Starting /dee2/code/volunteer_pipeline.sh SRR7172087 current disk space = 3086824673280 free memory = 1568171720 SRR7172087 SRAfilesize e98f0c44cfec0809ae0b3db8fa512422 SRR7172087.sra SRR7172087.sra file validated SRR7172087 is paired end SRR7172087 is conventional basespace SRR7172087 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172087_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.226 33.0 33.0 34.0 31.0 34.0 2 32.72975 33.0 33.0 34.0 31.0 34.0 3 32.318 33.0 33.0 34.0 30.0 34.0 4 33.0345 33.0 33.0 34.0 32.0 34.0 5 32.738 33.0 33.0 33.0 32.0 34.0 6 36.52225 38.0 36.0 38.0 34.0 38.0 7 37.23525 38.0 38.0 38.0 36.0 38.0 8 37.61825 38.0 38.0 38.0 37.0 38.0 9 37.71675 38.0 38.0 38.0 38.0 38.0 10-14 37.72875 38.0 38.0 38.0 38.0 38.0 15-19 37.73909999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.7281 38.0 38.0 38.0 38.0 38.0 25-29 37.69015 38.0 38.0 38.0 38.0 38.0 30-34 37.6697 38.0 38.0 38.0 38.0 38.0 35-39 37.64164999999999 38.0 38.0 38.0 38.0 38.0 40-44 37.60025 38.0 38.0 38.0 38.0 38.0 45-49 37.59765 38.0 38.0 38.0 38.0 38.0 50-54 37.47875 38.0 38.0 38.0 37.4 38.0 55-59 37.426050000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.334849999999996 38.0 38.0 38.0 37.0 38.0 65-69 37.2752 38.0 38.0 38.0 37.0 38.0 70-74 37.2844 38.0 38.0 38.0 36.8 38.0 75-79 37.18560000000001 38.0 38.0 38.0 36.4 38.0 80-84 37.140950000000004 38.0 38.0 38.0 36.0 38.0 85-89 37.064699999999995 38.0 38.0 38.0 36.0 38.0 90-94 36.9255 38.0 38.0 38.0 35.8 38.0 95-99 36.8463 38.0 38.0 38.0 35.4 38.0 100-104 36.7008 38.0 38.0 38.0 34.8 38.0 105-109 36.45605 38.0 38.0 38.0 34.0 38.0 110-114 36.4077 38.0 37.8 38.0 34.0 38.0 115-119 36.168949999999995 38.0 37.4 38.0 33.8 38.0 120-124 36.12125 38.0 37.4 38.0 33.4 38.0 125-129 35.8827 38.0 37.0 38.0 32.6 38.0 130-134 35.555400000000006 38.0 36.0 38.0 31.2 38.0 135-139 35.18535 38.0 35.8 38.0 29.4 38.0 140-144 35.047200000000004 38.0 35.4 38.0 28.8 38.0 145-149 34.3997 38.0 35.0 38.0 27.2 38.0 150-151 30.75925 36.5 29.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 4.0 17 1.0 18 1.0 19 3.0 20 5.0 21 3.0 22 4.0 23 3.0 24 8.0 25 3.0 26 11.0 27 17.0 28 18.0 29 20.0 30 16.0 31 23.0 32 39.0 33 69.0 34 122.0 35 257.0 36 785.0 37 2585.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.735286355238852 16.996569015571392 16.838215888097125 39.42992874109264 2 18.154538634658664 24.60615153788447 38.38459614903726 18.854713678419603 3 17.875 29.675 26.900000000000002 25.55 4 20.4 37.225 21.575 20.8 5 20.075000000000003 37.475 24.725 17.724999999999998 6 16.075 35.15 26.3 22.475 7 12.1 19.725 46.725 21.45 8 17.75 21.525 29.125 31.6 9 17.95 21.975 32.675 27.400000000000002 10-14 19.775000000000002 30.145 26.665 23.415 15-19 19.314999999999998 29.665000000000003 27.145000000000003 23.875 20-24 19.035 29.775000000000002 27.685 23.505000000000003 25-29 19.28 29.89 27.41 23.419999999999998 30-34 19.86 29.505 27.339999999999996 23.294999999999998 35-39 19.66 29.035 27.88 23.425 40-44 19.93 29.455 27.084999999999997 23.53 45-49 19.439999999999998 29.525000000000002 27.825 23.21 50-54 18.915000000000003 29.705 27.525 23.855 55-59 19.12 29.755 27.139999999999997 23.985 60-64 19.900000000000002 28.92 28.02 23.16 65-69 19.564999999999998 29.39 27.76 23.285 70-74 19.725 29.69 27.33 23.255 75-79 19.900000000000002 29.020000000000003 27.625 23.455000000000002 80-84 20.0 28.93 27.395000000000003 23.674999999999997 85-89 19.475 29.509999999999998 27.99 23.025000000000002 90-94 19.86 28.555000000000003 27.735 23.849999999999998 95-99 20.28 28.720000000000002 27.865000000000002 23.135 100-104 20.185 29.715000000000003 27.01 23.09 105-109 20.45 28.435 27.255000000000003 23.86 110-114 20.355 28.754999999999995 27.77 23.119999999999997 115-119 20.49 28.52 26.950000000000003 24.04 120-124 20.105 28.849999999999998 26.755000000000003 24.29 125-129 20.46 28.92 26.810000000000002 23.810000000000002 130-134 20.599999999999998 28.9 27.05 23.45 135-139 20.315 28.7 27.065 23.919999999999998 140-144 20.97 28.37 27.245 23.415 145-149 20.855 28.415000000000003 26.71 24.02 150-151 20.674999999999997 29.049999999999997 27.125 23.150000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 1.5 23 2.0 24 4.5 25 5.5 26 6.0 27 9.5 28 13.5 29 20.0 30 27.5 31 38.5 32 50.0 33 63.0 34 83.0 35 98.5 36 112.0 37 138.5 38 147.5 39 174.5 40 195.5 41 210.5 42 248.0 43 259.5 44 264.0 45 257.0 46 239.0 47 227.5 48 224.0 49 193.5 50 152.5 51 128.0 52 99.5 53 76.0 54 59.5 55 46.5 56 36.0 57 26.0 58 19.5 59 10.5 60 5.5 61 4.5 62 3.5 63 3.5 64 2.5 65 1.0 66 1.0 67 0.5 68 1.5 69 1.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.2749999999999995 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84973703981969 99.675 2 0.12521913348359628 0.25 3 0.025043826696719257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.6499999999999999 0.0 0.0 0.0 0.0 106-107 0.8125 0.0 0.0 0.0 0.0 108-109 0.875 0.0 0.0 0.0 0.0 110-111 1.025 0.0 0.0 0.0 0.0 112-113 1.125 0.0 0.0 0.0 0.0 114-115 1.3375 0.0 0.0 0.0 0.0 116-117 1.6125 0.0 0.0 0.0 0.0 118-119 1.9375 0.0 0.0 0.0 0.0 120-121 2.2375 0.0 0.0 0.0 0.0 122-123 2.425 0.0 0.0 0.0 0.0 124-125 2.75 0.0 0.0 0.0 0.0 126-127 3.0625 0.0 0.0 0.0 0.0 128-129 3.35 0.0 0.0 0.0 0.0 130-131 3.6624999999999996 0.0 0.0 0.0 0.0 132-133 4.025 0.0 0.0 0.0 0.0 134-135 4.475 0.0 0.0 0.0 0.0 136-137 4.85 0.0 0.0 0.0 0.0 138-139 5.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGCTAT 10 0.0051850425 158.80821 1 >>END_MODULE SRR7172087 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172087_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.35475 34.0 33.0 34.0 33.0 34.0 2 33.46475 34.0 33.0 34.0 33.0 34.0 3 33.487 34.0 33.0 34.0 33.0 34.0 4 33.472 34.0 33.0 34.0 33.0 34.0 5 33.45575 34.0 33.0 34.0 33.0 34.0 6 37.615 38.0 38.0 38.0 38.0 38.0 7 37.672 38.0 38.0 38.0 38.0 38.0 8 37.60825 38.0 38.0 38.0 38.0 38.0 9 37.60475 38.0 38.0 38.0 38.0 38.0 10-14 37.6225 38.0 38.0 38.0 38.0 38.0 15-19 37.632600000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.59235 38.0 38.0 38.0 38.0 38.0 25-29 37.5576 38.0 38.0 38.0 38.0 38.0 30-34 37.5437 38.0 38.0 38.0 38.0 38.0 35-39 37.5268 38.0 38.0 38.0 38.0 38.0 40-44 37.493950000000005 38.0 38.0 38.0 38.0 38.0 45-49 37.476800000000004 38.0 38.0 38.0 38.0 38.0 50-54 37.47155 38.0 38.0 38.0 37.6 38.0 55-59 37.44735 38.0 38.0 38.0 37.6 38.0 60-64 37.385149999999996 38.0 38.0 38.0 37.0 38.0 65-69 37.35419999999999 38.0 38.0 38.0 37.0 38.0 70-74 37.294900000000005 38.0 38.0 38.0 37.0 38.0 75-79 37.19325 38.0 38.0 38.0 36.6 38.0 80-84 37.115449999999996 38.0 38.0 38.0 36.0 38.0 85-89 37.053 38.0 38.0 38.0 36.2 38.0 90-94 36.95440000000001 38.0 38.0 38.0 36.0 38.0 95-99 36.881299999999996 38.0 38.0 38.0 36.0 38.0 100-104 36.91455 38.0 38.0 38.0 35.8 38.0 105-109 36.69515 38.0 38.0 38.0 34.8 38.0 110-114 36.61475 38.0 38.0 38.0 34.6 38.0 115-119 36.39645 38.0 38.0 38.0 34.2 38.0 120-124 36.242549999999994 38.0 37.6 38.0 33.8 38.0 125-129 35.984249999999996 38.0 37.2 38.0 33.2 38.0 130-134 35.685050000000004 38.0 36.2 38.0 31.6 38.0 135-139 35.42115 38.0 36.0 38.0 31.0 38.0 140-144 35.097 38.0 35.8 38.0 30.6 38.0 145-149 34.3632 38.0 34.8 38.0 26.8 38.0 150-151 30.7875 36.5 29.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 3.0 16 0.0 17 3.0 18 2.0 19 1.0 20 5.0 21 3.0 22 5.0 23 6.0 24 7.0 25 9.0 26 4.0 27 9.0 28 8.0 29 25.0 30 25.0 31 33.0 32 47.0 33 74.0 34 104.0 35 202.0 36 579.0 37 2839.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.85 14.099999999999998 17.7 34.35 2 23.075000000000003 23.325000000000003 37.75 15.85 3 21.075 26.25 31.5 21.175 4 24.4 35.275 20.925 19.400000000000002 5 24.625 35.8 21.475 18.099999999999998 6 17.724999999999998 36.925000000000004 24.625 20.724999999999998 7 16.075 15.275 46.7 21.95 8 22.325 21.25 26.474999999999998 29.95 9 22.125 22.625 28.599999999999998 26.650000000000002 10-14 22.835 29.18 26.14 21.845 15-19 23.655 27.894999999999996 27.715 20.735 20-24 22.939999999999998 28.17 27.839999999999996 21.05 25-29 23.825 28.105000000000004 27.725 20.345 30-34 22.919999999999998 27.200000000000003 28.815 21.065 35-39 23.255 28.035 27.67 21.04 40-44 23.415 27.889999999999997 28.115000000000002 20.580000000000002 45-49 23.150000000000002 27.655 28.26 20.935000000000002 50-54 23.095 27.810000000000002 28.285 20.810000000000002 55-59 23.150000000000002 27.794999999999998 28.305000000000003 20.75 60-64 23.65 27.889999999999997 27.91 20.549999999999997 65-69 23.494999999999997 27.839999999999996 28.044999999999998 20.62 70-74 23.52 27.955000000000002 27.715 20.810000000000002 75-79 23.044999999999998 27.095000000000002 28.73 21.13 80-84 23.419999999999998 28.23 27.875 20.474999999999998 85-89 23.905 28.17 27.700000000000003 20.225 90-94 23.0 28.08 28.494999999999997 20.424999999999997 95-99 23.515 27.955000000000002 28.04 20.49 100-104 23.865 28.189999999999998 28.125 19.82 105-109 23.665 27.465 28.9 19.97 110-114 23.325000000000003 28.27 28.27 20.135 115-119 24.099999999999998 27.889999999999997 27.915 20.095 120-124 23.525 27.87 27.72 20.885 125-129 24.169999999999998 28.194999999999997 27.834999999999997 19.8 130-134 24.565 27.534999999999997 27.950000000000003 19.950000000000003 135-139 24.575 27.529999999999998 28.32 19.575 140-144 25.080000000000002 27.894999999999996 27.665 19.36 145-149 25.34 27.955000000000002 27.089999999999996 19.615 150-151 25.0125 28.249999999999996 27.9125 18.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 2.0 24 2.5 25 2.0 26 4.0 27 5.0 28 5.0 29 7.5 30 12.5 31 18.5 32 24.0 33 31.0 34 51.0 35 64.0 36 70.0 37 89.0 38 124.5 39 182.0 40 209.5 41 209.0 42 233.5 43 269.0 44 288.5 45 294.5 46 283.5 47 264.0 48 246.5 49 206.5 50 179.5 51 164.5 52 135.0 53 92.5 54 56.0 55 44.0 56 37.5 57 27.0 58 18.0 59 12.5 60 7.0 61 6.5 62 5.5 63 3.5 64 2.0 65 2.0 66 1.5 67 0.5 68 1.5 69 2.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67369477911646 99.275 2 0.25100401606425704 0.5 3 0.07530120481927711 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.6499999999999999 0.0 0.0 0.0 0.0 106-107 0.8125 0.0 0.0 0.0 0.0 108-109 0.875 0.0 0.0 0.0 0.0 110-111 1.025 0.0 0.0 0.0 0.0 112-113 1.125 0.0 0.0 0.0 0.0 114-115 1.3624999999999998 0.0 0.0 0.0 0.0 116-117 1.65 0.0 0.0 0.0 0.0 118-119 1.9874999999999998 0.0 0.0 0.0 0.0 120-121 2.3125 0.0 0.0 0.0 0.0 122-123 2.5250000000000004 0.0 0.0 0.0 0.0 124-125 2.875 0.0 0.0 0.0 0.0 126-127 3.175 0.0 0.0 0.0 0.0 128-129 3.4625000000000004 0.0 0.0 0.0 0.0 130-131 3.7625 0.0 0.0 0.0 0.0 132-133 4.1 0.0 0.0 0.0 0.0 134-135 4.550000000000001 0.0 0.0 0.0 0.0 136-137 4.9375 0.0 0.0 0.0 0.0 138-139 5.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 514038 spots for SRR7172087.sra Written 514038 spots for SRR7172087.sra Read 514038 spots for SRR7172087.sra Written 514038 spots for SRR7172087.sra Read 514038 spots for SRR7172087.sra Written 514038 spots for SRR7172087.sra Read 514038 spots for SRR7172087.sra Written 514038 spots for SRR7172087.sra Read 514038 spots for SRR7172087.sra Written 514038 spots for SRR7172087.sra Read 514038 spots for SRR7172087.sra Written 514038 spots for SRR7172087.sra Read 514038 spots for SRR7172087.sra Written 514038 spots for SRR7172087.sra Read 514038 spots for SRR7172087.sra Written 514038 spots for SRR7172087.sra Read 514038 spots for SRR7172087.sra Written 514038 spots for SRR7172087.sra Read 514046 spots for SRR7172087.sra Written 514046 spots for SRR7172087.sra Read 514038 spots for SRR7172087.sra Written 514038 spots for SRR7172087.sra Read 514038 spots for SRR7172087.sra Written 514038 spots for SRR7172087.sra Read 514038 spots for SRR7172087.sra Written 514038 spots for SRR7172087.sra Read 514038 spots for SRR7172087.sra Written 514038 spots for SRR7172087.sra Read 514038 spots for SRR7172087.sra Written 514038 spots for SRR7172087.sra Read 514038 spots for SRR7172087.sra Written 514038 spots for SRR7172087.sra Read 514038 spots for SRR7172087.sra Written 514038 spots for SRR7172087.sra Read 514038 spots for SRR7172087.sra Written 514038 spots for SRR7172087.sra Read 514038 spots for SRR7172087.sra Written 514038 spots for SRR7172087.sra Read 514038 spots for SRR7172087.sra Written 514038 spots for SRR7172087.sra SRR ids: ['SRR7172087.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wluercvn SRR7172087.sra spots: 10280768 blocks: [[1, 514038], [514039, 1028076], [1028077, 1542114], [1542115, 2056152], [2056153, 2570190], [2570191, 3084228], [3084229, 3598266], [3598267, 4112304], [4112305, 4626342], [4626343, 5140380], [5140381, 5654418], [5654419, 6168456], [6168457, 6682494], [6682495, 7196532], [7196533, 7710570], [7710571, 8224608], [8224609, 8738646], [8738647, 9252684], [9252685, 9766722], [9766723, 10280768]] SRR7172087 file size 3462114 SRR7172087 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172087 SRR7172087_1.fastq SRR7172087_2.fastq Input file: SRR7172087_1.fastq Paired file: SRR7172087_2.fastq trimmed: SRR7172087-trimmed-pair1.fastq, SRR7172087-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 04:55:54 2025 >> started Fri Feb 14 04:56:05 2025 >> done (11.373s) 10280768 read pairs processed; of these: 3730 ( 0.04%) short read pairs filtered out after trimming by size control 3220 ( 0.03%) empty read pairs filtered out after trimming by size control 10273818 (99.93%) read pairs available; of these: 4913444 (47.82%) trimmed read pairs available after processing 5360374 (52.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 2 0.00% 21 1 0.00% 22 3 0.00% 23 1 0.00% 24 3 0.00% 25 4 0.00% 26 2 0.00% 27 3 0.00% 28 4 0.00% 29 2 0.00% 30 4 0.00% 31 2 0.00% 32 1 0.00% 33 2 0.00% 34 2 0.00% 35 1 0.00% 36 2 0.00% 37 5 0.00% 38 5 0.00% 39 2 0.00% 40 3 0.00% 41 8 0.00% 42 1 0.00% 43 4 0.00% 44 3 0.00% 45 8 0.00% 46 8 0.00% 47 7 0.00% 48 15 0.00% 49 10 0.00% 50 11 0.00% 51 13 0.00% 52 12 0.00% 53 13 0.00% 54 19 0.00% 55 18 0.00% 56 22 0.00% 57 29 0.00% 58 30 0.00% 59 38 0.00% 60 37 0.00% 61 64 0.00% 62 51 0.00% 63 68 0.00% 64 68 0.00% 65 105 0.00% 66 83 0.00% 67 100 0.00% 68 115 0.00% 69 136 0.00% 70 146 0.00% 71 182 0.00% 72 215 0.00% 73 263 0.00% 74 268 0.00% 75 314 0.00% 76 424 0.00% 77 439 0.00% 78 492 0.00% 79 487 0.00% 80 581 0.01% 81 672 0.01% 82 847 0.01% 83 889 0.01% 84 1131 0.01% 85 1438 0.01% 86 1560 0.02% 87 1788 0.02% 88 1958 0.02% 89 2006 0.02% 90 2282 0.02% 91 2463 0.02% 92 2749 0.03% 93 2890 0.03% 94 3147 0.03% 95 3444 0.03% 96 3729 0.04% 97 4036 0.04% 98 4436 0.04% 99 4722 0.05% 100 5247 0.05% 101 5435 0.05% 102 5816 0.06% 103 6261 0.06% 104 6691 0.07% 105 7157 0.07% 106 7719 0.08% 107 8375 0.08% 108 8818 0.09% 109 9195 0.09% 110 9815 0.10% 111 10334 0.10% 112 10901 0.11% 113 11429 0.11% 114 12339 0.12% 115 12833 0.12% 116 13809 0.13% 117 13963 0.14% 118 14626 0.14% 119 15264 0.15% 120 15939 0.16% 121 16790 0.16% 122 17435 0.17% 123 18207 0.18% 124 19241 0.19% 125 20223 0.20% 126 21220 0.21% 127 22398 0.22% 128 23538 0.23% 129 24568 0.24% 130 26035 0.25% 131 27058 0.26% 132 28542 0.28% 133 30480 0.30% 134 32162 0.31% 135 34058 0.33% 136 35943 0.35% 137 38174 0.37% 138 40828 0.40% 139 43490 0.42% 140 47488 0.46% 141 51702 0.50% 142 58055 0.57% 143 65430 0.64% 144 76867 0.75% 145 94108 0.92% 146 122000 1.19% 147 172810 1.68% 148 284196 2.77% 149 602742 5.87% 150 2554540 24.86% 151 5360374 52.18% 10273818 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=27 prefix-density=0.42 prefix-fanout=2.0 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.11 sequence-density-rank=18 fanout-score=42.81 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=11.8 sequence=CCTTCCTTGTCCTGGATCTTGGCCTTCAC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=4.84 fanout-score-rank=12 prefix-density=0.75 prefix-fanout=3.4 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=84.42 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=7.2 sequence=CTTCCATTTCCGCCCAAGCTGCTCACAGTATACGGGCGTCGGCATCCAGACCGTCGGCTGATCGTGGTTTTACTAGGCTAGACTAGCGTACGAGCACTATGGTCAGTAATTCCTGGAGGAATAGGTACCAAGAAAAAAACGAACCTTTGGGTTCCAGAGCTGTACGGTCGCACTGAACTCGGATAGGTCTCAGAAAAACGAAATATAGGCTTACGGTAGGTCCGAATGGCACAAAGCTTGTTCCGTTAGCTGGCATAAGATTCCATGCCTAGATGTGATACACGTTTCTGGAAACTGCCTCGTCATGCGACTGTTCCCCGGGGTCAGGGCCGCTGGTATTTGCTGT SRR7172087 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 04:56:51 Started mapping on | Feb 14 04:56:51 Finished on | Feb 14 04:58:12 Mapping speed, Million of reads per hour | 456.61 Number of input reads | 10273818 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 9628430 Uniquely mapped reads % | 93.72% Average mapped length | 295.54 Number of splices: Total | 9320455 Number of splices: Annotated (sjdb) | 9162093 Number of splices: GT/AG | 9169193 Number of splices: GC/AG | 118070 Number of splices: AT/AC | 6939 Number of splices: Non-canonical | 26253 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.04% Deletion average length | 2.39 Insertion rate per base | 0.02% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 271021 % of reads mapped to multiple loci | 2.64% Number of reads mapped to too many loci | 29360 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.29% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 378992 378992 378992 N_multimapping 271021 271021 271021 N_noFeature 236249 9527384 280495 N_ambiguous 103497 459 46510 UnstrandedReadsAssigned:9288684 PositiveStrandReadsAssigned:100587 NegativeStrandReadsAssigned:9301425 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172087 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172087-trimmed-pair1.fastq SRR7172087-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,273,818 reads, 9,209,437 reads pseudoaligned [quant] estimated average fragment length: 247.988 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,084 rounds 52401 SRR7172087.ke.tsv 34699 SRR7172087.se.tsv 87100 total ==> SRR7172087.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1771.01 527 28.6555 Potri.005G024800.1.v4.1 1035 788.012 122 14.9089 Potri.004G059700.1.v4.1 961 714.05 19 2.56239 Potri.007G009000.2.v4.1 1416 1169.01 0 0 Potri.003G141000.2.v4.1 2943 2696.01 371 13.2517 Potri.016G087400.1.v4.1 270 76.3342 623 785.938 Potri.015G069301.1.v4.1 564 321.856 0 0 Potri.010G195200.1.v4.1 1773 1526.01 95.8764 6.05025 Potri.012G127500.1.v4.1 977 730.029 2195 289.544 ==> SRR7172087.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 49 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 395 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 124 SRR7172087 completed mapping pipeline successfully