Starting /dee2/code/volunteer_pipeline.sh SRR7172091 current disk space = 3087624192000 free memory = 1449473756 SRR7172091 SRAfilesize 2b7f6d7767140bfde166000e27bfd42f SRR7172091.sra SRR7172091.sra file validated SRR7172091 is paired end SRR7172091 is conventional basespace SRR7172091 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172091_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4365 33.0 33.0 34.0 31.0 34.0 2 32.24025 33.0 32.0 34.0 28.0 34.0 3 31.97975 33.0 31.0 33.0 29.0 34.0 4 32.293 33.0 33.0 33.0 31.0 34.0 5 32.961 33.0 33.0 34.0 33.0 34.0 6 36.479 38.0 37.0 38.0 34.0 38.0 7 37.05375 38.0 38.0 38.0 36.0 38.0 8 37.16575 38.0 38.0 38.0 36.0 38.0 9 37.39675 38.0 38.0 38.0 37.0 38.0 10-14 37.46235 38.0 38.0 38.0 37.0 38.0 15-19 37.41755 38.0 38.0 38.0 37.0 38.0 20-24 37.412049999999994 38.0 38.0 38.0 37.0 38.0 25-29 37.391949999999994 38.0 38.0 38.0 37.0 38.0 30-34 37.38875 38.0 38.0 38.0 37.0 38.0 35-39 37.34565 38.0 38.0 38.0 37.0 38.0 40-44 37.27505 38.0 38.0 38.0 36.6 38.0 45-49 37.2299 38.0 38.0 38.0 36.2 38.0 50-54 37.1188 38.0 38.0 38.0 36.0 38.0 55-59 37.0125 38.0 38.0 38.0 36.0 38.0 60-64 36.93085 38.0 38.0 38.0 35.2 38.0 65-69 36.86725 38.0 38.0 38.0 35.2 38.0 70-74 36.778299999999994 38.0 38.0 38.0 34.8 38.0 75-79 36.7001 38.0 38.0 38.0 34.4 38.0 80-84 36.6534 38.0 38.0 38.0 34.0 38.0 85-89 36.43 38.0 37.0 38.0 34.0 38.0 90-94 36.3155 38.0 37.0 38.0 33.8 38.0 95-99 36.21365 38.0 37.0 38.0 33.4 38.0 100-104 35.9932 38.0 37.0 38.0 32.6 38.0 105-109 35.784499999999994 38.0 36.4 38.0 31.4 38.0 110-114 35.58835 38.0 36.0 38.0 31.0 38.0 115-119 35.45225 38.0 36.0 38.0 29.8 38.0 120-124 35.19500000000001 38.0 35.8 38.0 28.2 38.0 125-129 34.99995 38.0 35.0 38.0 28.0 38.0 130-134 34.6872 38.0 35.0 38.0 27.4 38.0 135-139 34.273250000000004 38.0 34.4 38.0 24.4 38.0 140-144 33.57155 38.0 33.8 38.0 20.6 38.0 145-149 32.6529 37.2 33.2 38.0 15.8 38.0 150-151 28.490125 35.0 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 2.0 14 0.0 15 1.0 16 2.0 17 1.0 18 2.0 19 0.0 20 4.0 21 1.0 22 4.0 23 8.0 24 3.0 25 9.0 26 14.0 27 23.0 28 23.0 29 31.0 30 43.0 31 58.0 32 101.0 33 150.0 34 218.0 35 491.0 36 1116.0 37 1693.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.712045989025345 16.096158871178467 16.226809511366604 41.96498562842958 2 19.1 24.575 39.75 16.575 3 18.675 28.575 27.0 25.75 4 21.875 34.949999999999996 22.125 21.05 5 20.25 37.25 24.55 17.95 6 16.1 36.199999999999996 25.95 21.75 7 13.0 19.3 45.675 22.025 8 18.175 22.025 29.15 30.65 9 17.875 22.075 32.7 27.35 10-14 19.475 30.175 26.075 24.275 15-19 19.305 28.895 27.955000000000002 23.845 20-24 19.46 28.585 27.96 23.995 25-29 19.25 28.999999999999996 28.165000000000003 23.585 30-34 19.5 29.365000000000002 27.889999999999997 23.244999999999997 35-39 19.72 29.054999999999996 27.68 23.544999999999998 40-44 20.16 28.910000000000004 27.384999999999998 23.544999999999998 45-49 19.919999999999998 29.12 27.88 23.080000000000002 50-54 20.52 28.794999999999998 28.105000000000004 22.58 55-59 19.919999999999998 28.999999999999996 27.565 23.515 60-64 19.689999999999998 28.62 27.950000000000003 23.74 65-69 20.165 28.544999999999998 28.23 23.06 70-74 20.445 28.720000000000002 27.48 23.355 75-79 19.725 29.060000000000002 27.700000000000003 23.515 80-84 20.615 28.675 27.11 23.599999999999998 85-89 20.185 29.154999999999998 27.6 23.06 90-94 20.53 28.645 27.145000000000003 23.68 95-99 20.005 28.395 28.12 23.48 100-104 20.11 28.395 27.77 23.724999999999998 105-109 20.43 28.599999999999998 27.779999999999998 23.189999999999998 110-114 20.565 29.535 27.315 22.585 115-119 20.335 29.154999999999998 27.534999999999997 22.975 120-124 20.47 28.720000000000002 27.215 23.595 125-129 20.255000000000003 28.99 27.49 23.265 130-134 20.549999999999997 28.685 27.284999999999997 23.48 135-139 20.9 28.725 26.99 23.385 140-144 21.17 28.499999999999996 26.69 23.64 145-149 21.16 28.435 27.04 23.365 150-151 20.2125 28.012500000000003 27.625 24.15 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.5 24 3.0 25 3.0 26 4.0 27 9.5 28 13.5 29 14.5 30 19.0 31 25.5 32 39.0 33 50.5 34 52.5 35 80.5 36 115.0 37 128.0 38 157.0 39 191.0 40 207.0 41 222.5 42 239.0 43 277.5 44 281.0 45 254.5 46 274.0 47 263.5 48 206.0 49 182.0 50 163.0 51 126.5 52 103.0 53 79.0 54 60.5 55 43.0 56 26.0 57 22.0 58 19.0 59 11.5 60 7.0 61 4.5 62 4.5 63 5.5 64 5.0 65 3.0 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.324999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.4125 0.0 0.0 0.0 0.0 108-109 0.5125 0.0 0.0 0.0 0.0 110-111 0.6499999999999999 0.0 0.0 0.0 0.0 112-113 0.8125 0.0 0.0 0.0 0.0 114-115 1.0375 0.0 0.0 0.0 0.0 116-117 1.1875 0.0 0.0 0.0 0.0 118-119 1.45 0.0 0.0 0.0 0.0 120-121 1.6749999999999998 0.0 0.0 0.0 0.0 122-123 1.85 0.0 0.0 0.0 0.0 124-125 2.1375 0.0 0.0 0.0 0.0 126-127 2.4 0.0 0.0 0.0 0.0 128-129 2.725 0.0 0.0 0.0 0.0 130-131 3.1375 0.0 0.0 0.0 0.0 132-133 3.525 0.0 0.0 0.0 0.0 134-135 3.8 0.0 0.0 0.0 0.0 136-137 4.15 0.0 0.0 0.0 0.0 138-139 4.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTATTCA 10 0.006832588 144.9875 4 TTTATTC 10 0.006832588 144.9875 3 >>END_MODULE SRR7172091 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172091_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.116 33.0 33.0 34.0 33.0 34.0 2 33.1875 34.0 33.0 34.0 33.0 34.0 3 33.24475 34.0 33.0 34.0 33.0 34.0 4 33.27175 34.0 33.0 34.0 33.0 34.0 5 33.24575 34.0 33.0 34.0 33.0 34.0 6 37.4225 38.0 38.0 38.0 37.0 38.0 7 37.50725 38.0 38.0 38.0 38.0 38.0 8 37.5085 38.0 38.0 38.0 38.0 38.0 9 37.521 38.0 38.0 38.0 38.0 38.0 10-14 37.4668 38.0 38.0 38.0 37.2 38.0 15-19 37.4347 38.0 38.0 38.0 37.0 38.0 20-24 37.3795 38.0 38.0 38.0 37.0 38.0 25-29 37.379000000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.349000000000004 38.0 38.0 38.0 37.0 38.0 35-39 37.22885 38.0 38.0 38.0 36.8 38.0 40-44 37.291050000000006 38.0 38.0 38.0 36.8 38.0 45-49 37.2745 38.0 38.0 38.0 37.0 38.0 50-54 37.19025 38.0 38.0 38.0 36.0 38.0 55-59 37.11785 38.0 38.0 38.0 36.0 38.0 60-64 37.0483 38.0 38.0 38.0 36.0 38.0 65-69 36.9456 38.0 38.0 38.0 36.0 38.0 70-74 36.90405 38.0 38.0 38.0 35.6 38.0 75-79 36.812599999999996 38.0 38.0 38.0 35.0 38.0 80-84 36.72135 38.0 38.0 38.0 34.6 38.0 85-89 36.626099999999994 38.0 38.0 38.0 34.2 38.0 90-94 36.479949999999995 38.0 38.0 38.0 34.0 38.0 95-99 36.392700000000005 38.0 37.6 38.0 34.0 38.0 100-104 36.19485 38.0 37.0 38.0 33.8 38.0 105-109 35.9913 38.0 37.0 38.0 33.2 38.0 110-114 35.82275 38.0 37.0 38.0 31.8 38.0 115-119 35.63674999999999 38.0 36.4 38.0 31.4 38.0 120-124 35.42145 38.0 36.0 38.0 29.8 38.0 125-129 34.873450000000005 38.0 35.2 38.0 27.6 38.0 130-134 34.5587 38.0 35.0 38.0 26.8 38.0 135-139 34.245 38.0 34.6 38.0 25.2 38.0 140-144 33.502050000000004 38.0 33.8 38.0 20.2 38.0 145-149 32.49605 38.0 33.0 38.0 14.8 38.0 150-151 27.86275 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 1.0 15 2.0 16 2.0 17 3.0 18 3.0 19 6.0 20 7.0 21 7.0 22 4.0 23 10.0 24 11.0 25 12.0 26 22.0 27 18.0 28 27.0 29 40.0 30 33.0 31 51.0 32 69.0 33 111.0 34 201.0 35 357.0 36 895.0 37 2106.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.4 14.099999999999998 19.225 36.275 2 21.0 22.325 39.875 16.8 3 19.825 26.950000000000003 31.15 22.075 4 23.325000000000003 35.449999999999996 21.0 20.225 5 22.475 37.4 22.025 18.099999999999998 6 17.424999999999997 39.050000000000004 24.375 19.15 7 16.1 14.799999999999999 46.650000000000006 22.45 8 20.1 21.625 29.15 29.125 9 22.275 22.75 30.125 24.85 10-14 22.395 28.32 26.91 22.375 15-19 22.325 28.21 27.685 21.78 20-24 22.715 28.375 28.27 20.64 25-29 22.52 27.845 28.37 21.265 30-34 22.720000000000002 27.705000000000002 28.435 21.14 35-39 22.314999999999998 27.845 28.465 21.375 40-44 22.925 28.235 28.24 20.599999999999998 45-49 23.075000000000003 28.360000000000003 27.800000000000004 20.765 50-54 22.31 28.64 27.975 21.075 55-59 22.855 28.360000000000003 28.17 20.615 60-64 23.235 28.185 28.095 20.485 65-69 23.150000000000002 27.884999999999998 28.349999999999998 20.615 70-74 23.080000000000002 28.12 28.03 20.77 75-79 23.095 28.455000000000002 27.779999999999998 20.669999999999998 80-84 23.919999999999998 27.37 28.17 20.54 85-89 23.5 27.92 28.32 20.26 90-94 23.32 27.565 28.54 20.575 95-99 23.355 27.634999999999998 28.325 20.685000000000002 100-104 23.7 27.500000000000004 28.044999999999998 20.755000000000003 105-109 23.355 27.51 28.360000000000003 20.775 110-114 22.91 28.360000000000003 28.07 20.66 115-119 23.51 28.389999999999997 27.689999999999998 20.41 120-124 23.21 28.244999999999997 28.505000000000003 20.04 125-129 24.125 28.455000000000002 27.634999999999998 19.785 130-134 24.404999999999998 27.735 27.88 19.98 135-139 23.875 28.32 27.805000000000003 20.0 140-144 24.805 28.384999999999998 26.905 19.905 145-149 24.55 28.07 27.834999999999997 19.545 150-151 24.075 27.962500000000002 27.462500000000002 20.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 4.5 27 6.5 28 8.5 29 10.5 30 7.5 31 12.5 32 24.5 33 31.5 34 41.0 35 61.0 36 100.5 37 126.0 38 141.5 39 177.5 40 216.5 41 248.0 42 264.0 43 269.5 44 282.5 45 279.0 46 261.0 47 260.5 48 251.5 49 213.5 50 159.0 51 126.0 52 107.5 53 87.0 54 64.5 55 40.5 56 24.0 57 18.0 58 17.5 59 12.0 60 10.0 61 7.5 62 3.5 63 7.5 64 6.5 65 1.5 66 1.5 67 1.5 68 0.5 69 0.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62339944765253 99.2 2 0.3263871453678132 0.65 3 0.05021340697966357 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.3875 0.0 0.0 0.0 0.0 108-109 0.5125 0.0 0.0 0.0 0.0 110-111 0.6499999999999999 0.0 0.0 0.0 0.0 112-113 0.8125 0.0 0.0 0.0 0.0 114-115 1.0125 0.0 0.0 0.0 0.0 116-117 1.175 0.0 0.0 0.0 0.0 118-119 1.45 0.0 0.0 0.0 0.0 120-121 1.6749999999999998 0.0 0.0 0.0 0.0 122-123 1.85 0.0 0.0 0.0 0.0 124-125 2.1500000000000004 0.0 0.0 0.0 0.0 126-127 2.425 0.0 0.0 0.0 0.0 128-129 2.75 0.0 0.0 0.0 0.0 130-131 3.125 0.0 0.0 0.0 0.0 132-133 3.4875 0.0 0.0 0.0 0.0 134-135 3.7875 0.0 0.0 0.0 0.0 136-137 4.15 0.0 0.0 0.0 0.0 138-139 4.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATTGAT 10 0.006830828 145.0 1 ATTTAAC 10 0.006830828 145.0 6 >>END_MODULE Read 528918 spots for SRR7172091.sra Written 528918 spots for SRR7172091.sra Read 528918 spots for SRR7172091.sra Written 528918 spots for SRR7172091.sra Read 528918 spots for SRR7172091.sra Written 528918 spots for SRR7172091.sra Read 528918 spots for SRR7172091.sra Written 528918 spots for SRR7172091.sra Read 528918 spots for SRR7172091.sra Written 528918 spots for SRR7172091.sra Read 528918 spots for SRR7172091.sra Written 528918 spots for SRR7172091.sra Read 528918 spots for SRR7172091.sra Written 528918 spots for SRR7172091.sra Read 528918 spots for SRR7172091.sra Written 528918 spots for SRR7172091.sra Read 528918 spots for SRR7172091.sra Written 528918 spots for SRR7172091.sra Read 528918 spots for SRR7172091.sra Written 528918 spots for SRR7172091.sra Read 528918 spots for SRR7172091.sra Written 528918 spots for SRR7172091.sra Read 528918 spots for SRR7172091.sra Written 528918 spots for SRR7172091.sra Read 528918 spots for SRR7172091.sra Written 528918 spots for SRR7172091.sra Read 528918 spots for SRR7172091.sra Written 528918 spots for SRR7172091.sra Read 528918 spots for SRR7172091.sra Written 528918 spots for SRR7172091.sra Read 528918 spots for SRR7172091.sra Written 528918 spots for SRR7172091.sra Read 528918 spots for SRR7172091.sra Written 528918 spots for SRR7172091.sra Read 528918 spots for SRR7172091.sra Written 528918 spots for SRR7172091.sra Read 528918 spots for SRR7172091.sra Written 528918 spots for SRR7172091.sra Read 528930 spots for SRR7172091.sra Written 528930 spots for SRR7172091.sra SRR ids: ['SRR7172091.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lq8kgevr SRR7172091.sra spots: 10578372 blocks: [[1, 528918], [528919, 1057836], [1057837, 1586754], [1586755, 2115672], [2115673, 2644590], [2644591, 3173508], [3173509, 3702426], [3702427, 4231344], [4231345, 4760262], [4760263, 5289180], [5289181, 5818098], [5818099, 6347016], [6347017, 6875934], [6875935, 7404852], [7404853, 7933770], [7933771, 8462688], [8462689, 8991606], [8991607, 9520524], [9520525, 10049442], [10049443, 10578372]] SRR7172091 file size 3562962 SRR7172091 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172091 SRR7172091_1.fastq SRR7172091_2.fastq Input file: SRR7172091_1.fastq Paired file: SRR7172091_2.fastq trimmed: SRR7172091-trimmed-pair1.fastq, SRR7172091-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 04:13:10 2025 >> started Fri Feb 14 04:13:27 2025 >> done (17.145s) 10578372 read pairs processed; of these: 2165 ( 0.02%) short read pairs filtered out after trimming by size control 1406 ( 0.01%) empty read pairs filtered out after trimming by size control 10574801 (99.97%) read pairs available; of these: 6735625 (63.70%) trimmed read pairs available after processing 3839176 (36.30%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 1 0.00% 21 2 0.00% 22 3 0.00% 23 3 0.00% 24 1 0.00% 25 2 0.00% 26 4 0.00% 27 0 0.00% 28 2 0.00% 29 5 0.00% 30 2 0.00% 31 2 0.00% 32 2 0.00% 33 2 0.00% 34 7 0.00% 35 2 0.00% 36 2 0.00% 37 1 0.00% 38 0 0.00% 39 4 0.00% 40 4 0.00% 41 3 0.00% 42 3 0.00% 43 7 0.00% 44 4 0.00% 45 5 0.00% 46 11 0.00% 47 9 0.00% 48 7 0.00% 49 15 0.00% 50 7 0.00% 51 10 0.00% 52 23 0.00% 53 18 0.00% 54 17 0.00% 55 30 0.00% 56 23 0.00% 57 21 0.00% 58 41 0.00% 59 38 0.00% 60 47 0.00% 61 55 0.00% 62 51 0.00% 63 67 0.00% 64 72 0.00% 65 87 0.00% 66 90 0.00% 67 122 0.00% 68 119 0.00% 69 162 0.00% 70 164 0.00% 71 161 0.00% 72 213 0.00% 73 260 0.00% 74 258 0.00% 75 275 0.00% 76 382 0.00% 77 434 0.00% 78 512 0.00% 79 525 0.00% 80 625 0.01% 81 658 0.01% 82 815 0.01% 83 902 0.01% 84 1156 0.01% 85 1296 0.01% 86 1541 0.01% 87 1779 0.02% 88 1909 0.02% 89 2069 0.02% 90 2219 0.02% 91 2457 0.02% 92 2583 0.02% 93 2964 0.03% 94 3249 0.03% 95 3588 0.03% 96 3771 0.04% 97 4170 0.04% 98 4408 0.04% 99 4868 0.05% 100 5109 0.05% 101 5627 0.05% 102 6254 0.06% 103 6623 0.06% 104 6976 0.07% 105 7745 0.07% 106 8170 0.08% 107 8874 0.08% 108 9249 0.09% 109 9833 0.09% 110 10486 0.10% 111 11047 0.10% 112 11864 0.11% 113 12549 0.12% 114 13247 0.13% 115 14221 0.13% 116 14949 0.14% 117 15832 0.15% 118 16669 0.16% 119 17484 0.17% 120 18304 0.17% 121 19855 0.19% 122 20776 0.20% 123 22125 0.21% 124 23811 0.23% 125 24858 0.24% 126 26561 0.25% 127 28476 0.27% 128 30434 0.29% 129 32790 0.31% 130 35303 0.33% 131 37760 0.36% 132 40887 0.39% 133 44320 0.42% 134 48384 0.46% 135 52365 0.50% 136 57691 0.55% 137 63393 0.60% 138 71040 0.67% 139 79117 0.75% 140 89728 0.85% 141 102550 0.97% 142 118934 1.12% 143 140949 1.33% 144 171091 1.62% 145 214914 2.03% 146 281882 2.67% 147 386869 3.66% 148 579059 5.48% 149 995618 9.42% 150 2611545 24.70% 151 3839176 36.30% 10574801 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.67 fanout-score-rank=28 prefix-density=0.59 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.10 sequence-density-rank=27 fanout-score=29.45 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=8.6 sequence=AGCACCAAGTGGAG criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.37 fanout-score-rank=27 prefix-density=0.60 prefix-fanout=2.3 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.13 sequence-density-rank=20 fanout-score=23.93 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=9.0 sequence=GAGGTTGAGTACAGGTGCTTTGTTGG SRR7172091 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 04:14:14 Started mapping on | Feb 14 04:14:14 Finished on | Feb 14 04:15:36 Mapping speed, Million of reads per hour | 464.26 Number of input reads | 10574801 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 10026397 Uniquely mapped reads % | 94.81% Average mapped length | 293.52 Number of splices: Total | 9699925 Number of splices: Annotated (sjdb) | 9517253 Number of splices: GT/AG | 9544385 Number of splices: GC/AG | 121183 Number of splices: AT/AC | 8435 Number of splices: Non-canonical | 25922 Mismatch rate per base, % | 0.49% Deletion rate per base | 0.04% Deletion average length | 2.43 Insertion rate per base | 0.02% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 282708 % of reads mapped to multiple loci | 2.67% Number of reads mapped to too many loci | 30124 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.12% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 269038 269038 269038 N_multimapping 282708 282708 282708 N_noFeature 288668 9925716 334803 N_ambiguous 114278 955 59011 UnstrandedReadsAssigned:9623451 PositiveStrandReadsAssigned:99726 NegativeStrandReadsAssigned:9632583 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7172091 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172091-trimmed-pair1.fastq SRR7172091-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,574,801 reads, 9,512,498 reads pseudoaligned [quant] estimated average fragment length: 249.632 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,092 rounds 52401 SRR7172091.ke.tsv 34699 SRR7172091.se.tsv 87100 total ==> SRR7172091.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1769.37 844 46.8337 Potri.005G024800.1.v4.1 1035 786.368 193 24.0971 Potri.004G059700.1.v4.1 961 712.373 14 1.92954 Potri.007G009000.2.v4.1 1416 1167.37 0 0 Potri.003G141000.2.v4.1 2943 2694.37 280.142 10.2084 Potri.016G087400.1.v4.1 270 74.9681 656 859.134 Potri.015G069301.1.v4.1 564 319.444 0 0 Potri.010G195200.1.v4.1 1773 1524.37 178 11.4647 Potri.012G127500.1.v4.1 977 728.368 4086 550.784 ==> SRR7172091.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 32 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 386 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 105 SRR7172091 completed mapping pipeline successfully