Starting /dee2/code/volunteer_pipeline.sh SRR7172086 current disk space = 3087767363584 free memory = 1491713148 SRR7172086 SRAfilesize 75c150751ba88272ff79cf2397eb3f9f SRR7172086.sra SRR7172086.sra file validated SRR7172086 is paired end SRR7172086 is conventional basespace SRR7172086 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172086_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.1525 33.0 32.0 34.0 30.0 34.0 2 31.9715 33.0 32.0 34.0 28.0 34.0 3 31.956 33.0 31.0 33.0 29.0 34.0 4 32.20675 33.0 33.0 33.0 31.0 34.0 5 32.808 33.0 33.0 34.0 31.0 34.0 6 36.74525 38.0 37.0 38.0 35.0 38.0 7 37.1525 38.0 38.0 38.0 36.0 38.0 8 37.37675 38.0 38.0 38.0 37.0 38.0 9 37.47825 38.0 38.0 38.0 37.0 38.0 10-14 37.48905 38.0 38.0 38.0 37.0 38.0 15-19 37.4581 38.0 38.0 38.0 37.0 38.0 20-24 37.4207 38.0 38.0 38.0 37.0 38.0 25-29 37.44865 38.0 38.0 38.0 37.0 38.0 30-34 37.384499999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.347500000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.33825 38.0 38.0 38.0 37.0 38.0 45-49 37.25625 38.0 38.0 38.0 36.4 38.0 50-54 37.145149999999994 38.0 38.0 38.0 36.0 38.0 55-59 37.06035 38.0 38.0 38.0 35.8 38.0 60-64 36.90345 38.0 38.0 38.0 35.0 38.0 65-69 36.86110000000001 38.0 38.0 38.0 35.2 38.0 70-74 36.78435 38.0 38.0 38.0 34.6 38.0 75-79 36.69500000000001 38.0 38.0 38.0 34.4 38.0 80-84 36.5938 38.0 37.8 38.0 34.0 38.0 85-89 36.46925 38.0 37.4 38.0 34.0 38.0 90-94 36.34205 38.0 37.0 38.0 34.0 38.0 95-99 36.17745 38.0 37.0 38.0 33.2 38.0 100-104 36.0573 38.0 37.0 38.0 33.0 38.0 105-109 35.765600000000006 38.0 36.4 38.0 31.4 38.0 110-114 35.55285 38.0 36.0 38.0 30.4 38.0 115-119 35.4542 38.0 36.0 38.0 29.4 38.0 120-124 35.20005 38.0 35.4 38.0 29.0 38.0 125-129 34.909200000000006 38.0 35.0 38.0 27.6 38.0 130-134 34.59325 38.0 34.8 38.0 26.6 38.0 135-139 34.12795 38.0 34.0 38.0 23.8 38.0 140-144 33.48315 38.0 33.8 38.0 21.4 38.0 145-149 32.5951 37.2 33.0 38.0 15.6 38.0 150-151 28.900624999999998 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 1.0 15 1.0 16 2.0 17 0.0 18 1.0 19 2.0 20 2.0 21 2.0 22 7.0 23 5.0 24 4.0 25 11.0 26 14.0 27 21.0 28 27.0 29 36.0 30 48.0 31 61.0 32 100.0 33 160.0 34 215.0 35 465.0 36 1052.0 37 1762.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.3305548319875 17.71294607970826 15.003907267517583 37.952591820786665 2 19.475 26.3 37.175000000000004 17.05 3 18.175 32.125 24.85 24.85 4 20.9 37.55 20.549999999999997 21.0 5 20.65 38.025 22.675 18.65 6 17.175 35.5 25.25 22.075 7 12.5 19.925 46.925 20.65 8 18.25 21.775 28.4 31.574999999999996 9 18.65 21.0 30.95 29.4 10-14 19.79 29.770000000000003 26.455000000000002 23.985 15-19 20.1 28.895 27.634999999999998 23.369999999999997 20-24 20.165 29.025000000000002 28.07 22.74 25-29 19.79 29.115000000000002 27.975 23.119999999999997 30-34 20.155 29.21 27.725 22.91 35-39 20.29 28.794999999999998 27.57 23.345 40-44 20.84 29.585 27.169999999999998 22.405 45-49 20.095 29.115000000000002 27.644999999999996 23.145 50-54 20.195 28.970000000000002 27.735 23.1 55-59 20.18 28.96 27.405 23.455000000000002 60-64 20.685000000000002 28.58 27.37 23.365 65-69 20.45 29.085 27.500000000000004 22.965 70-74 20.78 29.044999999999998 27.515 22.66 75-79 20.46 29.020000000000003 27.005000000000003 23.515 80-84 20.615 28.645 27.735 23.005 85-89 20.645 28.605000000000004 27.435 23.315 90-94 20.935000000000002 28.12 27.57 23.375 95-99 20.810000000000002 28.225 27.650000000000002 23.315 100-104 20.979999999999997 28.27 27.815 22.935 105-109 20.724999999999998 28.32 28.07 22.884999999999998 110-114 20.82 27.860000000000003 27.694999999999997 23.625 115-119 21.065 28.12 28.08 22.735 120-124 21.240000000000002 28.24 27.13 23.39 125-129 21.445 28.249999999999996 27.55 22.755 130-134 21.275 27.644999999999996 27.555000000000003 23.525 135-139 21.325 27.975 27.555000000000003 23.145 140-144 21.5 27.700000000000003 27.544999999999998 23.255 145-149 21.615000000000002 28.29 27.034999999999997 23.06 150-151 21.6625 27.6 27.187499999999996 23.549999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 2.5 24 3.0 25 4.0 26 5.0 27 8.0 28 12.0 29 15.0 30 21.0 31 28.0 32 36.5 33 48.0 34 65.0 35 91.5 36 112.5 37 123.0 38 137.0 39 170.0 40 214.0 41 240.0 42 242.0 43 249.0 44 266.0 45 270.0 46 261.5 47 244.5 48 209.5 49 177.0 50 154.5 51 129.5 52 110.5 53 85.5 54 60.5 55 46.5 56 34.5 57 27.5 58 20.0 59 14.0 60 14.0 61 12.5 62 10.0 63 6.0 64 5.5 65 6.5 66 3.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0125 0.0 0.0 0.0 74-75 0.0125 0.025 0.0 0.0 0.0 76-77 0.025 0.025 0.0 0.0 0.0 78-79 0.025 0.025 0.0 0.0 0.0 80-81 0.025 0.025 0.0 0.0 0.0 82-83 0.025 0.025 0.0 0.0 0.0 84-85 0.037500000000000006 0.025 0.0 0.0 0.0 86-87 0.0625 0.025 0.0 0.0 0.0 88-89 0.0875 0.025 0.0 0.0 0.0 90-91 0.1 0.025 0.0 0.0 0.0 92-93 0.125 0.025 0.0 0.0 0.0 94-95 0.21250000000000002 0.025 0.0 0.0 0.0 96-97 0.225 0.025 0.0 0.0 0.0 98-99 0.2875 0.025 0.0 0.0 0.0 100-101 0.3625 0.025 0.0 0.0 0.0 102-103 0.4625 0.025 0.0 0.0 0.0 104-105 0.5125 0.025 0.0 0.0 0.0 106-107 0.575 0.025 0.0 0.0 0.0 108-109 0.625 0.025 0.0 0.0 0.0 110-111 0.75 0.025 0.0 0.0 0.0 112-113 0.8625 0.025 0.0 0.0 0.0 114-115 1.025 0.025 0.0 0.0 0.0 116-117 1.2374999999999998 0.025 0.0 0.0 0.0 118-119 1.475 0.025 0.0 0.0 0.0 120-121 1.6 0.025 0.0 0.0 0.0 122-123 1.7875 0.025 0.0 0.0 0.0 124-125 2.0 0.025 0.0 0.0 0.0 126-127 2.2625 0.025 0.0 0.0 0.0 128-129 2.55 0.025 0.0 0.0 0.0 130-131 2.8875 0.025 0.0 0.0 0.0 132-133 3.2625 0.025 0.0 0.0 0.0 134-135 3.7375 0.025 0.0 0.0 0.0 136-137 4.199999999999999 0.025 0.0 0.0 0.0 138-139 4.387499999999999 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTAGCA 10 0.006836113 144.9625 7 >>END_MODULE SRR7172086 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172086_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1235 33.0 33.0 34.0 33.0 34.0 2 33.213 34.0 33.0 34.0 33.0 34.0 3 33.301 34.0 33.0 34.0 33.0 34.0 4 33.30325 34.0 33.0 34.0 33.0 34.0 5 33.22375 34.0 33.0 34.0 33.0 34.0 6 37.444 38.0 38.0 38.0 37.0 38.0 7 37.40225 38.0 38.0 38.0 37.0 38.0 8 37.441 38.0 38.0 38.0 37.0 38.0 9 37.45375 38.0 38.0 38.0 37.0 38.0 10-14 37.439150000000005 38.0 38.0 38.0 37.2 38.0 15-19 37.44375 38.0 38.0 38.0 37.0 38.0 20-24 37.417550000000006 38.0 38.0 38.0 37.0 38.0 25-29 37.3447 38.0 38.0 38.0 37.0 38.0 30-34 37.31515 38.0 38.0 38.0 37.0 38.0 35-39 37.216300000000004 38.0 38.0 38.0 36.8 38.0 40-44 37.3107 38.0 38.0 38.0 37.0 38.0 45-49 37.24855 38.0 38.0 38.0 37.0 38.0 50-54 37.208400000000005 38.0 38.0 38.0 36.4 38.0 55-59 37.1108 38.0 38.0 38.0 36.0 38.0 60-64 37.05595000000001 38.0 38.0 38.0 36.0 38.0 65-69 36.983050000000006 38.0 38.0 38.0 36.0 38.0 70-74 36.88755 38.0 38.0 38.0 35.8 38.0 75-79 36.82415 38.0 38.0 38.0 35.0 38.0 80-84 36.7159 38.0 38.0 38.0 34.8 38.0 85-89 36.62605 38.0 38.0 38.0 34.2 38.0 90-94 36.50645 38.0 38.0 38.0 34.0 38.0 95-99 36.34475 38.0 37.6 38.0 33.8 38.0 100-104 36.276399999999995 38.0 37.2 38.0 33.8 38.0 105-109 36.1128 38.0 37.0 38.0 33.0 38.0 110-114 35.907500000000006 38.0 37.0 38.0 32.6 38.0 115-119 35.61785 38.0 36.4 38.0 31.4 38.0 120-124 35.3611 38.0 36.0 38.0 29.8 38.0 125-129 34.90995 38.0 35.4 38.0 27.6 38.0 130-134 34.68875 38.0 35.0 38.0 26.8 38.0 135-139 34.4433 38.0 35.0 38.0 26.0 38.0 140-144 33.744350000000004 38.0 34.2 38.0 22.0 38.0 145-149 32.83669999999999 38.0 33.2 38.0 16.2 38.0 150-151 28.342125 35.0 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 0.0 16 1.0 17 3.0 18 2.0 19 3.0 20 6.0 21 1.0 22 5.0 23 12.0 24 8.0 25 19.0 26 20.0 27 16.0 28 23.0 29 43.0 30 40.0 31 61.0 32 81.0 33 129.0 34 168.0 35 344.0 36 797.0 37 2213.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.05 14.45 18.525 34.975 2 21.475 22.375 37.65 18.5 3 20.674999999999997 25.674999999999997 31.025000000000002 22.625 4 22.75 34.925 21.325 21.0 5 22.525000000000002 38.224999999999994 22.05 17.2 6 15.925 37.974999999999994 25.525 20.575 7 15.875 16.075 45.550000000000004 22.5 8 19.675 21.875 28.199999999999996 30.25 9 21.4 23.575 29.375 25.650000000000002 10-14 22.535 28.225 26.46 22.78 15-19 22.52 27.96 28.28 21.240000000000002 20-24 22.770000000000003 27.925 27.68 21.625 25-29 22.759999999999998 27.639999999999997 27.900000000000002 21.7 30-34 22.64 28.435 27.584999999999997 21.34 35-39 23.235 27.605 28.03 21.13 40-44 23.035 28.194999999999997 28.1 20.669999999999998 45-49 22.81 27.93 28.410000000000004 20.849999999999998 50-54 22.919999999999998 28.29 28.185 20.605 55-59 22.814999999999998 28.060000000000002 27.88 21.245 60-64 23.095 27.715 28.349999999999998 20.84 65-69 23.005 27.834999999999997 28.38 20.78 70-74 22.81 28.15 27.445000000000004 21.595 75-79 23.055 27.73 28.005000000000003 21.21 80-84 23.735 26.889999999999997 28.084999999999997 21.29 85-89 23.195 28.199999999999996 27.694999999999997 20.91 90-94 23.169999999999998 28.53 27.565 20.735 95-99 22.79 27.944999999999997 27.955000000000002 21.310000000000002 100-104 23.39 28.205000000000002 27.810000000000002 20.595 105-109 23.36 27.51 28.42 20.71 110-114 22.71 27.985 28.185 21.12 115-119 23.66 28.07 27.605 20.665 120-124 23.52 28.215 27.465 20.8 125-129 23.415 28.01 27.715 20.86 130-134 24.07 27.55 27.685 20.695 135-139 23.815 28.12 27.744999999999997 20.32 140-144 23.525 28.794999999999998 27.150000000000002 20.53 145-149 24.27 27.634999999999998 27.474999999999998 20.62 150-151 24.1125 28.1625 27.287499999999998 20.4375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 2.0 25 2.5 26 2.0 27 4.5 28 8.0 29 10.0 30 13.5 31 14.5 32 20.5 33 38.5 34 52.5 35 62.5 36 78.5 37 104.0 38 134.0 39 164.0 40 199.0 41 227.0 42 254.0 43 269.0 44 277.5 45 283.5 46 278.0 47 261.5 48 234.5 49 199.0 50 169.5 51 148.5 52 119.5 53 92.5 54 67.5 55 53.0 56 48.0 57 39.5 58 23.5 59 11.0 60 7.5 61 5.5 62 4.5 63 4.5 64 2.5 65 2.5 66 2.0 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.575 0.0 0.0 0.0 0.0 108-109 0.625 0.0 0.0 0.0 0.0 110-111 0.75 0.0 0.0 0.0 0.0 112-113 0.875 0.0 0.0 0.0 0.0 114-115 1.0625 0.0 0.0 0.0 0.0 116-117 1.3 0.0 0.0 0.0 0.0 118-119 1.525 0.0 0.0 0.0 0.0 120-121 1.65 0.0 0.0 0.0 0.0 122-123 1.8375 0.0 0.0 0.0 0.0 124-125 2.05 0.0 0.0 0.0 0.0 126-127 2.3 0.0 0.0 0.0 0.0 128-129 2.575 0.0 0.0 0.0 0.0 130-131 2.925 0.0 0.0 0.0 0.0 132-133 3.3125 0.0 0.0 0.0 0.0 134-135 3.7875 0.0 0.0 0.0 0.0 136-137 4.25 0.0 0.0 0.0 0.0 138-139 4.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACGACAT 10 0.006830828 145.0 1 TCTTTAT 10 0.006830828 145.0 9 >>END_MODULE Read 507538 spots for SRR7172086.sra Written 507538 spots for SRR7172086.sra Read 507538 spots for SRR7172086.sra Written 507538 spots for SRR7172086.sra Read 507538 spots for SRR7172086.sra Written 507538 spots for SRR7172086.sra Read 507538 spots for SRR7172086.sra Written 507538 spots for SRR7172086.sra Read 507538 spots for SRR7172086.sra Written 507538 spots for SRR7172086.sra Read 507538 spots for SRR7172086.sra Written 507538 spots for SRR7172086.sra Read 507538 spots for SRR7172086.sra Written 507538 spots for SRR7172086.sra Read 507538 spots for SRR7172086.sra Written 507538 spots for SRR7172086.sra Read 507538 spots for SRR7172086.sra Written 507538 spots for SRR7172086.sra Read 507538 spots for SRR7172086.sra Written 507538 spots for SRR7172086.sra Read 507538 spots for SRR7172086.sra Written 507538 spots for SRR7172086.sra Read 507538 spots for SRR7172086.sra Written 507538 spots for SRR7172086.sra Read 507538 spots for SRR7172086.sra Written 507538 spots for SRR7172086.sra Read 507538 spots for SRR7172086.sra Written 507538 spots for SRR7172086.sra Read 507538 spots for SRR7172086.sra Written 507538 spots for SRR7172086.sra Read 507550 spots for SRR7172086.sra Written 507550 spots for SRR7172086.sra Read 507538 spots for SRR7172086.sra Written 507538 spots for SRR7172086.sra Read 507538 spots for SRR7172086.sra Written 507538 spots for SRR7172086.sra Read 507538 spots for SRR7172086.sra Written 507538 spots for SRR7172086.sra Read 507538 spots for SRR7172086.sra Written 507538 spots for SRR7172086.sra SRR ids: ['SRR7172086.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_66i3wych SRR7172086.sra spots: 10150772 blocks: [[1, 507538], [507539, 1015076], [1015077, 1522614], [1522615, 2030152], [2030153, 2537690], [2537691, 3045228], [3045229, 3552766], [3552767, 4060304], [4060305, 4567842], [4567843, 5075380], [5075381, 5582918], [5582919, 6090456], [6090457, 6597994], [6597995, 7105532], [7105533, 7613070], [7613071, 8120608], [8120609, 8628146], [8628147, 9135684], [9135685, 9643222], [9643223, 10150772]] SRR7172086 file size 3418063 SRR7172086 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172086 SRR7172086_1.fastq SRR7172086_2.fastq Input file: SRR7172086_1.fastq Paired file: SRR7172086_2.fastq trimmed: SRR7172086-trimmed-pair1.fastq, SRR7172086-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 04:03:14 2025 >> started Fri Feb 14 04:03:25 2025 >> done (10.640s) 10150772 read pairs processed; of these: 2687 ( 0.03%) short read pairs filtered out after trimming by size control 1639 ( 0.02%) empty read pairs filtered out after trimming by size control 10146446 (99.96%) read pairs available; of these: 6384015 (62.92%) trimmed read pairs available after processing 3762431 (37.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 4 0.00% 21 1 0.00% 22 1 0.00% 23 1 0.00% 24 6 0.00% 25 2 0.00% 26 2 0.00% 27 1 0.00% 28 2 0.00% 29 4 0.00% 30 2 0.00% 31 2 0.00% 32 2 0.00% 33 7 0.00% 34 9 0.00% 35 1 0.00% 36 4 0.00% 37 8 0.00% 38 2 0.00% 39 6 0.00% 40 5 0.00% 41 5 0.00% 42 8 0.00% 43 10 0.00% 44 9 0.00% 45 11 0.00% 46 8 0.00% 47 13 0.00% 48 9 0.00% 49 14 0.00% 50 13 0.00% 51 17 0.00% 52 22 0.00% 53 24 0.00% 54 24 0.00% 55 32 0.00% 56 26 0.00% 57 35 0.00% 58 40 0.00% 59 42 0.00% 60 52 0.00% 61 60 0.00% 62 77 0.00% 63 68 0.00% 64 90 0.00% 65 92 0.00% 66 105 0.00% 67 104 0.00% 68 153 0.00% 69 187 0.00% 70 164 0.00% 71 244 0.00% 72 251 0.00% 73 292 0.00% 74 320 0.00% 75 384 0.00% 76 437 0.00% 77 439 0.00% 78 517 0.01% 79 609 0.01% 80 683 0.01% 81 758 0.01% 82 928 0.01% 83 1033 0.01% 84 1268 0.01% 85 1400 0.01% 86 1559 0.02% 87 1835 0.02% 88 2082 0.02% 89 2178 0.02% 90 2350 0.02% 91 2557 0.03% 92 2763 0.03% 93 3165 0.03% 94 3355 0.03% 95 3662 0.04% 96 3904 0.04% 97 4316 0.04% 98 4523 0.04% 99 4891 0.05% 100 5351 0.05% 101 5787 0.06% 102 6303 0.06% 103 6773 0.07% 104 7295 0.07% 105 7903 0.08% 106 8360 0.08% 107 8977 0.09% 108 9297 0.09% 109 9823 0.10% 110 10433 0.10% 111 11285 0.11% 112 11850 0.12% 113 12440 0.12% 114 13487 0.13% 115 14311 0.14% 116 15227 0.15% 117 15732 0.16% 118 16558 0.16% 119 17244 0.17% 120 18321 0.18% 121 19527 0.19% 122 20971 0.21% 123 21768 0.21% 124 23569 0.23% 125 25000 0.25% 126 26882 0.26% 127 28160 0.28% 128 30473 0.30% 129 32324 0.32% 130 34688 0.34% 131 37401 0.37% 132 40508 0.40% 133 43091 0.42% 134 46836 0.46% 135 50766 0.50% 136 55470 0.55% 137 60584 0.60% 138 67210 0.66% 139 74022 0.73% 140 82812 0.82% 141 93969 0.93% 142 109239 1.08% 143 128106 1.26% 144 156264 1.54% 145 194591 1.92% 146 256176 2.52% 147 353555 3.48% 148 535395 5.28% 149 933585 9.20% 150 2514023 24.78% 151 3762431 37.08% 10146446 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=7.00 fanout-score-rank=22 prefix-density=0.26 prefix-fanout=4.3 sequence=AGGCCTTGAATGA criterion=fanout-score sequence-density=0.08 sequence-density-rank=24 fanout-score=402.25 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=37.4 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=9.81 fanout-score-rank=9 prefix-density=0.28 prefix-fanout=5.8 sequence=GAAAATGAGTTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=19 fanout-score=40.71 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=11.8 sequence=AAGCAGAAGATTGA SRR7172086 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 04:04:12 Started mapping on | Feb 14 04:04:12 Finished on | Feb 14 04:05:43 Mapping speed, Million of reads per hour | 401.40 Number of input reads | 10146446 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 9395638 Uniquely mapped reads % | 92.60% Average mapped length | 293.41 Number of splices: Total | 9428693 Number of splices: Annotated (sjdb) | 9273274 Number of splices: GT/AG | 9269346 Number of splices: GC/AG | 125501 Number of splices: AT/AC | 6617 Number of splices: Non-canonical | 27229 Mismatch rate per base, % | 0.48% Deletion rate per base | 0.04% Deletion average length | 2.47 Insertion rate per base | 0.02% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 324192 % of reads mapped to multiple loci | 3.20% Number of reads mapped to too many loci | 24189 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.84% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 430329 430329 430329 N_multimapping 324192 324192 324192 N_noFeature 229294 9300293 278243 N_ambiguous 98199 552 51508 UnstrandedReadsAssigned:9068145 PositiveStrandReadsAssigned:94793 NegativeStrandReadsAssigned:9065887 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7172086 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172086-trimmed-pair1.fastq SRR7172086-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,146,446 reads, 8,994,225 reads pseudoaligned [quant] estimated average fragment length: 247.557 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 992 rounds 52401 SRR7172086.ke.tsv 34699 SRR7172086.se.tsv 87100 total ==> SRR7172086.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1771.44 604 35.6682 Potri.005G024800.1.v4.1 1035 788.443 196 26.0051 Potri.004G059700.1.v4.1 961 714.463 27 3.95327 Potri.007G009000.2.v4.1 1416 1169.44 0 0 Potri.003G141000.2.v4.1 2943 2696.44 265 10.2808 Potri.016G087400.1.v4.1 270 75.3663 787 1092.37 Potri.015G069301.1.v4.1 564 321.343 0 0 Potri.010G195200.1.v4.1 1773 1526.44 257.715 17.6616 Potri.012G127500.1.v4.1 977 730.453 2023 289.718 ==> SRR7172086.se.tsv <== Potri.001G166300.v4.1 3 Potri.001G448400.v4.1 2 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 176 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 108 SRR7172086 completed mapping pipeline successfully