Starting /dee2/code/volunteer_pipeline.sh SRR7172085 current disk space = 3087117803520 free memory = 1580074988 SRR7172085 SRAfilesize c502e7ae48f58fcc81a99a8320d54bb1 SRR7172085.sra SRR7172085.sra file validated SRR7172085 is paired end SRR7172085 is conventional basespace SRR7172085 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172085_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.999 33.0 33.0 34.0 31.0 34.0 2 32.7355 33.0 33.0 34.0 30.0 34.0 3 32.43125 33.0 33.0 34.0 31.0 34.0 4 32.0825 33.0 32.0 33.0 31.0 34.0 5 32.9835 33.0 33.0 33.0 33.0 34.0 6 36.917 38.0 37.0 38.0 35.0 38.0 7 37.288 38.0 38.0 38.0 36.0 38.0 8 37.60525 38.0 38.0 38.0 37.0 38.0 9 37.7175 38.0 38.0 38.0 38.0 38.0 10-14 37.7055 38.0 38.0 38.0 38.0 38.0 15-19 37.705600000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.69725 38.0 38.0 38.0 38.0 38.0 25-29 37.6717 38.0 38.0 38.0 38.0 38.0 30-34 37.63005 38.0 38.0 38.0 38.0 38.0 35-39 37.6272 38.0 38.0 38.0 38.0 38.0 40-44 37.603899999999996 38.0 38.0 38.0 38.0 38.0 45-49 37.56245 38.0 38.0 38.0 38.0 38.0 50-54 37.48075 38.0 38.0 38.0 37.4 38.0 55-59 37.42725 38.0 38.0 38.0 37.0 38.0 60-64 37.36245 38.0 38.0 38.0 37.0 38.0 65-69 37.26345 38.0 38.0 38.0 36.8 38.0 70-74 37.29135 38.0 38.0 38.0 36.8 38.0 75-79 37.16414999999999 38.0 38.0 38.0 36.0 38.0 80-84 37.158 38.0 38.0 38.0 36.0 38.0 85-89 37.039 38.0 38.0 38.0 36.0 38.0 90-94 36.970349999999996 38.0 38.0 38.0 36.0 38.0 95-99 36.87025 38.0 38.0 38.0 35.4 38.0 100-104 36.722049999999996 38.0 38.0 38.0 35.0 38.0 105-109 36.54575 38.0 38.0 38.0 34.0 38.0 110-114 36.420249999999996 38.0 37.8 38.0 34.0 38.0 115-119 36.26055 38.0 37.4 38.0 33.8 38.0 120-124 36.2698 38.0 37.8 38.0 33.8 38.0 125-129 35.924800000000005 38.0 37.0 38.0 32.8 38.0 130-134 35.612049999999996 38.0 36.2 38.0 31.4 38.0 135-139 35.30185 38.0 36.0 38.0 29.8 38.0 140-144 35.12515 38.0 35.6 38.0 29.8 38.0 145-149 34.56965 38.0 35.0 38.0 27.8 38.0 150-151 30.941000000000003 36.5 29.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 0.0 15 1.0 16 1.0 17 2.0 18 2.0 19 4.0 20 2.0 21 3.0 22 4.0 23 3.0 24 3.0 25 12.0 26 9.0 27 8.0 28 13.0 29 18.0 30 23.0 31 23.0 32 47.0 33 88.0 34 116.0 35 258.0 36 749.0 37 2609.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.14243798346226 19.07175246732462 13.817017871432382 32.96879167778074 2 19.65982991495748 24.61230615307654 35.64282141070535 20.08504252126063 3 16.525000000000002 32.074999999999996 26.724999999999998 24.675 4 21.5 36.075 22.825 19.6 5 20.05 36.625 24.099999999999998 19.225 6 15.8 35.5 25.55 23.150000000000002 7 12.65 19.775000000000002 46.825 20.75 8 18.3 20.225 29.15 32.324999999999996 9 18.075 21.375 31.924999999999997 28.625 10-14 19.45 30.31 26.275 23.965 15-19 19.37 28.785 27.605 24.240000000000002 20-24 19.665 28.95 27.705000000000002 23.68 25-29 19.495 28.945 27.950000000000003 23.61 30-34 19.775000000000002 29.375 27.575 23.275000000000002 35-39 20.135 29.84 26.645000000000003 23.380000000000003 40-44 19.715 29.095 27.925 23.265 45-49 19.78 28.660000000000004 27.445000000000004 24.115000000000002 50-54 20.41 28.285 27.689999999999998 23.615 55-59 19.915 28.675 27.855 23.555 60-64 19.665 29.165000000000003 27.665 23.505000000000003 65-69 20.150000000000002 29.035 27.57 23.244999999999997 70-74 19.965 28.744999999999997 27.79 23.5 75-79 20.24 28.605000000000004 27.305 23.849999999999998 80-84 20.09 27.800000000000004 28.075 24.035 85-89 19.85 28.575 27.875 23.7 90-94 20.19 28.075 27.32 24.415 95-99 20.39 28.28 27.955000000000002 23.375 100-104 20.135 28.744999999999997 27.334999999999997 23.785 105-109 20.77 28.67 27.255000000000003 23.305 110-114 20.44 28.21 27.74 23.61 115-119 20.68 28.34 27.284999999999997 23.695 120-124 20.724999999999998 28.625 27.060000000000002 23.59 125-129 20.64 28.325 27.145000000000003 23.89 130-134 20.669999999999998 28.535 27.455000000000002 23.34 135-139 20.97 27.544999999999998 27.450000000000003 24.035 140-144 20.54 27.900000000000002 27.35 24.21 145-149 21.18 28.389999999999997 27.02 23.41 150-151 20.4875 27.325 28.462500000000002 23.724999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 1.5 23 3.5 24 3.0 25 2.5 26 4.0 27 6.5 28 9.0 29 15.5 30 21.0 31 26.0 32 37.0 33 54.5 34 72.0 35 79.0 36 89.0 37 114.5 38 141.0 39 174.0 40 205.5 41 214.5 42 240.0 43 263.5 44 269.0 45 265.5 46 265.5 47 263.5 48 232.0 49 197.0 50 169.5 51 132.0 52 101.5 53 81.5 54 65.5 55 50.5 56 31.0 57 23.0 58 15.0 59 12.5 60 12.5 61 7.5 62 6.0 63 4.5 64 3.0 65 3.0 66 1.5 67 1.0 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.275 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.32499999999999996 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.42500000000000004 0.0 0.0 0.0 0.0 102-103 0.45 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.55 0.0 0.0 0.0 0.0 108-109 0.65 0.0 0.0 0.0 0.0 110-111 0.7625 0.0 0.0 0.0 0.0 112-113 0.8374999999999999 0.0 0.0 0.0 0.0 114-115 0.975 0.0 0.0 0.0 0.0 116-117 1.175 0.0 0.0 0.0 0.0 118-119 1.375 0.0 0.0 0.0 0.0 120-121 1.6375000000000002 0.0 0.0 0.0 0.0 122-123 1.825 0.0 0.0 0.0 0.0 124-125 2.0250000000000004 0.0 0.0 0.0 0.0 126-127 2.2375 0.0 0.0 0.0 0.0 128-129 2.3375 0.0 0.0 0.0 0.0 130-131 2.6125 0.0 0.0 0.0 0.0 132-133 3.0125 0.0 0.0 0.0 0.0 134-135 3.3375 0.0 0.0 0.0 0.0 136-137 3.5250000000000004 0.0 0.0 0.0 0.0 138-139 3.7750000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGATCG 10 0.006841402 144.925 145 TCTTGGA 10 0.006841402 144.925 145 >>END_MODULE SRR7172085 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172085_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3495 34.0 33.0 34.0 33.0 34.0 2 33.3865 34.0 33.0 34.0 33.0 34.0 3 33.422 34.0 33.0 34.0 33.0 34.0 4 33.426 34.0 33.0 34.0 33.0 34.0 5 33.42975 34.0 33.0 34.0 33.0 34.0 6 37.592 38.0 38.0 38.0 38.0 38.0 7 37.61 38.0 38.0 38.0 38.0 38.0 8 37.599 38.0 38.0 38.0 38.0 38.0 9 37.61375 38.0 38.0 38.0 38.0 38.0 10-14 37.583949999999994 38.0 38.0 38.0 38.0 38.0 15-19 37.586650000000006 38.0 38.0 38.0 38.0 38.0 20-24 37.56425 38.0 38.0 38.0 38.0 38.0 25-29 37.52290000000001 38.0 38.0 38.0 38.0 38.0 30-34 37.50335 38.0 38.0 38.0 38.0 38.0 35-39 37.472899999999996 38.0 38.0 38.0 38.0 38.0 40-44 37.40185 38.0 38.0 38.0 37.8 38.0 45-49 37.446749999999994 38.0 38.0 38.0 37.8 38.0 50-54 37.4212 38.0 38.0 38.0 38.0 38.0 55-59 37.3816 38.0 38.0 38.0 37.0 38.0 60-64 37.314800000000005 38.0 38.0 38.0 37.0 38.0 65-69 37.2337 38.0 38.0 38.0 37.0 38.0 70-74 37.1906 38.0 38.0 38.0 36.8 38.0 75-79 37.0689 38.0 38.0 38.0 36.2 38.0 80-84 37.0841 38.0 38.0 38.0 36.0 38.0 85-89 36.98525 38.0 38.0 38.0 36.0 38.0 90-94 36.90005 38.0 38.0 38.0 36.0 38.0 95-99 36.8406 38.0 38.0 38.0 35.8 38.0 100-104 36.79305 38.0 38.0 38.0 35.2 38.0 105-109 36.6617 38.0 38.0 38.0 34.6 38.0 110-114 36.56015 38.0 38.0 38.0 34.4 38.0 115-119 36.351699999999994 38.0 38.0 38.0 34.0 38.0 120-124 36.1264 38.0 37.4 38.0 33.6 38.0 125-129 35.7986 38.0 36.6 38.0 32.4 38.0 130-134 35.536950000000004 38.0 36.0 38.0 31.6 38.0 135-139 35.1702 38.0 36.0 38.0 30.4 38.0 140-144 34.85425 38.0 35.2 38.0 28.0 38.0 145-149 34.4282 38.0 34.8 38.0 27.2 38.0 150-151 30.825874999999996 36.5 29.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 1.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 1.0 16 4.0 17 0.0 18 2.0 19 6.0 20 2.0 21 5.0 22 4.0 23 7.0 24 6.0 25 13.0 26 7.0 27 15.0 28 21.0 29 21.0 30 27.0 31 31.0 32 41.0 33 67.0 34 110.0 35 210.0 36 598.0 37 2794.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.824999999999996 15.725 16.2 29.25 2 24.224999999999998 22.5 34.275 19.0 3 20.45 25.95 30.15 23.45 4 23.674999999999997 35.325 21.175 19.825 5 22.825 36.575 21.75 18.85 6 18.35 37.475 23.150000000000002 21.025 7 15.975 16.5 45.5 22.025 8 20.150000000000002 22.15 27.175 30.525000000000002 9 21.425 24.825 27.925 25.825 10-14 22.685 28.189999999999998 26.795 22.33 15-19 22.875 27.43 27.735 21.959999999999997 20-24 22.900000000000002 27.765 27.76 21.575 25-29 22.73 28.470000000000002 27.36 21.44 30-34 22.68 27.750000000000004 28.675 20.895 35-39 23.22 27.83 27.875 21.075 40-44 23.275000000000002 28.244999999999997 27.375 21.105 45-49 22.99 27.91 28.050000000000004 21.05 50-54 23.0 28.115000000000002 28.08 20.805 55-59 23.880000000000003 28.325 27.095000000000002 20.7 60-64 23.59 28.255000000000003 27.54 20.615 65-69 23.455000000000002 27.76 27.715 21.07 70-74 23.465 28.175 27.935 20.424999999999997 75-79 23.055 27.66 28.025 21.26 80-84 23.830000000000002 28.18 27.279999999999998 20.71 85-89 23.705000000000002 28.27 27.71 20.315 90-94 23.59 28.425 27.284999999999997 20.7 95-99 23.35 27.785 27.74 21.125 100-104 23.93 27.665 27.884999999999998 20.52 105-109 23.805 28.21 27.529999999999998 20.455000000000002 110-114 23.32 27.894999999999996 28.21 20.575 115-119 23.419999999999998 28.005000000000003 28.299999999999997 20.275000000000002 120-124 23.86 27.85 27.794999999999998 20.495 125-129 24.08 27.205000000000002 28.155 20.560000000000002 130-134 24.310000000000002 27.595 27.400000000000002 20.695 135-139 24.279999999999998 27.0 28.405 20.315 140-144 24.265 28.235 27.279999999999998 20.22 145-149 24.279999999999998 27.750000000000004 27.54 20.43 150-151 24.575 27.5125 28.449999999999996 19.4625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.0 22 0.5 23 1.5 24 1.5 25 1.5 26 2.5 27 4.5 28 5.5 29 4.0 30 5.0 31 11.0 32 21.5 33 29.5 34 43.0 35 59.5 36 67.0 37 88.5 38 123.0 39 159.5 40 186.5 41 220.0 42 271.0 43 291.0 44 294.5 45 295.5 46 287.5 47 266.0 48 233.0 49 213.5 50 180.0 51 142.5 52 125.5 53 104.5 54 73.0 55 48.0 56 37.5 57 31.0 58 17.5 59 11.5 60 12.0 61 9.5 62 6.0 63 3.0 64 3.5 65 2.5 66 1.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.36250000000000004 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.6 0.0 0.0 0.0 0.0 108-109 0.7 0.0 0.0 0.0 0.0 110-111 0.8125 0.0 0.0 0.0 0.0 112-113 0.8875 0.0 0.0 0.0 0.0 114-115 1.0125 0.0 0.0 0.0 0.0 116-117 1.2125 0.0 0.0 0.0 0.0 118-119 1.4249999999999998 0.0 0.0 0.0 0.0 120-121 1.6875 0.0 0.0 0.0 0.0 122-123 1.85 0.0 0.0 0.0 0.0 124-125 2.05 0.0 0.0 0.0 0.0 126-127 2.2625 0.0 0.0 0.0 0.0 128-129 2.3625 0.0 0.0 0.0 0.0 130-131 2.625 0.0 0.0 0.0 0.0 132-133 2.9875 0.0 0.0 0.0 0.0 134-135 3.3125 0.0 0.0 0.0 0.0 136-137 3.5 0.0 0.0 0.0 0.0 138-139 3.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 55 0.0025160722 15.818182 120-124 >>END_MODULE Read 561001 spots for SRR7172085.sra Written 561001 spots for SRR7172085.sra Read 561001 spots for SRR7172085.sra Written 561001 spots for SRR7172085.sra Read 561001 spots for SRR7172085.sra Written 561001 spots for SRR7172085.sra Read 561001 spots for SRR7172085.sra Written 561001 spots for SRR7172085.sra Read 561001 spots for SRR7172085.sra Written 561001 spots for SRR7172085.sra Read 561001 spots for SRR7172085.sra Written 561001 spots for SRR7172085.sra Read 561001 spots for SRR7172085.sra Written 561001 spots for SRR7172085.sra Read 561001 spots for SRR7172085.sra Written 561001 spots for SRR7172085.sra Read 561001 spots for SRR7172085.sra Written 561001 spots for SRR7172085.sra Read 561001 spots for SRR7172085.sra Written 561001 spots for SRR7172085.sra Read 561001 spots for SRR7172085.sra Written 561001 spots for SRR7172085.sra Read 561001 spots for SRR7172085.sra Written 561001 spots for SRR7172085.sra Read 561001 spots for SRR7172085.sra Written 561001 spots for SRR7172085.sra Read 561001 spots for SRR7172085.sra Written 561001 spots for SRR7172085.sra Read 561001 spots for SRR7172085.sra Written 561001 spots for SRR7172085.sra Read 561005 spots for SRR7172085.sra Written 561005 spots for SRR7172085.sra Read 561001 spots for SRR7172085.sra Written 561001 spots for SRR7172085.sra Read 561001 spots for SRR7172085.sra Written 561001 spots for SRR7172085.sra Read 561001 spots for SRR7172085.sra Written 561001 spots for SRR7172085.sra Read 561001 spots for SRR7172085.sra Written 561001 spots for SRR7172085.sra SRR ids: ['SRR7172085.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lxd8xp2c SRR7172085.sra spots: 11220024 blocks: [[1, 561001], [561002, 1122002], [1122003, 1683003], [1683004, 2244004], [2244005, 2805005], [2805006, 3366006], [3366007, 3927007], [3927008, 4488008], [4488009, 5049009], [5049010, 5610010], [5610011, 6171011], [6171012, 6732012], [6732013, 7293013], [7293014, 7854014], [7854015, 8415015], [8415016, 8976016], [8976017, 9537017], [9537018, 10098018], [10098019, 10659019], [10659020, 11220024]] SRR7172085 file size 3780397 SRR7172085 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172085 SRR7172085_1.fastq SRR7172085_2.fastq Input file: SRR7172085_1.fastq Paired file: SRR7172085_2.fastq trimmed: SRR7172085-trimmed-pair1.fastq, SRR7172085-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 04:36:04 2025 >> started Fri Feb 14 04:36:16 2025 >> done (12.080s) 11220024 read pairs processed; of these: 5912 ( 0.05%) short read pairs filtered out after trimming by size control 4122 ( 0.04%) empty read pairs filtered out after trimming by size control 11209990 (99.91%) read pairs available; of these: 5501778 (49.08%) trimmed read pairs available after processing 5708212 (50.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 1 0.00% 21 3 0.00% 22 2 0.00% 23 2 0.00% 24 3 0.00% 25 2 0.00% 26 4 0.00% 27 2 0.00% 28 5 0.00% 29 4 0.00% 30 3 0.00% 31 4 0.00% 32 5 0.00% 33 5 0.00% 34 4 0.00% 35 6 0.00% 36 3 0.00% 37 4 0.00% 38 2 0.00% 39 5 0.00% 40 5 0.00% 41 6 0.00% 42 7 0.00% 43 3 0.00% 44 3 0.00% 45 8 0.00% 46 13 0.00% 47 5 0.00% 48 6 0.00% 49 12 0.00% 50 11 0.00% 51 18 0.00% 52 21 0.00% 53 17 0.00% 54 18 0.00% 55 20 0.00% 56 23 0.00% 57 27 0.00% 58 32 0.00% 59 24 0.00% 60 41 0.00% 61 49 0.00% 62 56 0.00% 63 67 0.00% 64 80 0.00% 65 78 0.00% 66 89 0.00% 67 93 0.00% 68 131 0.00% 69 145 0.00% 70 140 0.00% 71 163 0.00% 72 210 0.00% 73 231 0.00% 74 286 0.00% 75 296 0.00% 76 377 0.00% 77 386 0.00% 78 452 0.00% 79 511 0.00% 80 532 0.00% 81 642 0.01% 82 762 0.01% 83 884 0.01% 84 1221 0.01% 85 1524 0.01% 86 1695 0.02% 87 1970 0.02% 88 2148 0.02% 89 2311 0.02% 90 2407 0.02% 91 2705 0.02% 92 2902 0.03% 93 3125 0.03% 94 3468 0.03% 95 3764 0.03% 96 4035 0.04% 97 4359 0.04% 98 4612 0.04% 99 4994 0.04% 100 5412 0.05% 101 5866 0.05% 102 6330 0.06% 103 6924 0.06% 104 7471 0.07% 105 7827 0.07% 106 8432 0.08% 107 9148 0.08% 108 9667 0.09% 109 9955 0.09% 110 10703 0.10% 111 11427 0.10% 112 12177 0.11% 113 12877 0.11% 114 13637 0.12% 115 14367 0.13% 116 15155 0.14% 117 15524 0.14% 118 16409 0.15% 119 17439 0.16% 120 17867 0.16% 121 18883 0.17% 122 20027 0.18% 123 21088 0.19% 124 21944 0.20% 125 23207 0.21% 126 24422 0.22% 127 25809 0.23% 128 26767 0.24% 129 28407 0.25% 130 29955 0.27% 131 31203 0.28% 132 33359 0.30% 133 35212 0.31% 134 37426 0.33% 135 39608 0.35% 136 41883 0.37% 137 44852 0.40% 138 47872 0.43% 139 50838 0.45% 140 55464 0.49% 141 59941 0.53% 142 67499 0.60% 143 76950 0.69% 144 90053 0.80% 145 109745 0.98% 146 142148 1.27% 147 200854 1.79% 148 327011 2.92% 149 681910 6.08% 150 2798536 24.96% 151 5708212 50.92% 11209990 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=35 prefix-density=0.14 prefix-fanout=2.3 sequence=GTGGACTCCTTCTGGAT criterion=fanout-score sequence-density=0.09 sequence-density-rank=17 fanout-score=392.45 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=35.7 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=3.79 fanout-score-rank=34 prefix-density=0.16 prefix-fanout=3.0 sequence=CATCACTTGCTCTCTTTCTTGCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=21 fanout-score=291.56 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=29.4 sequence=GAAGAAGAAGAAA SRR7172085 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 04:36:58 Started mapping on | Feb 14 04:36:58 Finished on | Feb 14 04:38:01 Mapping speed, Million of reads per hour | 640.57 Number of input reads | 11209990 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 10672604 Uniquely mapped reads % | 95.21% Average mapped length | 295.32 Number of splices: Total | 10929655 Number of splices: Annotated (sjdb) | 10763799 Number of splices: GT/AG | 10758129 Number of splices: GC/AG | 138249 Number of splices: AT/AC | 7532 Number of splices: Non-canonical | 25745 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.29 Insertion rate per base | 0.02% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 302685 % of reads mapped to multiple loci | 2.70% Number of reads mapped to too many loci | 31496 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.74% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 242261 242261 242261 N_multimapping 302685 302685 302685 N_noFeature 219465 10583495 259392 N_ambiguous 99369 707 49653 UnstrandedReadsAssigned:10353770 PositiveStrandReadsAssigned:88402 NegativeStrandReadsAssigned:10363559 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172085 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172085-trimmed-pair1.fastq SRR7172085-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,209,990 reads, 10,279,750 reads pseudoaligned [quant] estimated average fragment length: 249.32 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 989 rounds 52401 SRR7172085.ke.tsv 34699 SRR7172085.se.tsv 87100 total ==> SRR7172085.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1769.68 441 23.7135 Potri.005G024800.1.v4.1 1035 786.68 64 7.74166 Potri.004G059700.1.v4.1 961 712.705 13 1.73574 Potri.007G009000.2.v4.1 1416 1167.68 0 0 Potri.003G141000.2.v4.1 2943 2694.68 274.094 9.67932 Potri.016G087400.1.v4.1 270 77.2648 716.489 882.43 Potri.015G069301.1.v4.1 564 321.277 0 0 Potri.010G195200.1.v4.1 1773 1524.68 49 3.05823 Potri.012G127500.1.v4.1 977 728.699 1847 241.196 ==> SRR7172085.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 12 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 231 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 79 SRR7172085 completed mapping pipeline successfully