too many loci | 41280 % of reads mapped to too many loci | 0.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.80% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 699057 699057 699057 N_multimapping 291793 291793 291793 N_noFeature 294986 9782626 350438 N_ambiguous 106730 658 52624 UnstrandedReadsAssigned:9490005 PositiveStrandReadsAssigned:108437 NegativeStrandReadsAssigned:9488659 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR7172084 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172084-trimmed-pair1.fastq SRR7172084-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,873,719 reads, 9,447,223 reads pseudoaligned [quant] estimated average fragment length: 221.49 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,026 rounds 52401 SRR7172084.ke.tsv 34699 SRR7172084.se.tsv 87100 total ==> SRR7172084.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1797.51 857 49.8739 Potri.005G024800.1.v4.1 1035 814.51 202 25.9429 Potri.004G059700.1.v4.1 961 740.51 14 1.9777 Potri.007G009000.2.v4.1 1416 1195.51 0 0 Potri.003G141000.2.v4.1 2943 2722.51 271.142 10.4182 Potri.016G087400.1.v4.1 270 87.0626 561 674.055 Potri.015G069301.1.v4.1 564 345.62 0 0 Potri.010G195200.1.v4.1 1773 1552.51 328 22.1006 Potri.012G127500.1.v4.1 977 756.51 9239 1277.54 ==> SRR7172084.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 16 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 312 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 324 SRR7172084 completed mapping pipeline successfully