Starting /dee2/code/volunteer_pipeline.sh SRR7172093 current disk space = 3087729688576 free memory = 1291644456 SRR7172093 SRAfilesize 1a898e75c44210da2bb4786720835cdf SRR7172093.sra SRR7172093.sra file validated SRR7172093 is paired end SRR7172093 is conventional basespace SRR7172093 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172093_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9055 33.0 33.0 34.0 32.0 34.0 2 33.26625 34.0 33.0 34.0 32.0 34.0 3 33.062 34.0 33.0 34.0 32.0 34.0 4 33.00725 34.0 33.0 34.0 32.0 34.0 5 33.06425 34.0 33.0 34.0 32.0 34.0 6 36.99825 38.0 37.0 38.0 35.0 38.0 7 37.26525 38.0 38.0 38.0 37.0 38.0 8 37.4075 38.0 38.0 38.0 37.0 38.0 9 37.34875 38.0 38.0 38.0 37.0 38.0 10-14 37.44324999999999 38.0 38.0 38.0 37.2 38.0 15-19 37.4269 38.0 38.0 38.0 37.0 38.0 20-24 37.38119999999999 38.0 38.0 38.0 37.0 38.0 25-29 37.335300000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.23435 38.0 38.0 38.0 36.8 38.0 35-39 37.14105 38.0 38.0 38.0 36.8 38.0 40-44 37.19155 38.0 38.0 38.0 36.8 38.0 45-49 37.1058 38.0 38.0 38.0 36.6 38.0 50-54 37.22275 38.0 38.0 38.0 36.8 38.0 55-59 37.15925 38.0 38.0 38.0 36.8 38.0 60-64 37.08275 38.0 38.0 38.0 36.0 38.0 65-69 37.100300000000004 38.0 38.0 38.0 36.2 38.0 70-74 37.0757 38.0 38.0 38.0 36.0 38.0 75-79 36.900000000000006 38.0 38.0 38.0 35.8 38.0 80-84 36.8394 38.0 38.0 38.0 35.4 38.0 85-89 36.712450000000004 38.0 38.0 38.0 35.4 38.0 90-94 36.642250000000004 38.0 38.0 38.0 34.4 38.0 95-99 36.5834 38.0 38.0 38.0 34.0 38.0 100-104 36.379549999999995 38.0 38.0 38.0 34.0 38.0 105-109 36.34325 38.0 38.0 38.0 34.0 38.0 110-114 35.9969 38.0 37.0 38.0 32.8 38.0 115-119 35.871249999999996 38.0 37.0 38.0 31.8 38.0 120-124 35.6118 38.0 36.6 38.0 31.0 38.0 125-129 35.141 38.0 36.0 38.0 28.8 38.0 130-134 35.1167 38.0 36.0 38.0 30.0 38.0 135-139 34.656549999999996 38.0 35.4 38.0 27.4 38.0 140-144 34.02115 38.0 33.6 38.0 23.2 38.0 145-149 33.4461 38.0 33.2 38.0 20.2 38.0 150-151 28.31325 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 1.0 7 0.0 8 1.0 9 1.0 10 1.0 11 1.0 12 2.0 13 0.0 14 0.0 15 1.0 16 3.0 17 0.0 18 1.0 19 6.0 20 4.0 21 3.0 22 6.0 23 14.0 24 9.0 25 16.0 26 17.0 27 20.0 28 32.0 29 23.0 30 47.0 31 74.0 32 79.0 33 114.0 34 163.0 35 255.0 36 617.0 37 2488.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.175 17.375 14.45 33.0 2 20.4 24.0 36.199999999999996 19.400000000000002 3 17.2 31.3 26.950000000000003 24.55 4 19.875 37.175000000000004 23.1 19.85 5 20.175 38.800000000000004 23.425 17.599999999999998 6 16.475 36.575 25.35 21.6 7 12.9 21.05 45.6 20.45 8 19.175 21.925 27.700000000000003 31.2 9 17.081135393117307 21.7282089927154 31.951770911831197 29.238884702336097 10-14 19.21480370092523 30.367591897974496 26.52663165791448 23.890972743185795 15-19 19.235 29.2 27.950000000000003 23.615 20-24 19.384999999999998 28.095 28.365000000000002 24.154999999999998 25-29 19.93 28.465 28.22 23.385 30-34 19.96 29.020000000000003 27.775 23.244999999999997 35-39 20.125 29.09 27.365000000000002 23.419999999999998 40-44 19.615 29.82 27.175 23.39 45-49 19.79 28.439999999999998 27.375 24.395 50-54 20.32 29.270000000000003 26.875 23.535 55-59 19.939999999999998 28.665000000000003 27.595 23.799999999999997 60-64 20.185 28.175 28.025 23.615 65-69 19.74 28.115000000000002 28.349999999999998 23.794999999999998 70-74 20.095 28.62 27.665 23.62 75-79 20.125 29.235 27.235 23.405 80-84 20.285 28.249999999999996 28.185 23.28 85-89 20.41 29.005 27.279999999999998 23.305 90-94 20.285 29.375 27.36 22.98 95-99 20.39 28.99 26.985 23.635 100-104 20.125 28.03 27.91 23.935000000000002 105-109 20.747074707470748 28.462846284628462 27.17271727172717 23.617361736173617 110-114 20.479695558559914 28.851835160983423 27.75023784487507 22.918231435581593 115-119 20.455000000000002 28.084999999999997 27.98 23.48 120-124 19.96194863065138 28.408351274220195 28.147999799729632 23.481700295398788 125-129 20.7759009573455 28.670242093128163 27.46729487243747 23.086562077088868 130-134 20.89 28.65 26.91 23.549999999999997 135-139 20.735 28.515 27.450000000000003 23.3 140-144 20.86 28.449999999999996 27.525 23.165 145-149 21.529999999999998 28.46 26.740000000000002 23.27 150-151 20.4 28.000000000000004 27.3875 24.212500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 1.0 15 1.0 16 0.0 17 1.0 18 1.0 19 0.5 20 0.5 21 1.0 22 1.0 23 0.0 24 2.0 25 4.5 26 5.0 27 4.0 28 8.5 29 15.5 30 17.5 31 20.5 32 38.5 33 51.5 34 57.5 35 70.5 36 99.0 37 126.0 38 147.0 39 179.5 40 199.0 41 216.0 42 253.5 43 284.0 44 291.0 45 265.5 46 262.0 47 254.0 48 215.5 49 199.0 50 165.5 51 122.0 52 86.0 53 72.5 54 71.5 55 60.0 56 40.0 57 25.5 58 18.5 59 13.5 60 7.5 61 1.5 62 3.0 63 4.5 64 3.5 65 2.0 66 1.0 67 1.5 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.475 10-14 0.025 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.01 110-114 0.145 115-119 0.0 120-124 0.135 125-129 0.245 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0125 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.425 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.5874999999999999 0.0 0.0 0.0 0.0 108-109 0.625 0.0 0.0 0.0 0.0 110-111 0.675 0.0 0.0 0.0 0.0 112-113 0.725 0.0 0.0 0.0 0.0 114-115 0.8125 0.0 0.0 0.0 0.0 116-117 0.9 0.0 0.0 0.0 0.0 118-119 1.0125 0.0 0.0 0.0 0.0 120-121 1.1749999999999998 0.0 0.0 0.0 0.0 122-123 1.275 0.0 0.0 0.0 0.0 124-125 1.4375 0.0 0.0 0.0 0.0 126-127 1.8 0.0 0.0 0.0 0.0 128-129 2.075 0.0 0.0 0.0 0.0 130-131 2.3375 0.0 0.0 0.0 0.0 132-133 2.6125 0.0 0.0 0.0 0.0 134-135 2.9875 0.0 0.0 0.0 0.0 136-137 3.3625 0.0 0.0 0.0 0.0 138-139 3.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTCAAA 10 0.006830828 145.0 1 TTCAAAG 10 0.006830828 145.0 2 >>END_MODULE SRR7172093 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172093_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82975 33.0 33.0 34.0 32.0 34.0 2 32.92625 34.0 33.0 34.0 32.0 34.0 3 33.0375 34.0 33.0 34.0 32.0 34.0 4 33.01525 34.0 33.0 34.0 33.0 34.0 5 32.96325 34.0 33.0 34.0 32.0 34.0 6 37.01775 38.0 38.0 38.0 37.0 38.0 7 37.0805 38.0 38.0 38.0 37.0 38.0 8 36.9885 38.0 38.0 38.0 37.0 38.0 9 37.01825 38.0 38.0 38.0 37.0 38.0 10-14 37.012299999999996 38.0 38.0 38.0 36.8 38.0 15-19 37.0176 38.0 38.0 38.0 37.0 38.0 20-24 36.9058 38.0 38.0 38.0 36.2 38.0 25-29 36.8858 38.0 38.0 38.0 36.4 38.0 30-34 36.964999999999996 38.0 38.0 38.0 36.6 38.0 35-39 36.8726 38.0 38.0 38.0 36.2 38.0 40-44 36.74805 38.0 38.0 38.0 35.8 38.0 45-49 36.763099999999994 38.0 38.0 38.0 36.0 38.0 50-54 36.8549 38.0 38.0 38.0 36.0 38.0 55-59 36.8138 38.0 38.0 38.0 36.0 38.0 60-64 36.7793 38.0 38.0 38.0 36.0 38.0 65-69 36.6648 38.0 38.0 38.0 35.8 38.0 70-74 36.63105 38.0 38.0 38.0 35.6 38.0 75-79 36.50725 38.0 38.0 38.0 34.8 38.0 80-84 36.4869 38.0 38.0 38.0 34.6 38.0 85-89 36.380599999999994 38.0 38.0 38.0 34.2 38.0 90-94 36.16 38.0 38.0 38.0 33.6 38.0 95-99 36.01485 38.0 38.0 38.0 33.4 38.0 100-104 35.9183 38.0 38.0 38.0 33.0 38.0 105-109 35.81235 38.0 37.2 38.0 32.6 38.0 110-114 35.53660000000001 38.0 37.0 38.0 30.6 38.0 115-119 35.51775 38.0 37.0 38.0 31.0 38.0 120-124 35.25945 38.0 37.0 38.0 29.8 38.0 125-129 34.85705 38.0 36.0 38.0 28.0 38.0 130-134 34.397149999999996 38.0 35.6 38.0 25.0 38.0 135-139 33.97195000000001 38.0 34.6 38.0 22.6 38.0 140-144 33.31085 38.0 33.2 38.0 19.4 38.0 145-149 32.66145 38.0 33.0 38.0 11.0 38.0 150-151 27.580750000000002 34.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 2.0 4 7.0 5 1.0 6 0.0 7 2.0 8 2.0 9 2.0 10 2.0 11 1.0 12 3.0 13 0.0 14 4.0 15 5.0 16 2.0 17 2.0 18 4.0 19 5.0 20 7.0 21 8.0 22 16.0 23 11.0 24 14.0 25 16.0 26 24.0 27 33.0 28 46.0 29 40.0 30 51.0 31 56.0 32 75.0 33 108.0 34 149.0 35 257.0 36 569.0 37 2461.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.81043129388165 15.997993981945838 17.352056168505516 29.839518555667 2 23.8988988988989 23.34834834834835 35.06006006006006 17.692692692692695 3 19.83987990993245 26.044533400050035 31.923942957217914 22.191643732799598 4 23.092319239429575 34.75106329747311 22.316737553164874 19.83987990993245 5 23.34250688016012 36.22717037778334 22.641981486114584 17.788341255941955 6 16.804407713498623 37.39043325820185 24.843476083145504 20.96168294515402 7 17.45991983967936 15.130260521042086 44.73947895791583 22.670340681362724 8 20.41531148361271 22.66700025018764 26.670002501876404 30.24768576432324 9 22.39179384538404 22.91718789091819 28.67150362772079 26.019514635976982 10-14 23.135822240016015 27.614853368031227 27.194475027524774 22.054849364427987 15-19 22.889756683688795 28.296785821568037 27.926304195454087 20.88715329928908 20-24 22.511255627813906 28.119059529764883 28.14407203601801 21.225612806403202 25-29 22.745 28.194999999999997 27.894999999999996 21.165 30-34 22.35 28.23 28.1 21.32 35-39 22.515 27.79 27.935 21.759999999999998 40-44 22.8 28.1 28.125 20.974999999999998 45-49 22.97 27.76 28.749999999999996 20.52 50-54 22.8 27.99 28.455000000000002 20.755000000000003 55-59 23.31 27.735 28.28 20.674999999999997 60-64 23.369999999999997 28.294999999999998 27.725 20.61 65-69 23.492349234923495 28.18781878187819 27.667766776677666 20.652065206520653 70-74 23.43 27.315 28.09 21.165 75-79 23.352005601680503 27.728318495548663 27.98839651895569 20.931279383815145 80-84 23.8023802380238 27.947794779477945 27.382738273827385 20.86708670867087 85-89 23.48 27.900000000000002 28.225 20.395 90-94 23.25232523252325 27.447744774477446 28.337833783378336 20.962096209620963 95-99 23.32966593318664 28.135627125425085 28.080616123224644 20.454090818163635 100-104 23.395 27.625 28.43 20.549999999999997 105-109 23.64 27.650000000000002 28.265 20.445 110-114 23.87 27.450000000000003 27.775 20.905 115-119 24.09 27.584999999999997 28.134999999999998 20.19 120-124 23.76 27.6 27.975 20.665 125-129 23.599999999999998 28.499999999999996 27.665 20.235 130-134 24.12 28.285 27.415 20.18 135-139 23.665 27.965 27.72 20.65 140-144 24.060000000000002 27.310000000000002 28.03 20.599999999999998 145-149 24.465 28.205000000000002 27.32 20.01 150-151 24.6625 28.3875 26.974999999999998 19.975 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 2.0 22 3.0 23 1.5 24 0.5 25 3.5 26 7.0 27 6.5 28 6.0 29 7.5 30 11.0 31 18.5 32 21.5 33 29.0 34 44.0 35 62.0 36 77.5 37 105.5 38 141.0 39 163.0 40 198.5 41 226.5 42 248.0 43 276.5 44 299.5 45 300.5 46 271.5 47 242.0 48 224.0 49 200.0 50 180.5 51 162.5 52 117.0 53 85.0 54 61.5 55 36.5 56 35.5 57 34.0 58 26.5 59 17.5 60 8.5 61 7.5 62 7.5 63 6.5 64 4.5 65 3.0 66 2.5 67 1.0 68 1.0 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.1 3 0.075 4 0.075 5 0.075 6 0.17500000000000002 7 0.2 8 0.075 9 0.075 10-14 0.09 15-19 0.13 20-24 0.05 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.01 70-74 0.0 75-79 0.03 80-84 0.01 85-89 0.0 90-94 0.01 95-99 0.02 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.5874999999999999 0.0 0.0 0.0 0.0 108-109 0.625 0.0 0.0 0.0 0.0 110-111 0.675 0.0 0.0 0.0 0.0 112-113 0.7 0.0 0.0 0.0 0.0 114-115 0.775 0.0 0.0 0.0 0.0 116-117 0.825 0.0 0.0 0.0 0.0 118-119 0.9375 0.0 0.0 0.0 0.0 120-121 1.125 0.0 0.0 0.0 0.0 122-123 1.2374999999999998 0.0 0.0 0.0 0.0 124-125 1.4249999999999998 0.0 0.0 0.0 0.0 126-127 1.775 0.0 0.0 0.0 0.0 128-129 2.05 0.0 0.0 0.0 0.0 130-131 2.3125 0.0 0.0 0.0 0.0 132-133 2.6125 0.0 0.0 0.0 0.0 134-135 2.9625 0.0 0.0 0.0 0.0 136-137 3.35 0.0 0.0 0.0 0.0 138-139 3.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAAGTT 10 0.006830828 145.0 1 CCCCCCC 20 0.00593511 29.0 80-84 >>END_MODULE Read 878637 spots for SRR7172093.sra Written 878637 spots for SRR7172093.sra Read 878637 spots for SRR7172093.sra Written 878637 spots for SRR7172093.sra Read 878637 spots for SRR7172093.sra Written 878637 spots for SRR7172093.sra Read 878637 spots for SRR7172093.sra Written 878637 spots for SRR7172093.sra Read 878637 spots for SRR7172093.sra Written 878637 spots for SRR7172093.sra Read 878637 spots for SRR7172093.sra Written 878637 spots for SRR7172093.sra Read 878637 spots for SRR7172093.sra Written 878637 spots for SRR7172093.sra Read 878637 spots for SRR7172093.sra Written 878637 spots for SRR7172093.sra Read 878637 spots for SRR7172093.sra Written 878637 spots for SRR7172093.sra Read 878637 spots for SRR7172093.sra Written 878637 spots for SRR7172093.sra Read 878637 spots for SRR7172093.sra Written 878637 spots for SRR7172093.sra Read 878637 spots for SRR7172093.sra Written 878637 spots for SRR7172093.sra Read 878637 spots for SRR7172093.sra Written 878637 spots for SRR7172093.sra Read 878637 spots for SRR7172093.sra Written 878637 spots for SRR7172093.sra Read 878637 spots for SRR7172093.sra Written 878637 spots for SRR7172093.sra Read 878637 spots for SRR7172093.sra Written 878637 spots for SRR7172093.sra Read 878637 spots for SRR7172093.sra Written 878637 spots for SRR7172093.sra Read 878641 spots for SRR7172093.sra Written 878641 spots for SRR7172093.sra Read 878637 spots for SRR7172093.sra Written 878637 spots for SRR7172093.sra Read 878637 spots for SRR7172093.sra Written 878637 spots for SRR7172093.sra SRR ids: ['SRR7172093.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_y2me7qmc SRR7172093.sra spots: 17572744 blocks: [[1, 878637], [878638, 1757274], [1757275, 2635911], [2635912, 3514548], [3514549, 4393185], [4393186, 5271822], [5271823, 6150459], [6150460, 7029096], [7029097, 7907733], [7907734, 8786370], [8786371, 9665007], [9665008, 10543644], [10543645, 11422281], [11422282, 12300918], [12300919, 13179555], [13179556, 14058192], [14058193, 14936829], [14936830, 15815466], [15815467, 16694103], [16694104, 17572744]] SRR7172093 file size 5933125 SRR7172093 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172093 SRR7172093_1.fastq SRR7172093_2.fastq Input file: SRR7172093_1.fastq Paired file: SRR7172093_2.fastq trimmed: SRR7172093-trimmed-pair1.fastq, SRR7172093-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 04:08:41 2025 >> started Fri Feb 14 04:09:01 2025 >> done (19.636s) 17572744 read pairs processed; of these: 25084 ( 0.14%) short read pairs filtered out after trimming by size control 20282 ( 0.12%) empty read pairs filtered out after trimming by size control 17527378 (99.74%) read pairs available; of these: 9907860 (56.53%) trimmed read pairs available after processing 7619518 (43.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 3 0.00% 21 7 0.00% 22 6 0.00% 23 10 0.00% 24 9 0.00% 25 9 0.00% 26 7 0.00% 27 12 0.00% 28 12 0.00% 29 8 0.00% 30 11 0.00% 31 4 0.00% 32 12 0.00% 33 8 0.00% 34 9 0.00% 35 15 0.00% 36 21 0.00% 37 12 0.00% 38 9 0.00% 39 7 0.00% 40 10 0.00% 41 8 0.00% 42 15 0.00% 43 11 0.00% 44 9 0.00% 45 15 0.00% 46 14 0.00% 47 20 0.00% 48 16 0.00% 49 25 0.00% 50 29 0.00% 51 32 0.00% 52 35 0.00% 53 27 0.00% 54 41 0.00% 55 41 0.00% 56 49 0.00% 57 79 0.00% 58 203 0.00% 59 317 0.00% 60 231 0.00% 61 129 0.00% 62 120 0.00% 63 123 0.00% 64 120 0.00% 65 146 0.00% 66 178 0.00% 67 199 0.00% 68 226 0.00% 69 269 0.00% 70 264 0.00% 71 348 0.00% 72 346 0.00% 73 396 0.00% 74 472 0.00% 75 616 0.00% 76 684 0.00% 77 755 0.00% 78 897 0.01% 79 1082 0.01% 80 1166 0.01% 81 1265 0.01% 82 1631 0.01% 83 2815 0.02% 84 4545 0.03% 85 5259 0.03% 86 5070 0.03% 87 5775 0.03% 88 5416 0.03% 89 5285 0.03% 90 5101 0.03% 91 5242 0.03% 92 5381 0.03% 93 5726 0.03% 94 6335 0.04% 95 6482 0.04% 96 6963 0.04% 97 7488 0.04% 98 8187 0.05% 99 8821 0.05% 100 10176 0.06% 101 10288 0.06% 102 10940 0.06% 103 11434 0.07% 104 12048 0.07% 105 12838 0.07% 106 13623 0.08% 107 14174 0.08% 108 15026 0.09% 109 15893 0.09% 110 16749 0.10% 111 17929 0.10% 112 19212 0.11% 113 20143 0.11% 114 21405 0.12% 115 23029 0.13% 116 24062 0.14% 117 25488 0.15% 118 26898 0.15% 119 28287 0.16% 120 30024 0.17% 121 31695 0.18% 122 33979 0.19% 123 35801 0.20% 124 38534 0.22% 125 40934 0.23% 126 43331 0.25% 127 45547 0.26% 128 48760 0.28% 129 51323 0.29% 130 53675 0.31% 131 57097 0.33% 132 60305 0.34% 133 63403 0.36% 134 67914 0.39% 135 72503 0.41% 136 77491 0.44% 137 81643 0.47% 138 88055 0.50% 139 95857 0.55% 140 108696 0.62% 141 118450 0.68% 142 133713 0.76% 143 153970 0.88% 144 183436 1.05% 145 214987 1.23% 146 278639 1.59% 147 383774 2.19% 148 564563 3.22% 149 1127226 6.43% 150 5060147 28.87% 151 7619518 43.47% 17527378 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=29 prefix-density=0.50 prefix-fanout=2.3 sequence=CATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=18 fanout-score=402.62 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=35.5 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.74 fanout-score-rank=32 prefix-density=0.60 prefix-fanout=2.3 sequence=GGTTTCTCAGAGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=24 fanout-score=122.23 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=22.7 sequence=CAAAGAAGAAGAT SRR7172093 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 04:09:47 Started mapping on | Feb 14 04:09:47 Finished on | Feb 14 04:11:42 Mapping speed, Million of reads per hour | 548.68 Number of input reads | 17527378 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 16618728 Uniquely mapped reads % | 94.82% Average mapped length | 294.36 Number of splices: Total | 16897608 Number of splices: Annotated (sjdb) | 16616301 Number of splices: GT/AG | 16638068 Number of splices: GC/AG | 207649 Number of splices: AT/AC | 11123 Number of splices: Non-canonical | 40768 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.03% Deletion average length | 2.30 Insertion rate per base | 0.03% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 471128 % of reads mapped to multiple loci | 2.69% Number of reads mapped to too many loci | 42096 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.17% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 466936 466936 466936 N_multimapping 471128 471128 471128 N_noFeature 398540 16470755 463025 N_ambiguous 174286 899 90324 UnstrandedReadsAssigned:16045902 PositiveStrandReadsAssigned:147074 NegativeStrandReadsAssigned:16065379 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172093 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172093-trimmed-pair1.fastq SRR7172093-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,527,378 reads, 15,910,023 reads pseudoaligned [quant] estimated average fragment length: 256.173 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,107 rounds 52401 SRR7172093.ke.tsv 34699 SRR7172093.se.tsv 87100 total ==> SRR7172093.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.83 1036 33.0044 Potri.005G024800.1.v4.1 1035 779.827 262 18.868 Potri.004G059700.1.v4.1 961 705.852 26 2.06862 Potri.007G009000.2.v4.1 1416 1160.83 0 0 Potri.003G141000.2.v4.1 2943 2687.83 615 12.8498 Potri.016G087400.1.v4.1 270 75.5005 1369.54 1018.7 Potri.015G069301.1.v4.1 564 315.712 0 0 Potri.010G195200.1.v4.1 1773 1517.83 254 9.39796 Potri.012G127500.1.v4.1 977 721.837 3961 308.168 ==> SRR7172093.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 23 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 393 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 145 SRR7172093 completed mapping pipeline successfully