Starting /dee2/code/volunteer_pipeline.sh SRR7172092 current disk space = 3086216839168 free memory = 1574731288 SRR7172092 SRAfilesize f9ae0ceea0f8fbdcf74ea289b544103a SRR7172092.sra SRR7172092.sra file validated SRR7172092 is paired end SRR7172092 is conventional basespace SRR7172092 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172092_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.3955 32.0 25.0 33.0 18.0 34.0 2 31.3495 33.0 31.0 33.0 27.0 34.0 3 32.45525 33.0 33.0 33.0 31.0 34.0 4 32.2985 33.0 33.0 33.0 31.0 34.0 5 32.9425 33.0 33.0 34.0 32.0 34.0 6 37.16875 38.0 37.0 38.0 36.0 38.0 7 37.45375 38.0 38.0 38.0 37.0 38.0 8 37.57725 38.0 38.0 38.0 37.0 38.0 9 37.6085 38.0 38.0 38.0 38.0 38.0 10-14 37.45815 38.0 38.0 38.0 37.6 38.0 15-19 37.50345 38.0 38.0 38.0 37.4 38.0 20-24 37.50575 38.0 38.0 38.0 38.0 38.0 25-29 37.415 38.0 38.0 38.0 37.4 38.0 30-34 37.399950000000004 38.0 38.0 38.0 37.2 38.0 35-39 37.3245 38.0 38.0 38.0 37.0 38.0 40-44 37.17295 38.0 38.0 38.0 36.8 38.0 45-49 37.26469999999999 38.0 38.0 38.0 37.0 38.0 50-54 37.295950000000005 38.0 38.0 38.0 37.0 38.0 55-59 37.34155 38.0 38.0 38.0 37.0 38.0 60-64 37.3183 38.0 38.0 38.0 37.0 38.0 65-69 37.25035 38.0 38.0 38.0 37.0 38.0 70-74 37.1534 38.0 38.0 38.0 36.4 38.0 75-79 37.10815 38.0 38.0 38.0 36.2 38.0 80-84 37.04745 38.0 38.0 38.0 36.0 38.0 85-89 36.90985 38.0 38.0 38.0 35.8 38.0 90-94 36.8303 38.0 38.0 38.0 35.4 38.0 95-99 36.75735 38.0 38.0 38.0 35.0 38.0 100-104 36.58395 38.0 38.0 38.0 34.2 38.0 105-109 36.59245 38.0 38.0 38.0 34.2 38.0 110-114 36.15085 38.0 38.0 38.0 33.8 38.0 115-119 35.6684 38.0 36.8 38.0 30.6 38.0 120-124 36.08985 38.0 37.0 38.0 33.4 38.0 125-129 35.665800000000004 38.0 36.6 38.0 31.4 38.0 130-134 35.48755 38.0 36.0 38.0 31.0 38.0 135-139 35.351 38.0 36.0 38.0 31.0 38.0 140-144 34.79365 38.0 35.4 38.0 28.4 38.0 145-149 34.3132 38.0 35.0 38.0 27.2 38.0 150-151 29.565624999999997 35.5 27.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 1.0 14 2.0 15 2.0 16 2.0 17 1.0 18 2.0 19 1.0 20 8.0 21 2.0 22 3.0 23 2.0 24 7.0 25 8.0 26 11.0 27 19.0 28 17.0 29 43.0 30 37.0 31 46.0 32 47.0 33 103.0 34 170.0 35 284.0 36 651.0 37 2528.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.0 19.175 13.225000000000001 30.599999999999998 2 20.325 24.15 34.5 21.025 3 17.5 32.775 29.025000000000002 20.7 4 20.549999999999997 36.425000000000004 22.3 20.724999999999998 5 20.9 36.8 23.1 19.2 6 18.075 35.425000000000004 24.25 22.25 7 12.875 20.625 46.425 20.075000000000003 8 17.549999999999997 21.0 29.225 32.225 9 16.675 22.225 31.900000000000002 29.2 10-14 19.285678505234685 29.79512097380153 26.6242548715123 24.294945649451485 15-19 18.975 29.104999999999997 28.04 23.880000000000003 20-24 19.535 29.14 27.845 23.48 25-29 19.778955791158232 28.880776155231047 27.700540108021602 23.63972794558912 30-34 19.584896224056013 28.907226806701676 28.11202800700175 23.39584896224056 35-39 20.20813528793716 29.329063891529493 27.427828088257368 23.03497273227598 40-44 19.765871229176046 29.236079843914155 27.80029015958777 23.19775876732203 45-49 19.61382622179981 28.842979340703316 27.98759441748787 23.555600020009003 50-54 20.175 28.875 28.23 22.720000000000002 55-59 19.435 28.46 28.555000000000003 23.549999999999997 60-64 19.62 29.609999999999996 27.589999999999996 23.18 65-69 19.735 28.439999999999998 28.02 23.805 70-74 20.033004950742612 28.939340901135168 28.149222383357504 22.878431764764713 75-79 20.305 29.049999999999997 27.389999999999997 23.255 80-84 19.776866119671805 28.547128276966177 27.961777066239748 23.714228537122274 85-89 19.690597777110245 29.187944327625914 28.071492940823067 23.049964954440775 90-94 20.147125056297853 28.854526347395286 27.538407646499525 23.459940949807336 95-99 19.775988799439972 28.801440072003597 27.92139606980349 23.50117505875294 100-104 20.72536268134067 28.284142071035518 27.473736868434216 23.516758379189596 105-109 20.09401880376075 28.485697139427884 27.875575115023004 23.544708941788357 110-114 20.53926253835706 28.180491976457567 27.72272247094924 23.55752301423613 115-119 20.178517701333867 29.11944639454418 27.69531641761107 23.00671948651088 120-124 20.60736441865119 28.602161296778068 27.28637182309386 23.504102461476887 125-129 20.408163265306122 28.591485734342875 27.744070601213462 23.25628039913754 130-134 20.433064959743962 29.024353653047957 27.254088113216984 23.288493273991097 135-139 21.423213482022305 28.274241136170424 27.389108366254938 22.913437015552333 140-144 20.64357922129917 28.665799219297366 27.28455610049044 23.406065458913023 145-149 20.491516091896493 28.0894939686671 26.98333249912408 24.435657440312326 150-151 20.9375 27.800000000000004 27.224999999999998 24.0375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 1.0 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 1.5 24 2.5 25 3.5 26 6.0 27 9.0 28 11.5 29 16.0 30 22.0 31 31.5 32 42.5 33 52.5 34 59.0 35 89.5 36 107.0 37 117.5 38 155.0 39 175.0 40 201.5 41 255.0 42 269.5 43 268.5 44 301.0 45 290.5 46 255.0 47 234.5 48 195.0 49 158.5 50 137.0 51 117.5 52 109.5 53 82.0 54 52.5 55 43.0 56 33.0 57 24.0 58 14.5 59 9.0 60 8.5 61 7.0 62 4.5 63 4.0 64 3.5 65 4.0 66 3.0 67 1.5 68 1.5 69 0.5 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.185 15-19 0.0 20-24 0.0 25-29 0.02 30-34 0.025 35-39 0.065 40-44 0.055 45-49 0.045 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.015 75-79 0.0 80-84 0.06 85-89 0.13 90-94 0.08499999999999999 95-99 0.005 100-104 0.05 105-109 0.02 110-114 0.605 115-119 0.29 120-124 0.06 125-129 0.28500000000000003 130-134 0.015 135-139 0.015 140-144 0.09 145-149 0.105 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21894683799447 98.45 2 0.781053162005543 1.55 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.675 0.0 0.0 0.0 0.0 108-109 0.75 0.0 0.0 0.0 0.0 110-111 0.875 0.0 0.0 0.0 0.0 112-113 1.0499999999999998 0.0 0.0 0.0 0.0 114-115 1.1375000000000002 0.0 0.0 0.0 0.0 116-117 1.4 0.0 0.0 0.0 0.0 118-119 1.65 0.0 0.0 0.0 0.0 120-121 1.875 0.0 0.0 0.0 0.0 122-123 2.0875 0.0 0.0 0.0 0.0 124-125 2.3875 0.0 0.0 0.0 0.0 126-127 2.6125 0.0 0.0 0.0 0.0 128-129 2.95 0.0 0.0 0.0 0.0 130-131 3.325 0.0 0.0 0.0 0.0 132-133 3.6125 0.0 0.0 0.0 0.0 134-135 3.9125 0.0 0.0 0.0 0.0 136-137 4.237500000000001 0.0 0.0 0.0 0.0 138-139 4.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172092 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172092_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.85675 33.0 33.0 34.0 32.0 34.0 2 32.91325 34.0 33.0 34.0 32.0 34.0 3 32.956 34.0 33.0 34.0 32.0 34.0 4 32.804 34.0 33.0 34.0 32.0 34.0 5 32.7405 34.0 33.0 34.0 32.0 34.0 6 36.8675 38.0 38.0 38.0 37.0 38.0 7 36.89275 38.0 38.0 38.0 37.0 38.0 8 37.00975 38.0 38.0 38.0 37.0 38.0 9 36.949 38.0 38.0 38.0 37.0 38.0 10-14 36.921 38.0 38.0 38.0 37.0 38.0 15-19 36.851099999999995 38.0 38.0 38.0 37.0 38.0 20-24 36.76735000000001 38.0 38.0 38.0 36.4 38.0 25-29 36.88335 38.0 38.0 38.0 36.6 38.0 30-34 36.8582 38.0 38.0 38.0 36.8 38.0 35-39 36.82215 38.0 38.0 38.0 36.6 38.0 40-44 36.681599999999996 38.0 38.0 38.0 36.0 38.0 45-49 36.72964999999999 38.0 38.0 38.0 36.0 38.0 50-54 36.775999999999996 38.0 38.0 38.0 36.0 38.0 55-59 36.666399999999996 38.0 38.0 38.0 36.0 38.0 60-64 36.64755 38.0 38.0 38.0 36.0 38.0 65-69 36.5851 38.0 38.0 38.0 35.8 38.0 70-74 36.58385 38.0 38.0 38.0 36.0 38.0 75-79 36.5199 38.0 38.0 38.0 35.8 38.0 80-84 36.3621 38.0 38.0 38.0 35.2 38.0 85-89 36.168850000000006 38.0 38.0 38.0 34.2 38.0 90-94 35.984950000000005 38.0 38.0 38.0 33.6 38.0 95-99 35.91285 38.0 38.0 38.0 33.4 38.0 100-104 35.8844 38.0 38.0 38.0 33.0 38.0 105-109 35.861 38.0 38.0 38.0 33.2 38.0 110-114 35.63635 38.0 37.4 38.0 31.8 38.0 115-119 35.536249999999995 38.0 37.0 38.0 31.0 38.0 120-124 35.468149999999994 38.0 37.2 38.0 31.4 38.0 125-129 35.05714999999999 38.0 36.4 38.0 29.8 38.0 130-134 34.5901 38.0 36.0 38.0 27.0 38.0 135-139 34.2379 38.0 35.6 38.0 25.2 38.0 140-144 33.833949999999994 38.0 34.6 38.0 22.6 38.0 145-149 32.75995 38.0 33.0 38.0 12.2 38.0 150-151 27.4145 34.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 9.0 4 5.0 5 2.0 6 3.0 7 3.0 8 9.0 9 3.0 10 2.0 11 3.0 12 1.0 13 2.0 14 1.0 15 7.0 16 3.0 17 3.0 18 2.0 19 7.0 20 10.0 21 4.0 22 4.0 23 11.0 24 12.0 25 17.0 26 16.0 27 21.0 28 27.0 29 34.0 30 49.0 31 48.0 32 60.0 33 110.0 34 142.0 35 274.0 36 570.0 37 2506.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.91491491491492 16.49149149149149 16.04104104104104 27.55255255255255 2 25.18147684605757 21.67709637046308 34.06758448060075 19.0738423028786 3 19.924906132665832 25.75719649561952 33.09136420525657 21.226533166458072 4 23.26571500125219 34.886050588529926 22.514400200350615 19.333834209867266 5 23.339182752569563 37.90423665078967 20.957633492103284 17.798947104537476 6 17.763819095477388 37.03517587939699 24.87437185929648 20.326633165829143 7 16.842634489693314 16.71694318753142 43.71543489190548 22.724987430869785 8 19.261677548970365 23.204419889502763 27.900552486187845 29.633350075339028 9 21.608040201005025 24.42211055276382 27.010050251256278 26.959798994974875 10-14 22.420107359654846 28.821552199869565 26.664325490392816 22.094014950082776 15-19 22.639425731639978 27.754630791626926 28.377089503538976 21.228853973194116 20-24 22.671882052053558 28.268391755679257 28.01765207361717 21.042074118650017 25-29 22.23945564617001 28.09326061940261 28.81372892380047 20.853554810626907 30-34 22.215 28.42 27.994999999999997 21.37 35-39 22.865 27.985 28.175 20.974999999999998 40-44 23.025000000000002 28.384999999999998 27.76 20.830000000000002 45-49 23.2016008004002 28.054027013506754 28.444222111055527 20.300150075037518 50-54 23.115 28.04 28.115000000000002 20.73 55-59 22.915 28.21 28.08 20.794999999999998 60-64 23.294999999999998 27.755000000000003 28.58 20.369999999999997 65-69 22.675 28.48 27.755000000000003 21.09 70-74 23.385 28.23 28.134999999999998 20.25 75-79 23.68 27.939999999999998 28.16 20.22 80-84 23.3 28.27 28.18 20.25 85-89 23.419999999999998 28.005000000000003 28.38 20.195 90-94 23.085 28.255000000000003 27.884999999999998 20.775 95-99 23.205000000000002 27.975 28.355000000000004 20.465 100-104 23.82 27.855 27.76 20.565 105-109 22.814999999999998 28.65 28.310000000000002 20.225 110-114 23.56 28.235 27.92 20.285 115-119 23.405 28.255000000000003 28.21 20.13 120-124 23.72 27.875 28.34 20.064999999999998 125-129 23.919999999999998 28.485 27.275 20.32 130-134 24.57 28.025 27.315 20.09 135-139 23.865 28.03 28.189999999999998 19.915 140-144 24.395 28.125 27.715 19.765 145-149 24.58 28.21 27.615000000000002 19.595000000000002 150-151 24.625 27.6875 28.299999999999997 19.3875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 1.0 16 1.5 17 0.5 18 0.5 19 1.0 20 1.0 21 1.0 22 0.5 23 0.0 24 1.0 25 3.0 26 4.0 27 4.5 28 7.5 29 10.0 30 10.5 31 22.5 32 39.5 33 41.0 34 48.0 35 72.0 36 89.5 37 114.0 38 139.5 39 165.0 40 210.5 41 242.5 42 263.0 43 275.0 44 268.0 45 272.5 46 267.5 47 249.0 48 223.0 49 192.5 50 163.5 51 141.0 52 119.5 53 83.5 54 62.0 55 45.0 56 36.0 57 32.0 58 21.0 59 14.5 60 11.5 61 7.0 62 5.0 63 4.0 64 3.0 65 3.5 66 1.0 67 1.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.125 3 0.125 4 0.17500000000000002 5 0.27499999999999997 6 0.5 7 0.5499999999999999 8 0.44999999999999996 9 0.5 10-14 0.335 15-19 0.395 20-24 0.295 25-29 0.065 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.05 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 98.96412329459324 97.925 2 1.010611419909045 2.0 3 0.025265285497726126 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.525 0.0 0.0 0.0 0.0 106-107 0.65 0.0 0.0 0.0 0.0 108-109 0.7250000000000001 0.0 0.0 0.0 0.0 110-111 0.85 0.0 0.0 0.0 0.0 112-113 1.0 0.0 0.0 0.0 0.0 114-115 1.0875 0.0 0.0 0.0 0.0 116-117 1.35 0.0 0.0 0.0 0.0 118-119 1.575 0.0 0.0 0.0 0.0 120-121 1.7999999999999998 0.0 0.0 0.0 0.0 122-123 1.9874999999999998 0.0 0.0 0.0 0.0 124-125 2.2875 0.0 0.0 0.0 0.0 126-127 2.5125 0.0 0.0 0.0 0.0 128-129 2.8499999999999996 0.0 0.0 0.0 0.0 130-131 3.2375 0.0 0.0 0.0 0.0 132-133 3.55 0.0 0.0 0.0 0.0 134-135 3.8625 0.0 0.0 0.0 0.0 136-137 4.1375 0.0 0.0 0.0 0.0 138-139 4.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 689016 spots for SRR7172092.sra Written 689016 spots for SRR7172092.sra Read 689016 spots for SRR7172092.sra Written 689016 spots for SRR7172092.sra Read 689016 spots for SRR7172092.sra Written 689016 spots for SRR7172092.sra Read 689016 spots for SRR7172092.sra Written 689016 spots for SRR7172092.sra Read 689016 spots for SRR7172092.sra Written 689016 spots for SRR7172092.sra Read 689016 spots for SRR7172092.sra Written 689016 spots for SRR7172092.sra Read 689016 spots for SRR7172092.sra Written 689016 spots for SRR7172092.sra Read 689016 spots for SRR7172092.sra Written 689016 spots for SRR7172092.sra Read 689016 spots for SRR7172092.sra Written 689016 spots for SRR7172092.sra Read 689016 spots for SRR7172092.sra Written 689016 spots for SRR7172092.sra Read 689016 spots for SRR7172092.sra Written 689016 spots for SRR7172092.sra Read 689016 spots for SRR7172092.sra Written 689016 spots for SRR7172092.sra Read 689016 spots for SRR7172092.sra Written 689016 spots for SRR7172092.sra Read 689022 spots for SRR7172092.sra Written 689022 spots for SRR7172092.sra Read 689016 spots for SRR7172092.sra Written 689016 spots for SRR7172092.sra Read 689016 spots for SRR7172092.sra Written 689016 spots for SRR7172092.sra Read 689016 spots for SRR7172092.sra Written 689016 spots for SRR7172092.sra Read 689016 spots for SRR7172092.sra Written 689016 spots for SRR7172092.sra Read 689016 spots for SRR7172092.sra Written 689016 spots for SRR7172092.sra Read 689016 spots for SRR7172092.sra Written 689016 spots for SRR7172092.sra SRR ids: ['SRR7172092.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n_8xe8k0 SRR7172092.sra spots: 13780326 blocks: [[1, 689016], [689017, 1378032], [1378033, 2067048], [2067049, 2756064], [2756065, 3445080], [3445081, 4134096], [4134097, 4823112], [4823113, 5512128], [5512129, 6201144], [6201145, 6890160], [6890161, 7579176], [7579177, 8268192], [8268193, 8957208], [8957209, 9646224], [9646225, 10335240], [10335241, 11024256], [11024257, 11713272], [11713273, 12402288], [12402289, 13091304], [13091305, 13780326]] SRR7172092 file size 4647999 SRR7172092 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172092 SRR7172092_1.fastq SRR7172092_2.fastq Input file: SRR7172092_1.fastq Paired file: SRR7172092_2.fastq trimmed: SRR7172092-trimmed-pair1.fastq, SRR7172092-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 05:23:18 2025 >> started Fri Feb 14 05:23:34 2025 >> done (15.910s) 13780326 read pairs processed; of these: 18828 ( 0.14%) short read pairs filtered out after trimming by size control 12130 ( 0.09%) empty read pairs filtered out after trimming by size control 13749368 (99.78%) read pairs available; of these: 7287220 (53.00%) trimmed read pairs available after processing 6462148 (47.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 5 0.00% 21 3 0.00% 22 3 0.00% 23 6 0.00% 24 5 0.00% 25 8 0.00% 26 9 0.00% 27 8 0.00% 28 9 0.00% 29 4 0.00% 30 6 0.00% 31 3 0.00% 32 9 0.00% 33 8 0.00% 34 5 0.00% 35 10 0.00% 36 9 0.00% 37 7 0.00% 38 7 0.00% 39 5 0.00% 40 9 0.00% 41 6 0.00% 42 7 0.00% 43 12 0.00% 44 3 0.00% 45 9 0.00% 46 9 0.00% 47 14 0.00% 48 13 0.00% 49 14 0.00% 50 16 0.00% 51 17 0.00% 52 26 0.00% 53 13 0.00% 54 20 0.00% 55 29 0.00% 56 46 0.00% 57 37 0.00% 58 47 0.00% 59 46 0.00% 60 45 0.00% 61 60 0.00% 62 81 0.00% 63 66 0.00% 64 91 0.00% 65 117 0.00% 66 122 0.00% 67 143 0.00% 68 177 0.00% 69 179 0.00% 70 215 0.00% 71 258 0.00% 72 321 0.00% 73 348 0.00% 74 366 0.00% 75 423 0.00% 76 562 0.00% 77 593 0.00% 78 675 0.00% 79 788 0.01% 80 900 0.01% 81 977 0.01% 82 1211 0.01% 83 1403 0.01% 84 2585 0.02% 85 3313 0.02% 86 3640 0.03% 87 3662 0.03% 88 3927 0.03% 89 4048 0.03% 90 4080 0.03% 91 4173 0.03% 92 4311 0.03% 93 4703 0.03% 94 4983 0.04% 95 5295 0.04% 96 5742 0.04% 97 6048 0.04% 98 6241 0.05% 99 6652 0.05% 100 7478 0.05% 101 7920 0.06% 102 8585 0.06% 103 9132 0.07% 104 9692 0.07% 105 10262 0.07% 106 10947 0.08% 107 11341 0.08% 108 12219 0.09% 109 12302 0.09% 110 13174 0.10% 111 14079 0.10% 112 14593 0.11% 113 15458 0.11% 114 16569 0.12% 115 17159 0.12% 116 18303 0.13% 117 19296 0.14% 118 20040 0.15% 119 20712 0.15% 120 22239 0.16% 121 23190 0.17% 122 24299 0.18% 123 25769 0.19% 124 26805 0.19% 125 28607 0.21% 126 29988 0.22% 127 31878 0.23% 128 32978 0.24% 129 35466 0.26% 130 37191 0.27% 131 39839 0.29% 132 42944 0.31% 133 45672 0.33% 134 49169 0.36% 135 53690 0.39% 136 59485 0.43% 137 61467 0.45% 138 66471 0.48% 139 72389 0.53% 140 78035 0.57% 141 84237 0.61% 142 94025 0.68% 143 107099 0.78% 144 125021 0.91% 145 148510 1.08% 146 184615 1.34% 147 252883 1.84% 148 388038 2.82% 149 766394 5.57% 150 3895516 28.33% 151 6462148 47.00% 13749368 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=26 prefix-density=0.27 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=62.27 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=10.4 sequence=TCAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACATTATTTTTAGAAATCCCATACTGCCACCGAATATTCAGTCCTTTAAGAAATCGAACAGCATACCCAACATAGTAAAAACCATCAATAATGC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.83 fanout-score-rank=19 prefix-density=0.37 prefix-fanout=2.7 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=129.36 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=9.1 sequence=CTTCCATTTCCGCCCAAGCTGCTCACAGTATACGGGCGTCGGCATCCAGACCGTCGGCTGATCGTGGTTTTACTAGGCTAGACTAGCGTACGAGCACTATGGTCAGTAATTCCTGGAGGAATAGGTACCAAGAAAAAAACGAACCTTTGGGTTCCAGAGCTGTACGGTCGCACTGAACTCGGATAGGTCTCAGAAAAACGAAATATAGGCTTACGGTAGGTCCGAATGGCACAAAGCTTGTTCCGTTAGCTGGCATAAGATTCCATGCCTAGATGTGATACACGTTTCTGGAAACTGCCTCGTCATGCGACTGTTCCCCGGGGTCAGGGCCGCTGGTATTTGCTGTAAAGAGGGGCGTTGAGTCCGTCCGACTTCACTGCCCCCTTTCAGCCTTTTGGGTCCTGTATCCCAATTCTCAGAGGTCCCGCCGTACGCTGAGGACCACCTGAAACGGGCATCGTCGCTCTTCGTTGTTCGTCGACTTCTAGTGTGGAGACGAATTGCCAGAATT SRR7172092 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 05:24:22 Started mapping on | Feb 14 05:24:22 Finished on | Feb 14 05:26:32 Mapping speed, Million of reads per hour | 380.75 Number of input reads | 13749368 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 12595484 Uniquely mapped reads % | 91.61% Average mapped length | 294.92 Number of splices: Total | 12336305 Number of splices: Annotated (sjdb) | 12113308 Number of splices: GT/AG | 12139937 Number of splices: GC/AG | 155424 Number of splices: AT/AC | 8619 Number of splices: Non-canonical | 32325 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.04% Deletion average length | 2.28 Insertion rate per base | 0.02% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 364097 % of reads mapped to multiple loci | 2.65% Number of reads mapped to too many loci | 46505 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.31% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 810632 810632 810632 N_multimapping 364097 364097 364097 N_noFeature 343981 12471948 399965 N_ambiguous 135949 937 67845 UnstrandedReadsAssigned:12115554 PositiveStrandReadsAssigned:122599 NegativeStrandReadsAssigned:12127674 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172092 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172092-trimmed-pair1.fastq SRR7172092-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,749,368 reads, 12,055,627 reads pseudoaligned [quant] estimated average fragment length: 259.778 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,090 rounds 52401 SRR7172092.ke.tsv 34699 SRR7172092.se.tsv 87100 total ==> SRR7172092.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.22 1159 53.0783 Potri.005G024800.1.v4.1 1035 776.222 339 35.1858 Potri.004G059700.1.v4.1 961 702.242 19 2.17982 Potri.007G009000.2.v4.1 1416 1157.22 0 0 Potri.003G141000.2.v4.1 2943 2684.22 490 14.7073 Potri.016G087400.1.v4.1 270 76.1586 724 765.903 Potri.015G069301.1.v4.1 564 312.725 0 0 Potri.010G195200.1.v4.1 1773 1514.22 534 28.4123 Potri.012G127500.1.v4.1 977 718.227 3021 338.878 ==> SRR7172092.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 21 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 367 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 37 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 146 SRR7172092 completed mapping pipeline successfully