Starting /dee2/code/volunteer_pipeline.sh SRR7172090 current disk space = 3111125983232 free memory = 1568103440 SRR7172090 SRAfilesize e3e76b253a6d70a4c4a092ea638ab4f2 SRR7172090.sra SRR7172090.sra file validated SRR7172090 is paired end SRR7172090 is conventional basespace SRR7172090 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172090_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.7935 32.0 18.0 33.0 18.0 34.0 2 30.53425 31.0 29.0 33.0 27.0 34.0 3 31.09775 33.0 31.0 33.0 28.0 33.0 4 32.14125 33.0 33.0 33.0 31.0 33.0 5 32.826 33.0 33.0 33.0 32.0 34.0 6 36.4725 38.0 37.0 38.0 34.0 38.0 7 37.3665 38.0 38.0 38.0 37.0 38.0 8 37.466 38.0 38.0 38.0 37.0 38.0 9 37.56975 38.0 38.0 38.0 38.0 38.0 10-14 37.528299999999994 38.0 38.0 38.0 38.0 38.0 15-19 37.54215000000001 38.0 38.0 38.0 38.0 38.0 20-24 37.5548 38.0 38.0 38.0 38.0 38.0 25-29 37.45395 38.0 38.0 38.0 37.8 38.0 30-34 37.44385 38.0 38.0 38.0 37.8 38.0 35-39 37.3948 38.0 38.0 38.0 37.4 38.0 40-44 37.27435 38.0 38.0 38.0 37.0 38.0 45-49 37.327349999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.2808 38.0 38.0 38.0 37.0 38.0 55-59 37.3198 38.0 38.0 38.0 37.0 38.0 60-64 37.363350000000004 38.0 38.0 38.0 37.0 38.0 65-69 37.263999999999996 38.0 38.0 38.0 37.0 38.0 70-74 37.210449999999994 38.0 38.0 38.0 37.0 38.0 75-79 37.17605 38.0 38.0 38.0 37.0 38.0 80-84 37.05945 38.0 38.0 38.0 36.2 38.0 85-89 36.9597 38.0 38.0 38.0 36.0 38.0 90-94 36.86535 38.0 38.0 38.0 36.0 38.0 95-99 36.7803 38.0 38.0 38.0 35.6 38.0 100-104 36.6405 38.0 38.0 38.0 35.0 38.0 105-109 36.73845 38.0 38.0 38.0 35.0 38.0 110-114 36.36965 38.0 38.0 38.0 34.2 38.0 115-119 35.8749 38.0 37.2 38.0 31.6 38.0 120-124 36.2471 38.0 38.0 38.0 33.8 38.0 125-129 35.76519999999999 38.0 37.0 38.0 32.4 38.0 130-134 35.6819 38.0 36.8 38.0 31.4 38.0 135-139 35.5332 38.0 36.4 38.0 31.0 38.0 140-144 35.05800000000001 38.0 36.0 38.0 30.6 38.0 145-149 34.6406 38.0 36.0 38.0 29.2 38.0 150-151 30.152124999999998 35.5 28.0 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 3.0 8 0.0 9 0.0 10 2.0 11 1.0 12 2.0 13 3.0 14 2.0 15 1.0 16 1.0 17 0.0 18 2.0 19 3.0 20 4.0 21 1.0 22 6.0 23 3.0 24 5.0 25 12.0 26 11.0 27 13.0 28 19.0 29 27.0 30 32.0 31 53.0 32 54.0 33 76.0 34 131.0 35 233.0 36 635.0 37 2664.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.924999999999997 17.5 14.549999999999999 36.025 2 18.675 23.400000000000002 37.65 20.275000000000002 3 18.4 30.075000000000003 26.924999999999997 24.6 4 21.025 36.7 22.125 20.150000000000002 5 19.725 38.375 23.175 18.725 6 16.25 37.05 25.025 21.675 7 12.125 21.6 46.075 20.200000000000003 8 16.875 22.6 29.2 31.324999999999996 9 17.25 23.575 31.424999999999997 27.750000000000004 10-14 18.441597437693925 31.708537683915523 26.38374537083375 23.4661195075568 15-19 19.155 30.39 27.165 23.29 20-24 19.335 29.535 27.175 23.955000000000002 25-29 19.906990699069908 29.692969296929693 27.682768276827684 22.717271727172715 30-34 19.462919437915687 29.379406911036654 27.349102365354806 23.808571285692853 35-39 18.96042823552954 30.151583370853967 27.685226874781126 23.20276151883536 40-44 19.448751938372265 29.718373267970588 27.64243909759392 23.190435696063226 45-49 19.820946283885167 29.61888566569971 27.433229968990698 23.126938081424427 50-54 19.555977798889945 29.816490824541226 27.69638481924096 22.931146557327867 55-59 19.675 29.205 28.32 22.8 60-64 19.025 29.375 27.925 23.674999999999997 65-69 19.77 28.975 27.689999999999998 23.565 70-74 19.52695269526953 29.157915791579157 27.792779277927792 23.522352235223522 75-79 19.75 28.95 27.76 23.54 80-84 19.717887154861945 28.361344537815125 28.0062024809924 23.914565826330534 85-89 20.14914168460037 29.217756869025575 27.666282968820376 22.966818477553677 90-94 20.0450337753315 29.056792594445835 27.09532149111834 23.802852139104328 95-99 19.966996699669966 28.477847784778476 27.697769776977697 23.857385738573857 100-104 20.236070821246376 28.808642592777833 27.30319095728719 23.652095628688606 105-109 19.771977197719774 28.392839283928396 28.052805280528055 23.78237823782378 110-114 20.274000100366337 28.39363677422592 27.354845184924976 23.977517940482763 115-119 20.067124179732502 28.698091469218053 27.555978560336627 23.67880579071282 120-124 19.827931172468986 28.86154461784714 27.651060424169664 23.659463785514205 125-129 21.113003406131035 28.330995792426368 26.853336004808654 23.70266479663394 130-134 20.15201520152015 28.742874287428744 27.672767276727672 23.432343234323433 135-139 20.482048204820483 28.83788378837884 27.142714271427142 23.537353735373536 140-144 20.741593274619696 28.482786228983187 26.901521216973578 23.87409927942354 145-149 20.636668501927026 28.870313829521 26.683017168026428 23.810000500525554 150-151 21.2625 28.812500000000004 26.2625 23.6625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.5 11 0.5 12 0.5 13 1.0 14 0.5 15 0.0 16 0.5 17 1.0 18 1.0 19 1.0 20 1.0 21 1.5 22 1.0 23 1.0 24 3.0 25 3.0 26 6.0 27 11.0 28 12.5 29 12.0 30 25.5 31 41.5 32 48.5 33 61.5 34 82.5 35 105.5 36 127.0 37 143.0 38 157.5 39 179.5 40 196.5 41 228.0 42 255.5 43 252.5 44 262.0 45 264.0 46 244.0 47 218.5 48 197.0 49 187.5 50 163.5 51 126.0 52 90.0 53 65.5 54 48.5 55 36.0 56 30.0 57 24.0 58 19.5 59 15.5 60 9.5 61 6.5 62 6.0 63 4.0 64 2.0 65 2.0 66 3.0 67 3.5 68 3.0 69 1.5 70 0.5 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.09 15-19 0.0 20-24 0.0 25-29 0.01 30-34 0.015 35-39 0.055 40-44 0.045 45-49 0.03 50-54 0.005 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.01 75-79 0.0 80-84 0.04 85-89 0.095 90-94 0.075 95-99 0.01 100-104 0.03 105-109 0.01 110-114 0.365 115-119 0.185 120-124 0.04 125-129 0.18 130-134 0.01 135-139 0.01 140-144 0.08 145-149 0.105 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11727616645649 98.25 2 0.8827238335435058 1.7500000000000002 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.5375000000000001 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.7250000000000001 0.0 0.0 0.0 0.0 106-107 0.85 0.0 0.0 0.0 0.0 108-109 0.95 0.0 0.0 0.0 0.0 110-111 1.0750000000000002 0.0 0.0 0.0 0.0 112-113 1.2125 0.0 0.0 0.0 0.0 114-115 1.4375 0.0 0.0 0.0 0.0 116-117 1.775 0.0 0.0 0.0 0.0 118-119 1.9874999999999998 0.0 0.0 0.0 0.0 120-121 2.2625 0.0 0.0 0.0 0.0 122-123 2.425 0.0 0.0 0.0 0.0 124-125 2.7 0.0 0.0 0.0 0.0 126-127 3.0875000000000004 0.0 0.0 0.0 0.0 128-129 3.5 0.0 0.0 0.0 0.0 130-131 3.8 0.0 0.0 0.0 0.0 132-133 4.225 0.0 0.0 0.0 0.0 134-135 4.6875 0.0 0.0 0.0 0.0 136-137 5.1875 0.0 0.0 0.0 0.0 138-139 5.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172090 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172090_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.02475 33.0 33.0 34.0 32.0 34.0 2 33.07925 34.0 33.0 34.0 33.0 34.0 3 33.0835 34.0 33.0 34.0 33.0 34.0 4 33.02625 34.0 33.0 34.0 33.0 34.0 5 32.96525 34.0 33.0 34.0 32.0 34.0 6 37.15325 38.0 38.0 38.0 37.0 38.0 7 37.19825 38.0 38.0 38.0 37.0 38.0 8 37.117 38.0 38.0 38.0 38.0 38.0 9 37.17 38.0 38.0 38.0 38.0 38.0 10-14 37.17415 38.0 38.0 38.0 37.8 38.0 15-19 37.10625 38.0 38.0 38.0 37.2 38.0 20-24 37.0087 38.0 38.0 38.0 37.0 38.0 25-29 37.05315 38.0 38.0 38.0 37.0 38.0 30-34 37.102149999999995 38.0 38.0 38.0 37.0 38.0 35-39 37.02035 38.0 38.0 38.0 37.0 38.0 40-44 36.955600000000004 38.0 38.0 38.0 36.8 38.0 45-49 36.9966 38.0 38.0 38.0 37.0 38.0 50-54 36.99015 38.0 38.0 38.0 37.0 38.0 55-59 36.9276 38.0 38.0 38.0 37.0 38.0 60-64 36.943000000000005 38.0 38.0 38.0 36.8 38.0 65-69 36.88745 38.0 38.0 38.0 36.6 38.0 70-74 36.90505 38.0 38.0 38.0 36.6 38.0 75-79 36.800599999999996 38.0 38.0 38.0 36.0 38.0 80-84 36.71425000000001 38.0 38.0 38.0 36.0 38.0 85-89 36.5995 38.0 38.0 38.0 35.6 38.0 90-94 36.4427 38.0 38.0 38.0 34.6 38.0 95-99 36.3364 38.0 38.0 38.0 34.2 38.0 100-104 36.246950000000005 38.0 38.0 38.0 34.0 38.0 105-109 36.2661 38.0 38.0 38.0 34.0 38.0 110-114 36.0769 38.0 38.0 38.0 34.0 38.0 115-119 36.0131 38.0 38.0 38.0 33.6 38.0 120-124 35.853750000000005 38.0 38.0 38.0 32.2 38.0 125-129 35.48855 38.0 37.0 38.0 31.0 38.0 130-134 35.1299 38.0 36.4 38.0 29.8 38.0 135-139 34.7096 38.0 36.0 38.0 28.0 38.0 140-144 34.259249999999994 38.0 35.8 38.0 25.8 38.0 145-149 33.379099999999994 38.0 33.6 38.0 17.8 38.0 150-151 27.761875 34.0 17.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 11.0 4 2.0 5 3.0 6 1.0 7 0.0 8 1.0 9 1.0 10 2.0 11 1.0 12 3.0 13 1.0 14 5.0 15 0.0 16 3.0 17 2.0 18 8.0 19 6.0 20 5.0 21 2.0 22 9.0 23 5.0 24 8.0 25 16.0 26 18.0 27 17.0 28 31.0 29 26.0 30 34.0 31 44.0 32 75.0 33 78.0 34 114.0 35 244.0 36 507.0 37 2704.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.96848424212106 15.307653826913455 18.459229614807406 29.264632316158078 2 24.993745308981737 21.51613710282712 36.82762071553665 16.662496872654494 3 21.766324743557668 26.169627220415308 31.448586439829874 20.61546159619715 4 24.3175557225144 35.41197094916103 21.061858251940897 19.208615076383673 5 23.89181066867017 36.83946907087403 21.337340345604808 17.93137991485099 6 19.448621553884713 36.365914786967416 24.110275689223055 20.075187969924812 7 19.78931527464259 16.002006521193877 43.566591422121896 20.642086782041634 8 21.228070175438596 22.63157894736842 27.21804511278195 28.92230576441103 9 22.431077694235587 23.659147869674186 28.82205513784461 25.087719298245613 10-14 23.880148311454054 28.4848181180479 25.979557069846678 21.655476500651368 15-19 23.387622149837135 28.06815334502631 27.717364069155597 20.826860435980958 20-24 23.290416311808027 28.836230649767046 27.157958018135364 20.715395020289566 25-29 23.156578289144573 28.62431215607804 27.218609304652325 21.00050025012506 30-34 23.61 27.765 27.615000000000002 21.01 35-39 23.185 28.425 27.77 20.62 40-44 23.35 28.084999999999997 28.01 20.555 45-49 23.234293717486995 27.77611044417767 28.061224489795915 20.928371348539414 50-54 23.53 28.095 27.43 20.945 55-59 23.39 28.285 27.525 20.8 60-64 23.835 27.985 27.750000000000004 20.43 65-69 23.565 28.01 27.845 20.580000000000002 70-74 23.965 27.185 28.23 20.62 75-79 23.435 27.985 27.77 20.810000000000002 80-84 23.405 28.12 28.189999999999998 20.285 85-89 23.895 27.915 27.775 20.415 90-94 23.119999999999997 28.205000000000002 28.665000000000003 20.01 95-99 24.09 28.03 27.68 20.200000000000003 100-104 23.315 27.975 28.165000000000003 20.544999999999998 105-109 23.525 27.79 28.455000000000002 20.23 110-114 24.075 27.994999999999997 28.33 19.6 115-119 24.185000000000002 27.700000000000003 28.49 19.625 120-124 24.03 28.000000000000004 28.335 19.634999999999998 125-129 23.849999999999998 27.505000000000003 28.965000000000003 19.68 130-134 24.884999999999998 27.555000000000003 27.92 19.64 135-139 23.895 27.985 28.050000000000004 20.07 140-144 24.565 27.82 28.38 19.235 145-149 25.115 27.529999999999998 28.34 19.015 150-151 25.8 26.775 28.5625 18.862499999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.5 21 1.0 22 1.5 23 1.0 24 0.0 25 0.0 26 1.0 27 4.0 28 5.5 29 4.0 30 8.0 31 17.5 32 23.5 33 32.5 34 44.0 35 54.5 36 71.5 37 101.0 38 128.5 39 147.0 40 184.0 41 230.0 42 272.5 43 288.5 44 294.5 45 318.5 46 295.0 47 251.5 48 240.0 49 213.5 50 171.5 51 146.5 52 121.5 53 84.5 54 55.0 55 40.0 56 33.5 57 25.5 58 20.0 59 15.5 60 9.5 61 11.0 62 10.0 63 6.0 64 4.5 65 2.5 66 1.0 67 1.0 68 1.0 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.075 3 0.075 4 0.17500000000000002 5 0.17500000000000002 6 0.25 7 0.325 8 0.25 9 0.25 10-14 0.21 15-19 0.22499999999999998 20-24 0.19499999999999998 25-29 0.05 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.04 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.0911386013633 98.125 2 0.8331229487503155 1.6500000000000001 3 0.07573844988639232 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.425 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.825 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 1.0875 0.0 0.0 0.0 0.0 112-113 1.2000000000000002 0.0 0.0 0.0 0.0 114-115 1.4125 0.0 0.0 0.0 0.0 116-117 1.75 0.0 0.0 0.0 0.0 118-119 1.9375 0.0 0.0 0.0 0.0 120-121 2.2125 0.0 0.0 0.0 0.0 122-123 2.375 0.0 0.0 0.0 0.0 124-125 2.6500000000000004 0.0 0.0 0.0 0.0 126-127 3.0625 0.0 0.0 0.0 0.0 128-129 3.4749999999999996 0.0 0.0 0.0 0.0 130-131 3.7875 0.0 0.0 0.0 0.0 132-133 4.225 0.0 0.0 0.0 0.0 134-135 4.699999999999999 0.0 0.0 0.0 0.0 136-137 5.2125 0.0 0.0 0.0 0.0 138-139 5.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 636639 spots for SRR7172090.sra Written 636639 spots for SRR7172090.sra Read 636639 spots for SRR7172090.sra Written 636639 spots for SRR7172090.sra Read 636639 spots for SRR7172090.sra Written 636639 spots for SRR7172090.sra Read 636639 spots for SRR7172090.sra Written 636639 spots for SRR7172090.sra Read 636639 spots for SRR7172090.sra Written 636639 spots for SRR7172090.sra Read 636639 spots for SRR7172090.sra Written 636639 spots for SRR7172090.sra Read 636639 spots for SRR7172090.sra Written 636639 spots for SRR7172090.sra Read 636639 spots for SRR7172090.sra Written 636639 spots for SRR7172090.sra Read 636639 spots for SRR7172090.sra Written 636639 spots for SRR7172090.sra Read 636639 spots for SRR7172090.sra Written 636639 spots for SRR7172090.sra Read 636639 spots for SRR7172090.sra Written 636639 spots for SRR7172090.sra Read 636639 spots for SRR7172090.sra Written 636639 spots for SRR7172090.sra Read 636658 spots for SRR7172090.sra Written 636658 spots for SRR7172090.sra Read 636639 spots for SRR7172090.sra Written 636639 spots for SRR7172090.sra Read 636639 spots for SRR7172090.sra Written 636639 spots for SRR7172090.sra Read 636639 spots for SRR7172090.sra Written 636639 spots for SRR7172090.sra Read 636639 spots for SRR7172090.sra Written 636639 spots for SRR7172090.sra Read 636639 spots for SRR7172090.sra Written 636639 spots for SRR7172090.sra Read 636639 spots for SRR7172090.sra Written 636639 spots for SRR7172090.sra Read 636639 spots for SRR7172090.sra Written 636639 spots for SRR7172090.sra SRR ids: ['SRR7172090.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wr37nqp_ SRR7172090.sra spots: 12732799 blocks: [[1, 636639], [636640, 1273278], [1273279, 1909917], [1909918, 2546556], [2546557, 3183195], [3183196, 3819834], [3819835, 4456473], [4456474, 5093112], [5093113, 5729751], [5729752, 6366390], [6366391, 7003029], [7003030, 7639668], [7639669, 8276307], [8276308, 8912946], [8912947, 9549585], [9549586, 10186224], [10186225, 10822863], [10822864, 11459502], [11459503, 12096141], [12096142, 12732799]] SRR7172090 file size 4293027 SRR7172090 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172090 SRR7172090_1.fastq SRR7172090_2.fastq Input file: SRR7172090_1.fastq Paired file: SRR7172090_2.fastq trimmed: SRR7172090-trimmed-pair1.fastq, SRR7172090-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 17:45:49 2025 >> started Fri Feb 14 17:46:10 2025 >> done (20.682s) 12732799 read pairs processed; of these: 16498 ( 0.13%) short read pairs filtered out after trimming by size control 11502 ( 0.09%) empty read pairs filtered out after trimming by size control 12704799 (99.78%) read pairs available; of these: 6662257 (52.44%) trimmed read pairs available after processing 6042542 (47.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 6 0.00% 21 10 0.00% 22 10 0.00% 23 21 0.00% 24 6 0.00% 25 12 0.00% 26 7 0.00% 27 11 0.00% 28 8 0.00% 29 8 0.00% 30 9 0.00% 31 9 0.00% 32 10 0.00% 33 10 0.00% 34 11 0.00% 35 8 0.00% 36 6 0.00% 37 8 0.00% 38 8 0.00% 39 14 0.00% 40 7 0.00% 41 13 0.00% 42 13 0.00% 43 10 0.00% 44 14 0.00% 45 13 0.00% 46 9 0.00% 47 9 0.00% 48 19 0.00% 49 18 0.00% 50 27 0.00% 51 34 0.00% 52 19 0.00% 53 33 0.00% 54 35 0.00% 55 48 0.00% 56 57 0.00% 57 45 0.00% 58 66 0.00% 59 64 0.00% 60 90 0.00% 61 109 0.00% 62 93 0.00% 63 123 0.00% 64 146 0.00% 65 170 0.00% 66 155 0.00% 67 248 0.00% 68 223 0.00% 69 267 0.00% 70 310 0.00% 71 337 0.00% 72 364 0.00% 73 480 0.00% 74 582 0.00% 75 592 0.00% 76 720 0.01% 77 880 0.01% 78 965 0.01% 79 1091 0.01% 80 1199 0.01% 81 1350 0.01% 82 1643 0.01% 83 1989 0.02% 84 2954 0.02% 85 3879 0.03% 86 4248 0.03% 87 4527 0.04% 88 4852 0.04% 89 4958 0.04% 90 5090 0.04% 91 5247 0.04% 92 5658 0.04% 93 5914 0.05% 94 6429 0.05% 95 6971 0.05% 96 7537 0.06% 97 8144 0.06% 98 8347 0.07% 99 8889 0.07% 100 9750 0.08% 101 10512 0.08% 102 11053 0.09% 103 11705 0.09% 104 12433 0.10% 105 13435 0.11% 106 14354 0.11% 107 14960 0.12% 108 15581 0.12% 109 16370 0.13% 110 17294 0.14% 111 17829 0.14% 112 18918 0.15% 113 19609 0.15% 114 20504 0.16% 115 21675 0.17% 116 22930 0.18% 117 23643 0.19% 118 24893 0.20% 119 26056 0.21% 120 26596 0.21% 121 28010 0.22% 122 29355 0.23% 123 30578 0.24% 124 31721 0.25% 125 33367 0.26% 126 34611 0.27% 127 35991 0.28% 128 37435 0.29% 129 39433 0.31% 130 40645 0.32% 131 42757 0.34% 132 44770 0.35% 133 47755 0.38% 134 50382 0.40% 135 54133 0.43% 136 58447 0.46% 137 60128 0.47% 138 63426 0.50% 139 68751 0.54% 140 71904 0.57% 141 77269 0.61% 142 84962 0.67% 143 93723 0.74% 144 107390 0.85% 145 126561 1.00% 146 154742 1.22% 147 209041 1.65% 148 315946 2.49% 149 629477 4.95% 150 3480928 27.40% 151 6042542 47.56% 12704799 reads passed initial QC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.89 fanout-score-rank=26 prefix-density=0.86 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=304.68 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=21.6 sequence=AAACAGAAACTAATTAAGCATTTTCATTAATAATCATCAACTCCACATAGTTCAAGTTTCCAAGCATACATGAAAACACCTTGAAAGTTGAAGCAGCCAACAAAGCAG criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=17 prefix-density=0.80 prefix-fanout=2.4 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=105.42 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=6.4 sequence=TTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATA SRR7172090 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 17:47:52 Started mapping on | Feb 14 17:47:52 Finished on | Feb 14 17:49:30 Mapping speed, Million of reads per hour | 466.71 Number of input reads | 12704799 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 11772934 Uniquely mapped reads % | 92.67% Average mapped length | 293.70 Number of splices: Total | 10386201 Number of splices: Annotated (sjdb) | 10179165 Number of splices: GT/AG | 10213927 Number of splices: GC/AG | 132816 Number of splices: AT/AC | 8755 Number of splices: Non-canonical | 30703 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.04% Deletion average length | 2.44 Insertion rate per base | 0.03% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 371185 % of reads mapped to multiple loci | 2.92% Number of reads mapped to too many loci | 52464 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.88% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 579371 579371 579371 N_multimapping 371185 371185 371185 N_noFeature 278566 11630440 327048 N_ambiguous 150754 656 56572 UnstrandedReadsAssigned:11343614 PositiveStrandReadsAssigned:141838 NegativeStrandReadsAssigned:11389314 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172090 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172090-trimmed-pair1.fastq SRR7172090-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,704,799 reads, 11,331,280 reads pseudoaligned [quant] estimated average fragment length: 234.117 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,112 rounds 52401 SRR7172090.ke.tsv 34699 SRR7172090.se.tsv 87100 total ==> SRR7172090.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.88 1050 42.2257 Potri.005G024800.1.v4.1 1035 801.883 448 40.1018 Potri.004G059700.1.v4.1 961 727.898 18 1.775 Potri.007G009000.2.v4.1 1416 1182.88 0 0 Potri.003G141000.2.v4.1 2943 2709.88 484 12.8201 Potri.016G087400.1.v4.1 270 81.6447 895 786.85 Potri.015G069301.1.v4.1 564 333.919 0 0 Potri.010G195200.1.v4.1 1773 1539.88 517 24.099 Potri.012G127500.1.v4.1 977 743.893 4106 396.192 ==> SRR7172090.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 49 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 823 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 476 SRR7172090 completed mapping pipeline successfully