Starting /dee2/code/volunteer_pipeline.sh SRR7172089 current disk space = 3110862680064 free memory = 1569234288 SRR7172089 SRAfilesize 6ee31561653d903071efbe19b09494d4 SRR7172089.sra SRR7172089.sra file validated SRR7172089 is paired end SRR7172089 is conventional basespace SRR7172089 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172089_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9265 33.0 33.0 34.0 32.0 34.0 2 33.2755 34.0 33.0 34.0 33.0 34.0 3 33.084 34.0 33.0 34.0 32.0 34.0 4 33.15125 34.0 33.0 34.0 32.0 34.0 5 33.19775 34.0 33.0 34.0 33.0 34.0 6 37.009 38.0 37.0 38.0 36.0 38.0 7 37.37 38.0 38.0 38.0 37.0 38.0 8 37.46725 38.0 38.0 38.0 37.0 38.0 9 37.467 38.0 38.0 38.0 38.0 38.0 10-14 37.51285 38.0 38.0 38.0 38.0 38.0 15-19 37.480000000000004 38.0 38.0 38.0 37.8 38.0 20-24 37.461850000000005 38.0 38.0 38.0 37.4 38.0 25-29 37.42550000000001 38.0 38.0 38.0 37.2 38.0 30-34 37.296850000000006 38.0 38.0 38.0 37.0 38.0 35-39 37.27565 38.0 38.0 38.0 37.0 38.0 40-44 37.21634999999999 38.0 38.0 38.0 36.8 38.0 45-49 37.20954999999999 38.0 38.0 38.0 36.8 38.0 50-54 37.3148 38.0 38.0 38.0 37.0 38.0 55-59 37.27975 38.0 38.0 38.0 37.0 38.0 60-64 37.22985 38.0 38.0 38.0 36.8 38.0 65-69 37.2448 38.0 38.0 38.0 37.0 38.0 70-74 37.192800000000005 38.0 38.0 38.0 36.6 38.0 75-79 37.019349999999996 38.0 38.0 38.0 36.0 38.0 80-84 36.9662 38.0 38.0 38.0 36.0 38.0 85-89 36.87775 38.0 38.0 38.0 35.6 38.0 90-94 36.74335 38.0 38.0 38.0 34.8 38.0 95-99 36.69645 38.0 38.0 38.0 34.8 38.0 100-104 36.57795 38.0 38.0 38.0 34.2 38.0 105-109 36.55575 38.0 38.0 38.0 34.0 38.0 110-114 36.28144999999999 38.0 37.8 38.0 33.8 38.0 115-119 36.0972 38.0 37.2 38.0 33.4 38.0 120-124 35.8486 38.0 37.0 38.0 32.0 38.0 125-129 35.49195 38.0 36.6 38.0 31.0 38.0 130-134 35.4436 38.0 36.2 38.0 31.0 38.0 135-139 35.03465 38.0 36.0 38.0 29.2 38.0 140-144 34.388600000000004 38.0 34.4 38.0 26.4 38.0 145-149 33.8769 38.0 34.2 38.0 24.8 38.0 150-151 28.520125 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 2.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 2.0 18 1.0 19 1.0 20 5.0 21 3.0 22 7.0 23 5.0 24 5.0 25 10.0 26 19.0 27 27.0 28 23.0 29 29.0 30 46.0 31 48.0 32 75.0 33 110.0 34 157.0 35 236.0 36 648.0 37 2538.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.3 18.85 15.024999999999999 30.825000000000003 2 22.625 24.425 34.175 18.775 3 17.45 32.300000000000004 27.0 23.25 4 20.705176294073517 36.90922730682671 22.88072018004501 19.504876219054765 5 19.375 37.675 24.275 18.675 6 16.625 36.449999999999996 24.95 21.975 7 12.425 19.875 45.925 21.775 8 17.65 21.4 27.250000000000004 33.7 9 17.143574297188753 22.515060240963855 30.97389558232932 29.367469879518072 10-14 19.36096804840242 30.00650032501625 26.16630831541577 24.466223311165557 15-19 19.35 29.160000000000004 27.169999999999998 24.32 20-24 19.830000000000002 29.060000000000002 27.61 23.5 25-29 19.720986049302468 29.161458072903645 27.78138906945347 23.336166808340415 30-34 19.93 29.535 27.35 23.185 35-39 19.509999999999998 29.160000000000004 27.725 23.605 40-44 19.950997549877496 28.821441072053606 27.556377818890944 23.67118355917796 45-49 20.203030454568186 28.774316147422113 27.794169125368807 23.228484272640895 50-54 19.685 28.910000000000004 27.67 23.735 55-59 20.064999999999998 28.634999999999998 28.144999999999996 23.155 60-64 20.32 28.705000000000002 27.615000000000002 23.36 65-69 19.405 28.849999999999998 28.08 23.665 70-74 20.43 28.384999999999998 27.565 23.62 75-79 19.955000000000002 28.884999999999998 27.735 23.425 80-84 19.67 28.88 27.555000000000003 23.895 85-89 20.01200120012001 28.397839783978394 27.867786778677868 23.72237223722372 90-94 20.06 29.17 27.46 23.31 95-99 20.29 28.349999999999998 28.095 23.265 100-104 20.021001050052504 28.346417320866042 28.286414320716034 23.346167308365416 105-109 20.055 27.96 28.194999999999997 23.79 110-114 20.780131190225827 28.691602824094936 27.394722347403732 23.1335436382755 115-119 20.45 28.215 27.71 23.625 120-124 20.488317406314106 28.418472006804425 27.983189072897385 23.110021513984087 125-129 20.521547625006257 28.25466740077081 27.478852795435206 23.744932178787728 130-134 20.44 28.595 26.825 24.14 135-139 19.975 27.900000000000002 27.825 24.3 140-144 20.161008050402522 28.73143657182859 27.281364068203413 23.826191309565477 145-149 20.810000000000002 29.110000000000003 26.125 23.955000000000002 150-151 21.05 28.1 27.237499999999997 23.6125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 1.0 21 1.5 22 1.5 23 4.0 24 6.0 25 6.0 26 7.5 27 7.0 28 9.5 29 15.0 30 17.0 31 26.0 32 37.5 33 47.0 34 55.5 35 74.0 36 105.5 37 136.0 38 144.5 39 167.5 40 207.5 41 233.5 42 260.0 43 278.5 44 263.0 45 247.0 46 249.5 47 250.5 48 240.0 49 192.5 50 144.5 51 129.0 52 110.5 53 78.0 54 59.0 55 40.0 56 33.0 57 31.0 58 22.5 59 18.0 60 13.5 61 9.5 62 6.0 63 4.0 64 1.5 65 1.5 66 1.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.4 10-14 0.005 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.0 35-39 0.0 40-44 0.005 45-49 0.015 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.01 90-94 0.0 95-99 0.0 100-104 0.005 105-109 0.0 110-114 0.145 115-119 0.0 120-124 0.065 125-129 0.105 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.8375 0.0 0.0 0.0 0.0 110-111 0.975 0.0 0.0 0.0 0.0 112-113 1.2 0.0 0.0 0.0 0.0 114-115 1.4 0.0 0.0 0.0 0.0 116-117 1.475 0.0 0.0 0.0 0.0 118-119 1.6125 0.0 0.0 0.0 0.0 120-121 1.7125 0.0 0.0 0.0 0.0 122-123 1.9 0.0 0.0 0.0 0.0 124-125 2.075 0.0 0.0 0.0 0.0 126-127 2.3625 0.0 0.0 0.0 0.0 128-129 2.5375 0.0 0.0 0.0 0.0 130-131 2.8 0.0 0.0 0.0 0.0 132-133 3.1125 0.0 0.0 0.0 0.0 134-135 3.55 0.0 0.0 0.0 0.0 136-137 3.9250000000000003 0.0 0.0 0.0 0.0 138-139 4.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172089 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172089_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.87125 33.0 33.0 34.0 32.0 34.0 2 32.98 34.0 33.0 34.0 32.0 34.0 3 33.0345 34.0 33.0 34.0 32.0 34.0 4 32.99075 34.0 33.0 34.0 32.0 34.0 5 32.94525 34.0 33.0 34.0 33.0 34.0 6 36.8845 38.0 38.0 38.0 36.0 38.0 7 37.09375 38.0 38.0 38.0 37.0 38.0 8 37.127 38.0 38.0 38.0 37.0 38.0 9 36.9985 38.0 38.0 38.0 37.0 38.0 10-14 37.020599999999995 38.0 38.0 38.0 36.8 38.0 15-19 36.980999999999995 38.0 38.0 38.0 37.0 38.0 20-24 36.901700000000005 38.0 38.0 38.0 36.2 38.0 25-29 36.853300000000004 38.0 38.0 38.0 36.2 38.0 30-34 36.87845 38.0 38.0 38.0 36.6 38.0 35-39 36.834399999999995 38.0 38.0 38.0 36.2 38.0 40-44 36.67555 38.0 38.0 38.0 35.8 38.0 45-49 36.71660000000001 38.0 38.0 38.0 35.8 38.0 50-54 36.7746 38.0 38.0 38.0 36.2 38.0 55-59 36.7545 38.0 38.0 38.0 36.0 38.0 60-64 36.673 38.0 38.0 38.0 36.0 38.0 65-69 36.59165 38.0 38.0 38.0 35.4 38.0 70-74 36.580400000000004 38.0 38.0 38.0 35.6 38.0 75-79 36.52759999999999 38.0 38.0 38.0 35.4 38.0 80-84 36.428200000000004 38.0 38.0 38.0 34.8 38.0 85-89 36.305699999999995 38.0 38.0 38.0 34.2 38.0 90-94 36.1475 38.0 38.0 38.0 33.8 38.0 95-99 35.92144999999999 38.0 38.0 38.0 33.2 38.0 100-104 35.92995 38.0 38.0 38.0 33.4 38.0 105-109 35.76305000000001 38.0 38.0 38.0 33.0 38.0 110-114 35.61030000000001 38.0 37.0 38.0 31.4 38.0 115-119 35.49515 38.0 37.0 38.0 31.4 38.0 120-124 35.217999999999996 38.0 37.0 38.0 29.4 38.0 125-129 34.9463 38.0 36.0 38.0 28.8 38.0 130-134 34.5543 38.0 36.0 38.0 26.4 38.0 135-139 34.12285 38.0 35.4 38.0 24.4 38.0 140-144 33.404849999999996 38.0 33.4 38.0 19.0 38.0 145-149 32.763 38.0 33.0 38.0 11.8 38.0 150-151 27.810375 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 7.0 4 3.0 5 1.0 6 3.0 7 4.0 8 3.0 9 4.0 10 2.0 11 2.0 12 3.0 13 3.0 14 2.0 15 6.0 16 4.0 17 5.0 18 6.0 19 5.0 20 8.0 21 8.0 22 9.0 23 8.0 24 12.0 25 16.0 26 22.0 27 20.0 28 28.0 29 36.0 30 58.0 31 66.0 32 75.0 33 97.0 34 155.0 35 252.0 36 522.0 37 2529.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.083625438157235 15.6985478217326 14.972458688032047 30.24536805207812 2 24.58114528632158 22.755688922230558 33.93348337084271 18.72968242060515 3 19.979994998749685 26.6816704176044 31.807951987997 21.530382595648913 4 22.83070767691923 34.83370842710677 23.23080770192548 19.10477619404851 5 23.78094523630908 35.8589647411853 22.680670167541887 17.67941985496374 6 17.95448862215554 36.959239809952486 24.356089022255563 20.730182545636406 7 17.72943235808952 15.57889472368092 44.88622155538885 21.80545136284071 8 19.854963740935233 21.555388847211805 27.831957989497376 30.75768942235559 9 21.555388847211805 24.85621405351338 28.68217054263566 24.90622655663916 10-14 22.970742685671418 28.16704176044011 26.65166291572893 22.210552638159538 15-19 23.225806451612904 28.06201550387597 28.00700175043761 20.705176294073517 20-24 22.724544908981798 27.870574114822965 28.52070414082817 20.884176835367075 25-29 22.94614730736537 27.51137556877844 28.23141157057853 21.311065553277665 30-34 22.884999999999998 27.825 28.84 20.45 35-39 23.14 28.615000000000002 27.6 20.645 40-44 22.905 28.365000000000002 27.88 20.849999999999998 45-49 23.32 28.01 27.87 20.8 50-54 23.011150557527877 28.436421821091056 27.78638931946597 20.766038301915096 55-59 23.135783945986496 27.93198299574894 28.267066766691674 20.66516629157289 60-64 23.640910227556887 28.132033008252062 28.012003000750184 20.21505376344086 65-69 23.52588147036759 27.84196049012253 27.926981745436358 20.705176294073517 70-74 23.240810202550637 27.95198799699925 28.097024256064017 20.710177544386095 75-79 23.420855213803453 27.576894223555886 28.212053013253314 20.790197549387347 80-84 23.39584896224056 28.11202800700175 28.037009252313077 20.455113778444613 85-89 23.870967741935484 27.656914228557138 28.072018004501125 20.400100025006253 90-94 23.20080020005001 27.806951737934483 27.966991747936987 21.02525631407852 95-99 22.98344751712757 27.379106866029908 28.39425913887083 21.243186477971694 100-104 23.92119605980299 27.796389819490976 27.736386819340968 20.54602730136507 105-109 23.765 27.315 28.525 20.395 110-114 23.294999999999998 28.505000000000003 27.839999999999996 20.36 115-119 24.0886132919938 28.119217882682403 27.76916537480622 20.023003450517578 120-124 24.301075268817204 27.976994248562143 27.84196049012253 19.879969992498125 125-129 23.840960240060017 27.831957989497376 27.881970492623154 20.445111277819457 130-134 24.786196549137284 27.851962990747687 27.93198299574894 19.42985746436609 135-139 24.411102775693923 28.02700675168792 27.991997999499873 19.56989247311828 140-144 23.935983995999 28.06201550387597 27.73693423355839 20.26506626656664 145-149 24.357435743574356 28.5028502850285 27.317731773177318 19.82198219821982 150-151 24.675 28.775000000000002 27.037499999999998 19.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.5 23 2.0 24 1.0 25 2.0 26 5.5 27 7.0 28 8.0 29 8.5 30 9.5 31 16.5 32 19.5 33 24.5 34 44.0 35 66.5 36 86.5 37 110.5 38 136.5 39 171.5 40 199.0 41 226.5 42 261.0 43 271.0 44 281.5 45 287.0 46 260.0 47 234.0 48 233.0 49 221.5 50 185.0 51 151.5 52 115.0 53 90.5 54 72.5 55 47.0 56 37.5 57 31.5 58 23.5 59 14.0 60 6.0 61 6.0 62 6.0 63 3.5 64 2.5 65 3.0 66 3.0 67 1.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.025 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-14 0.025 15-19 0.025 20-24 0.02 25-29 0.005 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.005 55-59 0.025 60-64 0.025 65-69 0.025 70-74 0.025 75-79 0.025 80-84 0.025 85-89 0.025 90-94 0.025 95-99 0.015 100-104 0.005 105-109 0.0 110-114 0.0 115-119 0.015 120-124 0.025 125-129 0.025 130-134 0.025 135-139 0.025 140-144 0.025 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.7375 0.0 0.0 0.0 0.0 108-109 0.8375 0.0 0.0 0.0 0.0 110-111 0.975 0.0 0.0 0.0 0.0 112-113 1.2 0.0 0.0 0.0 0.0 114-115 1.4 0.0 0.0 0.0 0.0 116-117 1.475 0.0 0.0 0.0 0.0 118-119 1.6 0.0 0.0 0.0 0.0 120-121 1.6875 0.0 0.0 0.0 0.0 122-123 1.875 0.0 0.0 0.0 0.0 124-125 2.05 0.0 0.0 0.0 0.0 126-127 2.3499999999999996 0.0 0.0 0.0 0.0 128-129 2.5375 0.0 0.0 0.0 0.0 130-131 2.7875 0.0 0.0 0.0 0.0 132-133 3.0875 0.0 0.0 0.0 0.0 134-135 3.525 0.0 0.0 0.0 0.0 136-137 3.8875 0.0 0.0 0.0 0.0 138-139 4.237500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 965418 spots for SRR7172089.sra Written 965418 spots for SRR7172089.sra Read 965418 spots for SRR7172089.sra Written 965418 spots for SRR7172089.sra Read 965418 spots for SRR7172089.sra Written 965418 spots for SRR7172089.sra Read 965418 spots for SRR7172089.sra Written 965418 spots for SRR7172089.sra Read 965418 spots for SRR7172089.sra Written 965418 spots for SRR7172089.sra Read 965418 spots for SRR7172089.sra Written 965418 spots for SRR7172089.sra Read 965418 spots for SRR7172089.sra Written 965418 spots for SRR7172089.sra Read 965418 spots for SRR7172089.sra Written 965418 spots for SRR7172089.sra Read 965418 spots for SRR7172089.sra Written 965418 spots for SRR7172089.sra Read 965418 spots for SRR7172089.sra Written 965418 spots for SRR7172089.sra Read 965418 spots for SRR7172089.sra Written 965418 spots for SRR7172089.sra Read 965418 spots for SRR7172089.sra Written 965418 spots for SRR7172089.sra Read 965418 spots for SRR7172089.sra Written 965418 spots for SRR7172089.sra Read 965418 spots for SRR7172089.sra Written 965418 spots for SRR7172089.sra Read 965418 spots for SRR7172089.sra Written 965418 spots for SRR7172089.sra Read 965418 spots for SRR7172089.sra Written 965418 spots for SRR7172089.sra Read 965418 spots for SRR7172089.sra Written 965418 spots for SRR7172089.sra Read 965418 spots for SRR7172089.sra Written 965418 spots for SRR7172089.sra Read 965418 spots for SRR7172089.sra Written 965418 spots for SRR7172089.sra Read 965418 spots for SRR7172089.sra Written 965418 spots for SRR7172089.sra SRR ids: ['SRR7172089.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d0roap9c SRR7172089.sra spots: 19308360 blocks: [[1, 965418], [965419, 1930836], [1930837, 2896254], [2896255, 3861672], [3861673, 4827090], [4827091, 5792508], [5792509, 6757926], [6757927, 7723344], [7723345, 8688762], [8688763, 9654180], [9654181, 10619598], [10619599, 11585016], [11585017, 12550434], [12550435, 13515852], [13515853, 14481270], [14481271, 15446688], [15446689, 16412106], [16412107, 17377524], [17377525, 18342942], [18342943, 19308360]] SRR7172089 file size 6521269 SRR7172089 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172089 SRR7172089_1.fastq SRR7172089_2.fastq Input file: SRR7172089_1.fastq Paired file: SRR7172089_2.fastq trimmed: SRR7172089-trimmed-pair1.fastq, SRR7172089-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 18:01:38 2025 >> started Fri Feb 14 18:02:00 2025 >> done (21.609s) 19308360 read pairs processed; of these: 23711 ( 0.12%) short read pairs filtered out after trimming by size control 15712 ( 0.08%) empty read pairs filtered out after trimming by size control 19268937 (99.80%) read pairs available; of these: 10854376 (56.33%) trimmed read pairs available after processing 8414561 (43.67%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 3 0.00% 21 10 0.00% 22 13 0.00% 23 5 0.00% 24 10 0.00% 25 9 0.00% 26 5 0.00% 27 13 0.00% 28 10 0.00% 29 12 0.00% 30 7 0.00% 31 11 0.00% 32 7 0.00% 33 11 0.00% 34 9 0.00% 35 23 0.00% 36 10 0.00% 37 13 0.00% 38 5 0.00% 39 14 0.00% 40 13 0.00% 41 10 0.00% 42 8 0.00% 43 11 0.00% 44 20 0.00% 45 16 0.00% 46 23 0.00% 47 17 0.00% 48 18 0.00% 49 31 0.00% 50 26 0.00% 51 28 0.00% 52 30 0.00% 53 31 0.00% 54 59 0.00% 55 49 0.00% 56 57 0.00% 57 79 0.00% 58 193 0.00% 59 382 0.00% 60 225 0.00% 61 167 0.00% 62 120 0.00% 63 134 0.00% 64 145 0.00% 65 159 0.00% 66 200 0.00% 67 214 0.00% 68 247 0.00% 69 252 0.00% 70 301 0.00% 71 326 0.00% 72 422 0.00% 73 480 0.00% 74 538 0.00% 75 624 0.00% 76 759 0.00% 77 852 0.00% 78 1107 0.01% 79 1275 0.01% 80 1367 0.01% 81 1515 0.01% 82 1882 0.01% 83 3088 0.02% 84 5039 0.03% 85 5708 0.03% 86 5425 0.03% 87 5981 0.03% 88 5925 0.03% 89 5613 0.03% 90 5500 0.03% 91 5937 0.03% 92 6058 0.03% 93 6588 0.03% 94 6950 0.04% 95 7513 0.04% 96 8122 0.04% 97 8435 0.04% 98 9009 0.05% 99 10119 0.05% 100 11600 0.06% 101 11610 0.06% 102 12152 0.06% 103 13162 0.07% 104 13579 0.07% 105 14588 0.08% 106 15374 0.08% 107 16071 0.08% 108 17035 0.09% 109 18091 0.09% 110 18849 0.10% 111 20280 0.11% 112 21320 0.11% 113 22813 0.12% 114 24092 0.13% 115 25372 0.13% 116 27153 0.14% 117 28556 0.15% 118 30053 0.16% 119 31843 0.17% 120 33384 0.17% 121 35289 0.18% 122 37511 0.19% 123 39750 0.21% 124 42107 0.22% 125 44990 0.23% 126 47649 0.25% 127 50773 0.26% 128 53665 0.28% 129 55926 0.29% 130 59206 0.31% 131 62295 0.32% 132 66048 0.34% 133 69218 0.36% 134 73859 0.38% 135 78753 0.41% 136 84256 0.44% 137 88420 0.46% 138 95044 0.49% 139 104397 0.54% 140 118109 0.61% 141 127554 0.66% 142 144544 0.75% 143 166992 0.87% 144 196932 1.02% 145 231707 1.20% 146 300170 1.56% 147 414106 2.15% 148 610050 3.17% 149 1226402 6.36% 150 5576050 28.94% 151 8414561 43.67% 19268937 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=3.10 fanout-score-rank=23 prefix-density=0.26 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACCAGAGTTCATCTCAGACC criterion=fanout-score sequence-density=0.09 sequence-density-rank=15 fanout-score=393.18 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=36.4 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.84 fanout-score-rank=27 prefix-density=0.28 prefix-fanout=2.7 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=25 fanout-score=117.51 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=22.7 sequence=GAAGAAGAGAGG SRR7172089 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 18:03:46 Started mapping on | Feb 14 18:03:50 Finished on | Feb 14 18:06:09 Mapping speed, Million of reads per hour | 499.05 Number of input reads | 19268937 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 17198031 Uniquely mapped reads % | 89.25% Average mapped length | 289.99 Number of splices: Total | 17087650 Number of splices: Annotated (sjdb) | 16797286 Number of splices: GT/AG | 16808834 Number of splices: GC/AG | 218484 Number of splices: AT/AC | 13024 Number of splices: Non-canonical | 47308 Mismatch rate per base, % | 0.49% Deletion rate per base | 0.04% Deletion average length | 2.31 Insertion rate per base | 0.03% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 575370 % of reads mapped to multiple loci | 2.99% Number of reads mapped to too many loci | 54666 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.36% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1516566 1516566 1516566 N_multimapping 575370 575370 575370 N_noFeature 428370 17038475 499628 N_ambiguous 234293 1594 145093 UnstrandedReadsAssigned:16535368 PositiveStrandReadsAssigned:157962 NegativeStrandReadsAssigned:16553310 Dataset is classified negative stranded MeadianReadLen=147 20thPercentileLength=146 echo kmer=141 SRR7172089 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172089-trimmed-pair1.fastq SRR7172089-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,268,937 reads, 17,234,621 reads pseudoaligned [quant] estimated average fragment length: 249.64 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,136 rounds 52401 SRR7172089.ke.tsv 34699 SRR7172089.se.tsv 87100 total ==> SRR7172089.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1769.36 1424 43.8607 Potri.005G024800.1.v4.1 1035 786.36 463 32.0879 Potri.004G059700.1.v4.1 961 712.375 66 5.04913 Potri.007G009000.2.v4.1 1416 1167.36 0 0 Potri.003G141000.2.v4.1 2943 2694.36 587.139 11.8759 Potri.016G087400.1.v4.1 270 78.4489 1464 1017.03 Potri.015G069301.1.v4.1 564 321.174 0 0 Potri.010G195200.1.v4.1 1773 1524.36 459 16.4099 Potri.012G127500.1.v4.1 977 728.365 6425 480.735 ==> SRR7172089.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 23 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 432 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 331 Potri.001G452600.v4.1 287 SRR7172089 completed mapping pipeline successfully