Starting /dee2/code/volunteer_pipeline.sh SRR7172088 current disk space = 3087632416768 free memory = 1449491320 SRR7172088 SRAfilesize 54164ea11a0dbbaaeeffa9612d8e3d27 SRR7172088.sra SRR7172088.sra file validated SRR7172088 is paired end SRR7172088 is conventional basespace SRR7172088 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172088_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.84775 33.0 32.0 33.0 27.0 34.0 2 29.51275 32.0 28.0 33.0 18.0 33.0 3 31.7595 33.0 31.0 33.0 28.0 33.0 4 30.628 31.0 31.0 33.0 28.0 33.0 5 32.1575 33.0 33.0 33.0 31.0 33.0 6 35.127 37.0 35.0 38.0 30.0 38.0 7 36.71925 38.0 37.0 38.0 34.0 38.0 8 37.19 38.0 38.0 38.0 36.0 38.0 9 37.34 38.0 38.0 38.0 37.0 38.0 10-14 37.3688 38.0 38.0 38.0 37.0 38.0 15-19 37.4064 38.0 38.0 38.0 37.0 38.0 20-24 37.400999999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.416999999999994 38.0 38.0 38.0 37.0 38.0 30-34 37.35325 38.0 38.0 38.0 37.0 38.0 35-39 37.2859 38.0 38.0 38.0 37.0 38.0 40-44 37.24315 38.0 38.0 38.0 36.8 38.0 45-49 37.2035 38.0 38.0 38.0 36.4 38.0 50-54 37.1111 38.0 38.0 38.0 36.0 38.0 55-59 37.02475 38.0 38.0 38.0 36.0 38.0 60-64 36.978300000000004 38.0 38.0 38.0 36.0 38.0 65-69 36.905100000000004 38.0 38.0 38.0 35.6 38.0 70-74 36.8452 38.0 38.0 38.0 35.2 38.0 75-79 36.7177 38.0 38.0 38.0 34.6 38.0 80-84 36.630199999999995 38.0 38.0 38.0 34.2 38.0 85-89 36.47445 38.0 37.8 38.0 34.0 38.0 90-94 36.34055 38.0 37.2 38.0 33.8 38.0 95-99 36.232099999999996 38.0 37.0 38.0 33.4 38.0 100-104 36.0993 38.0 37.0 38.0 33.0 38.0 105-109 35.85105 38.0 37.0 38.0 31.8 38.0 110-114 35.64275 38.0 36.4 38.0 31.0 38.0 115-119 35.5868 38.0 36.0 38.0 31.0 38.0 120-124 35.251749999999994 38.0 35.8 38.0 28.4 38.0 125-129 35.077999999999996 38.0 35.4 38.0 28.0 38.0 130-134 34.721650000000004 38.0 35.0 38.0 27.4 38.0 135-139 34.39385 38.0 34.8 38.0 25.4 38.0 140-144 33.62145 38.0 34.0 38.0 21.8 38.0 145-149 32.88605 38.0 33.8 38.0 17.0 38.0 150-151 29.094375 36.0 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 2.0 12 1.0 13 0.0 14 1.0 15 0.0 16 3.0 17 3.0 18 3.0 19 3.0 20 5.0 21 2.0 22 10.0 23 7.0 24 19.0 25 11.0 26 11.0 27 21.0 28 31.0 29 41.0 30 45.0 31 51.0 32 67.0 33 127.0 34 211.0 35 433.0 36 1019.0 37 1873.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.571801566579634 15.87467362924282 16.475195822454307 40.07832898172324 2 18.854713678419603 22.43060765191298 39.75993998499625 18.95473868467117 3 17.7 28.225 27.750000000000004 26.325 4 20.599999999999998 36.05 21.55 21.8 5 19.8 37.974999999999994 23.775 18.45 6 15.225 36.775000000000006 26.25 21.75 7 14.05 18.975 45.45 21.525 8 18.15 21.0 29.849999999999998 31.0 9 17.7 23.65 29.875 28.775000000000002 10-14 18.96 30.03 26.735 24.275 15-19 19.25 29.12 27.685 23.945 20-24 19.655 29.049999999999997 28.215 23.080000000000002 25-29 19.759999999999998 28.78 27.905 23.555 30-34 19.595000000000002 29.005 28.060000000000002 23.34 35-39 19.950000000000003 29.085 27.495000000000005 23.47 40-44 20.03 28.4 27.725 23.845 45-49 19.88 28.895 27.725 23.5 50-54 19.78 29.065 27.425 23.73 55-59 20.275000000000002 28.59 27.775 23.36 60-64 20.11 28.98 27.37 23.54 65-69 20.71 28.92 27.400000000000002 22.97 70-74 20.995 28.904999999999998 27.49 22.61 75-79 20.145 28.815 27.47 23.57 80-84 20.45 28.655 27.384999999999998 23.51 85-89 20.23 29.065 27.555000000000003 23.150000000000002 90-94 20.13 28.93 27.785 23.155 95-99 20.075000000000003 28.560000000000002 27.794999999999998 23.57 100-104 20.235 29.2 27.495000000000005 23.07 105-109 20.415 28.275 27.71 23.599999999999998 110-114 20.985 28.1 27.825 23.09 115-119 21.205 28.76 27.584999999999997 22.45 120-124 20.71 28.455000000000002 27.58 23.255 125-129 20.805 27.955000000000002 27.555000000000003 23.685000000000002 130-134 20.86 27.800000000000004 27.83 23.51 135-139 21.13 28.17 27.900000000000002 22.8 140-144 21.01 28.175 27.284999999999997 23.53 145-149 21.4 28.15 26.99 23.46 150-151 20.6875 27.8625 27.250000000000004 24.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.5 24 0.5 25 2.0 26 4.5 27 5.0 28 7.0 29 13.5 30 21.0 31 24.5 32 34.0 33 48.0 34 62.5 35 91.5 36 118.5 37 132.0 38 147.0 39 175.0 40 211.5 41 225.0 42 242.5 43 260.0 44 262.0 45 283.5 46 273.0 47 248.0 48 230.0 49 189.5 50 164.5 51 138.0 52 97.5 53 76.0 54 62.0 55 39.5 56 28.0 57 22.0 58 13.0 59 7.5 60 4.5 61 4.0 62 2.5 63 4.0 64 5.5 65 5.5 66 4.5 67 2.0 68 1.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.25 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69894631209232 99.35000000000001 2 0.2508780732563974 0.5 3 0.050175614651279475 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.4875 0.0 0.0 0.0 0.0 104-105 0.5874999999999999 0.0 0.0 0.0 0.0 106-107 0.6375 0.0 0.0 0.0 0.0 108-109 0.825 0.0 0.0 0.0 0.0 110-111 1.0125 0.0 0.0 0.0 0.0 112-113 1.225 0.0 0.0 0.0 0.0 114-115 1.3375 0.0 0.0 0.0 0.0 116-117 1.65 0.0 0.0 0.0 0.0 118-119 1.85 0.0 0.0 0.0 0.0 120-121 1.9874999999999998 0.0 0.0 0.0 0.0 122-123 2.1625 0.0 0.0 0.0 0.0 124-125 2.3625 0.0 0.0 0.0 0.0 126-127 2.675 0.0 0.0 0.0 0.0 128-129 2.9125 0.0 0.0 0.0 0.0 130-131 3.1500000000000004 0.0 0.0 0.0 0.0 132-133 3.4375 0.0 0.0 0.0 0.0 134-135 3.7125000000000004 0.0 0.0 0.0 0.0 136-137 4.1375 0.0 0.0 0.0 0.0 138-139 4.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTAAG 10 0.0068343505 144.975 6 >>END_MODULE SRR7172088 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172088_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.96025 33.0 33.0 34.0 32.0 34.0 2 33.0015 34.0 33.0 34.0 32.0 34.0 3 33.10825 34.0 33.0 34.0 32.0 34.0 4 33.03525 34.0 33.0 34.0 32.0 34.0 5 33.031 34.0 33.0 34.0 32.0 34.0 6 37.10825 38.0 38.0 38.0 37.0 38.0 7 37.2915 38.0 38.0 38.0 37.0 38.0 8 37.26975 38.0 38.0 38.0 37.0 38.0 9 37.2705 38.0 38.0 38.0 37.0 38.0 10-14 37.26485 38.0 38.0 38.0 37.0 38.0 15-19 37.2425 38.0 38.0 38.0 37.0 38.0 20-24 37.14675 38.0 38.0 38.0 36.4 38.0 25-29 37.09365 38.0 38.0 38.0 36.0 38.0 30-34 37.10975 38.0 38.0 38.0 36.4 38.0 35-39 36.92875 38.0 38.0 38.0 35.8 38.0 40-44 37.0214 38.0 38.0 38.0 36.0 38.0 45-49 36.9859 38.0 38.0 38.0 36.0 38.0 50-54 36.9776 38.0 38.0 38.0 36.0 38.0 55-59 36.832750000000004 38.0 38.0 38.0 35.4 38.0 60-64 36.7436 38.0 38.0 38.0 35.0 38.0 65-69 36.6842 38.0 38.0 38.0 35.0 38.0 70-74 36.6449 38.0 38.0 38.0 34.4 38.0 75-79 36.54345 38.0 38.0 38.0 34.0 38.0 80-84 36.4135 38.0 38.0 38.0 34.0 38.0 85-89 36.336600000000004 38.0 37.8 38.0 33.8 38.0 90-94 36.12715000000001 38.0 37.0 38.0 33.0 38.0 95-99 35.968149999999994 38.0 37.0 38.0 32.6 38.0 100-104 35.799600000000005 38.0 37.0 38.0 31.0 38.0 105-109 35.626099999999994 38.0 36.6 38.0 30.6 38.0 110-114 35.37945 38.0 36.0 38.0 29.0 38.0 115-119 35.17585 38.0 36.0 38.0 28.4 38.0 120-124 34.9431 38.0 35.4 38.0 28.0 38.0 125-129 34.41080000000001 38.0 35.0 38.0 24.6 38.0 130-134 34.14245 38.0 35.0 38.0 23.2 38.0 135-139 33.86444999999999 38.0 34.4 38.0 22.8 38.0 140-144 33.10699999999999 38.0 33.8 38.0 17.2 38.0 145-149 31.96765 37.8 32.0 38.0 11.2 38.0 150-151 27.564875 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 2.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 2.0 13 2.0 14 1.0 15 2.0 16 2.0 17 3.0 18 6.0 19 8.0 20 7.0 21 11.0 22 13.0 23 9.0 24 17.0 25 26.0 26 18.0 27 31.0 28 27.0 29 46.0 30 54.0 31 75.0 32 76.0 33 138.0 34 199.0 35 374.0 36 871.0 37 1976.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.325000000000003 13.375 20.724999999999998 35.575 2 23.275000000000002 21.25 38.725 16.75 3 20.575 25.95 30.349999999999998 23.125 4 22.8 34.675 21.325 21.2 5 25.25 36.475 21.15 17.125 6 17.775 38.324999999999996 24.099999999999998 19.8 7 17.125 14.825 46.5 21.55 8 18.725 21.95 28.525 30.8 9 22.15 22.650000000000002 29.049999999999997 26.150000000000002 10-14 22.71 28.58 26.745 21.965 15-19 22.545 27.505000000000003 28.73 21.22 20-24 22.795 27.775 27.689999999999998 21.740000000000002 25-29 22.655 27.755000000000003 28.050000000000004 21.54 30-34 22.955000000000002 28.060000000000002 27.735 21.25 35-39 22.855 28.04 27.85 21.255 40-44 21.915000000000003 28.325 28.244999999999997 21.515 45-49 22.98 28.110000000000003 28.060000000000002 20.849999999999998 50-54 22.52 28.29 28.27 20.919999999999998 55-59 22.86 27.985 28.13 21.025 60-64 22.965 28.244999999999997 27.485 21.305 65-69 22.61 28.365000000000002 27.800000000000004 21.224999999999998 70-74 22.689999999999998 28.189999999999998 28.410000000000004 20.71 75-79 22.770000000000003 28.285 28.585 20.36 80-84 23.98 27.884999999999998 27.665 20.47 85-89 23.73 27.79 27.855 20.625 90-94 23.06 28.02 28.54 20.380000000000003 95-99 23.365 27.935 27.915 20.785 100-104 24.08 27.800000000000004 27.625 20.495 105-109 24.169999999999998 27.96 27.76 20.11 110-114 23.605 28.02 27.589999999999996 20.785 115-119 23.665 28.375 28.439999999999998 19.52 120-124 24.22 27.810000000000002 27.265 20.705000000000002 125-129 23.955000000000002 27.794999999999998 27.665 20.585 130-134 23.91 28.194999999999997 27.644999999999996 20.25 135-139 23.49 28.189999999999998 27.925 20.395 140-144 24.125 28.060000000000002 27.73 20.085 145-149 24.175 28.17 27.68 19.975 150-151 24.099999999999998 28.299999999999997 27.425 20.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 0.0 25 0.5 26 2.0 27 3.0 28 3.5 29 5.5 30 11.0 31 19.5 32 25.5 33 27.0 34 42.0 35 58.0 36 78.5 37 115.5 38 149.5 39 184.0 40 215.5 41 231.0 42 252.0 43 270.5 44 292.0 45 288.5 46 270.0 47 264.5 48 241.0 49 213.0 50 174.0 51 135.0 52 114.0 53 88.0 54 60.5 55 43.5 56 27.5 57 20.0 58 15.5 59 12.5 60 10.5 61 8.0 62 4.0 63 3.0 64 3.5 65 4.5 66 3.5 67 0.5 68 1.0 69 1.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42138364779875 98.8 2 0.5283018867924528 1.05 3 0.05031446540880503 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.4875 0.0 0.0 0.0 0.0 104-105 0.5874999999999999 0.0 0.0 0.0 0.0 106-107 0.6375 0.0 0.0 0.0 0.0 108-109 0.825 0.0 0.0 0.0 0.0 110-111 1.0125 0.0 0.0 0.0 0.0 112-113 1.225 0.0 0.0 0.0 0.0 114-115 1.3375 0.0 0.0 0.0 0.0 116-117 1.65 0.0 0.0 0.0 0.0 118-119 1.85 0.0 0.0 0.0 0.0 120-121 1.9874999999999998 0.0 0.0 0.0 0.0 122-123 2.1625 0.0 0.0 0.0 0.0 124-125 2.3625 0.0 0.0 0.0 0.0 126-127 2.675 0.0 0.0 0.0 0.0 128-129 2.9000000000000004 0.0 0.0 0.0 0.0 130-131 3.125 0.0 0.0 0.0 0.0 132-133 3.4125 0.0 0.0 0.0 0.0 134-135 3.6624999999999996 0.0 0.0 0.0 0.0 136-137 4.1 0.0 0.0 0.0 0.0 138-139 4.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCAAGC 10 0.006830828 145.0 2 AAAAGAT 10 0.006830828 145.0 145 >>END_MODULE Read 659478 spots for SRR7172088.sra Written 659478 spots for SRR7172088.sra Read 659478 spots for SRR7172088.sra Written 659478 spots for SRR7172088.sra Read 659478 spots for SRR7172088.sra Written 659478 spots for SRR7172088.sra Read 659478 spots for SRR7172088.sra Written 659478 spots for SRR7172088.sra Read 659478 spots for SRR7172088.sra Written 659478 spots for SRR7172088.sra Read 659478 spots for SRR7172088.sra Written 659478 spots for SRR7172088.sra Read 659478 spots for SRR7172088.sra Written 659478 spots for SRR7172088.sra Read 659478 spots for SRR7172088.sra Written 659478 spots for SRR7172088.sra Read 659478 spots for SRR7172088.sra Written 659478 spots for SRR7172088.sra Read 659478 spots for SRR7172088.sra Written 659478 spots for SRR7172088.sra Read 659478 spots for SRR7172088.sra Written 659478 spots for SRR7172088.sra Read 659478 spots for SRR7172088.sra Written 659478 spots for SRR7172088.sra Read 659478 spots for SRR7172088.sra Written 659478 spots for SRR7172088.sra Read 659478 spots for SRR7172088.sra Written 659478 spots for SRR7172088.sra Read 659478 spots for SRR7172088.sra Written 659478 spots for SRR7172088.sra Read 659478 spots for SRR7172088.sra Written 659478 spots for SRR7172088.sra Read 659483 spots for SRR7172088.sra Written 659483 spots for SRR7172088.sra Read 659478 spots for SRR7172088.sra Written 659478 spots for SRR7172088.sra Read 659478 spots for SRR7172088.sra Written 659478 spots for SRR7172088.sra Read 659478 spots for SRR7172088.sra Written 659478 spots for SRR7172088.sra SRR ids: ['SRR7172088.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fsxfws1z SRR7172088.sra spots: 13189565 blocks: [[1, 659478], [659479, 1318956], [1318957, 1978434], [1978435, 2637912], [2637913, 3297390], [3297391, 3956868], [3956869, 4616346], [4616347, 5275824], [5275825, 5935302], [5935303, 6594780], [6594781, 7254258], [7254259, 7913736], [7913737, 8573214], [8573215, 9232692], [9232693, 9892170], [9892171, 10551648], [10551649, 11211126], [11211127, 11870604], [11870605, 12530082], [12530083, 13189565]] SRR7172088 file size 4447810 SRR7172088 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172088 SRR7172088_1.fastq SRR7172088_2.fastq Input file: SRR7172088_1.fastq Paired file: SRR7172088_2.fastq trimmed: SRR7172088-trimmed-pair1.fastq, SRR7172088-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 04:08:16 2025 >> started Fri Feb 14 04:08:31 2025 >> done (15.076s) 13189565 read pairs processed; of these: 3983 ( 0.03%) short read pairs filtered out after trimming by size control 2997 ( 0.02%) empty read pairs filtered out after trimming by size control 13182585 (99.95%) read pairs available; of these: 8186751 (62.10%) trimmed read pairs available after processing 4995834 (37.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 1 0.00% 21 0 0.00% 22 0 0.00% 23 2 0.00% 24 5 0.00% 25 5 0.00% 26 2 0.00% 27 3 0.00% 28 2 0.00% 29 1 0.00% 30 1 0.00% 31 4 0.00% 32 0 0.00% 33 2 0.00% 34 2 0.00% 35 2 0.00% 36 6 0.00% 37 5 0.00% 38 4 0.00% 39 6 0.00% 40 5 0.00% 41 9 0.00% 42 2 0.00% 43 7 0.00% 44 11 0.00% 45 7 0.00% 46 13 0.00% 47 10 0.00% 48 11 0.00% 49 15 0.00% 50 24 0.00% 51 15 0.00% 52 18 0.00% 53 16 0.00% 54 46 0.00% 55 39 0.00% 56 31 0.00% 57 41 0.00% 58 38 0.00% 59 45 0.00% 60 65 0.00% 61 62 0.00% 62 99 0.00% 63 92 0.00% 64 110 0.00% 65 128 0.00% 66 168 0.00% 67 162 0.00% 68 173 0.00% 69 224 0.00% 70 226 0.00% 71 260 0.00% 72 298 0.00% 73 355 0.00% 74 396 0.00% 75 435 0.00% 76 543 0.00% 77 593 0.00% 78 661 0.01% 79 808 0.01% 80 885 0.01% 81 904 0.01% 82 1092 0.01% 83 1332 0.01% 84 1607 0.01% 85 1972 0.01% 86 2184 0.02% 87 2468 0.02% 88 2776 0.02% 89 2883 0.02% 90 3053 0.02% 91 3492 0.03% 92 3723 0.03% 93 4033 0.03% 94 4459 0.03% 95 4963 0.04% 96 5378 0.04% 97 5759 0.04% 98 6183 0.05% 99 6569 0.05% 100 7286 0.06% 101 7698 0.06% 102 8423 0.06% 103 8874 0.07% 104 9913 0.08% 105 10406 0.08% 106 11092 0.08% 107 11852 0.09% 108 12695 0.10% 109 13499 0.10% 110 14388 0.11% 111 14899 0.11% 112 15914 0.12% 113 17082 0.13% 114 18023 0.14% 115 19351 0.15% 116 20235 0.15% 117 21512 0.16% 118 22753 0.17% 119 23876 0.18% 120 25552 0.19% 121 26966 0.20% 122 28498 0.22% 123 30158 0.23% 124 31757 0.24% 125 34095 0.26% 126 36493 0.28% 127 38635 0.29% 128 40942 0.31% 129 44067 0.33% 130 47236 0.36% 131 50339 0.38% 132 54323 0.41% 133 58431 0.44% 134 62971 0.48% 135 67985 0.52% 136 73861 0.56% 137 79973 0.61% 138 88537 0.67% 139 97433 0.74% 140 107345 0.81% 141 120728 0.92% 142 139008 1.05% 143 161207 1.22% 144 194873 1.48% 145 241537 1.83% 146 313658 2.38% 147 433470 3.29% 148 660778 5.01% 149 1167780 8.86% 150 3266312 24.78% 151 4995834 37.90% 13182585 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=29 prefix-density=0.47 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.09 sequence-density-rank=29 fanout-score=78.26 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=15.3 sequence=GCAGCAGCAGCATGCACGCATATGATACTGACCGATCATTCATGCCTGTGCTGTTGGTAGCTGGGTAAGGTGATGATCCTCAATGTCTTTGCTGCAATGGATGCAAAACTCAAGCAACGTTTGAGGATCTGGAACGTTCTCATTTAGCTTCTCATATTCAAAAGTCCAGTGAGCCAAGCAGCTGCCCTCTCCTTTGGGAGTAGCTTGAACGATAATTATGAAATTCTTGTACTCCGTGGTGATGTCTCCTTCAATCACTTTGAAGGTGGTTGACAGCTTCTCATCGTCTATAGCTTCAATAACCTCCTTAGCAGTCTTAGCAACCCCATCATGTACATAACTCCAGCAGATTACAGTGCCCGGCTTCCCCCATTCACCTTCATGCAGATCAACATTCTGTATCTTGGCAGGGCTCATATTGGAAACGTGGTGTGGTCTGCAGCTGAAGATATCATGAAATGTTTCAGCAGAAACTTTGATCTCTACTTCAGCCTCCATCTTACCAAAGAGT criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.47 fanout-score-rank=21 prefix-density=0.59 prefix-fanout=2.4 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=49.53 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.1 sequence=AGGATCTGTTTAATTTGAGACAGAAAACATGAAATCCTCCTACACTTTCTTCATTCTTTTCTCACTCTTTTCGTTTGCTAACGTGATCGGTGCTAGAAAAGACACTGGAGAGTATTGGAGAGCTGTCATGAAAGATCAGCCCATGCCAGAAGCAATACA SRR7172088 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 04:09:31 Started mapping on | Feb 14 04:09:32 Finished on | Feb 14 04:11:12 Mapping speed, Million of reads per hour | 474.57 Number of input reads | 13182585 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 11804307 Uniquely mapped reads % | 89.54% Average mapped length | 288.34 Number of splices: Total | 11572494 Number of splices: Annotated (sjdb) | 11348446 Number of splices: GT/AG | 11386724 Number of splices: GC/AG | 144662 Number of splices: AT/AC | 9663 Number of splices: Non-canonical | 31445 Mismatch rate per base, % | 0.52% Deletion rate per base | 0.04% Deletion average length | 2.58 Insertion rate per base | 0.03% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 373555 % of reads mapped to multiple loci | 2.83% Number of reads mapped to too many loci | 29407 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.33% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1008693 1008693 1008693 N_multimapping 373555 373555 373555 N_noFeature 297619 11699803 338007 N_ambiguous 192263 791 127812 UnstrandedReadsAssigned:11314425 PositiveStrandReadsAssigned:103713 NegativeStrandReadsAssigned:11338488 Dataset is classified negative stranded MeadianReadLen=147 20thPercentileLength=145 echo kmer=141 SRR7172088 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172088-trimmed-pair1.fastq SRR7172088-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,182,585 reads, 11,793,238 reads pseudoaligned [quant] estimated average fragment length: 241.152 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,104 rounds 52401 SRR7172088.ke.tsv 34699 SRR7172088.se.tsv 87100 total ==> SRR7172088.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.85 1168 49.2582 Potri.005G024800.1.v4.1 1035 794.848 221 20.8468 Potri.004G059700.1.v4.1 961 720.863 26 2.70428 Potri.007G009000.2.v4.1 1416 1175.85 0 0 Potri.003G141000.2.v4.1 2943 2702.85 451.2 12.5164 Potri.016G087400.1.v4.1 270 78.4246 767 733.287 Potri.015G069301.1.v4.1 564 327.215 0 0 Potri.010G195200.1.v4.1 1773 1532.85 335 16.3861 Potri.012G127500.1.v4.1 977 736.863 4655 473.657 ==> SRR7172088.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 24 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 422 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 317 SRR7172088 completed mapping pipeline successfully