Starting /dee2/code/volunteer_pipeline.sh SRR7172094 current disk space = 3087361142784 free memory = 1489094688 SRR7172094 SRAfilesize 6d8b20dd19d4bf17665842643b4fc62c SRR7172094.sra SRR7172094.sra file validated SRR7172094 is paired end SRR7172094 is conventional basespace SRR7172094 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172094_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.23175 33.0 32.0 33.0 30.0 34.0 2 30.71425 32.0 31.0 33.0 25.0 33.0 3 32.16375 33.0 33.0 33.0 29.0 34.0 4 31.84175 33.0 31.0 33.0 29.0 34.0 5 32.507 33.0 33.0 33.0 31.0 34.0 6 36.88075 38.0 37.0 38.0 35.0 38.0 7 37.3345 38.0 38.0 38.0 36.0 38.0 8 37.499 38.0 38.0 38.0 37.0 38.0 9 37.45575 38.0 38.0 38.0 37.0 38.0 10-14 37.4821 38.0 38.0 38.0 37.0 38.0 15-19 37.535399999999996 38.0 38.0 38.0 37.4 38.0 20-24 37.42595 38.0 38.0 38.0 37.0 38.0 25-29 37.44189999999999 38.0 38.0 38.0 37.2 38.0 30-34 37.39965 38.0 38.0 38.0 37.0 38.0 35-39 37.39104999999999 38.0 38.0 38.0 37.0 38.0 40-44 37.335249999999995 38.0 38.0 38.0 37.0 38.0 45-49 37.28005 38.0 38.0 38.0 36.6 38.0 50-54 37.222500000000004 38.0 38.0 38.0 36.2 38.0 55-59 37.14665000000001 38.0 38.0 38.0 36.0 38.0 60-64 37.0145 38.0 38.0 38.0 35.8 38.0 65-69 36.9893 38.0 38.0 38.0 36.0 38.0 70-74 36.8879 38.0 38.0 38.0 35.2 38.0 75-79 36.818549999999995 38.0 38.0 38.0 35.0 38.0 80-84 36.73925 38.0 38.0 38.0 34.8 38.0 85-89 36.59525 38.0 38.0 38.0 34.0 38.0 90-94 36.473949999999995 38.0 38.0 38.0 34.0 38.0 95-99 36.3882 38.0 37.2 38.0 34.0 38.0 100-104 36.191050000000004 38.0 37.0 38.0 33.4 38.0 105-109 35.94475 38.0 37.0 38.0 32.0 38.0 110-114 35.85125000000001 38.0 36.8 38.0 31.6 38.0 115-119 35.72595 38.0 36.4 38.0 31.0 38.0 120-124 35.477450000000005 38.0 36.0 38.0 30.6 38.0 125-129 35.04695 38.0 35.4 38.0 28.0 38.0 130-134 34.86875 38.0 35.0 38.0 27.8 38.0 135-139 34.5644 38.0 35.0 38.0 27.0 38.0 140-144 33.79174999999999 38.0 34.0 38.0 23.0 38.0 145-149 32.95245 38.0 33.8 38.0 17.0 38.0 150-151 29.213124999999998 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 2.0 19 1.0 20 4.0 21 6.0 22 4.0 23 7.0 24 6.0 25 15.0 26 18.0 27 19.0 28 25.0 29 40.0 30 49.0 31 54.0 32 83.0 33 106.0 34 195.0 35 377.0 36 972.0 37 2014.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.95983307250913 17.031820552947313 14.736567553468962 37.2717788210746 2 18.825 23.275000000000002 39.675 18.224999999999998 3 17.575 29.375 27.950000000000003 25.1 4 19.900000000000002 37.375 22.325 20.4 5 20.200000000000003 38.125 23.7 17.974999999999998 6 16.25 36.225 25.05 22.475 7 12.125 22.325 45.675 19.875 8 18.099999999999998 20.225 30.575000000000003 31.1 9 17.875 22.025 30.175 29.925 10-14 19.435 29.970000000000002 27.07 23.525 15-19 19.715 28.68 28.000000000000004 23.605 20-24 20.02 28.754999999999995 27.43 23.794999999999998 25-29 19.49 30.214999999999996 27.415 22.88 30-34 19.67 29.48 28.07 22.78 35-39 19.79 29.26 28.07 22.88 40-44 20.06 29.435 27.68 22.825 45-49 19.895 29.03 27.529999999999998 23.544999999999998 50-54 19.73 28.810000000000002 28.375 23.085 55-59 19.66 29.215000000000003 28.205000000000002 22.919999999999998 60-64 19.825 29.360000000000003 27.715 23.1 65-69 19.425 29.330000000000002 27.71 23.535 70-74 20.105 28.255000000000003 28.465 23.175 75-79 19.939999999999998 29.044999999999998 27.894999999999996 23.119999999999997 80-84 19.685 28.835 28.09 23.39 85-89 19.955000000000002 28.52 28.24 23.285 90-94 20.41 28.67 27.605 23.315 95-99 20.02 28.96 27.66 23.36 100-104 20.7 28.835 27.384999999999998 23.080000000000002 105-109 20.02 28.51 27.779999999999998 23.69 110-114 19.825 28.925 28.355000000000004 22.895 115-119 20.185 29.110000000000003 27.705000000000002 23.0 120-124 20.315 28.48 27.884999999999998 23.32 125-129 20.560000000000002 28.67 28.15 22.62 130-134 20.89 28.665000000000003 26.99 23.455000000000002 135-139 20.445 29.01 27.045 23.5 140-144 20.075000000000003 29.575000000000003 26.655 23.695 145-149 20.815 28.365000000000002 27.389999999999997 23.43 150-151 21.425 28.175 26.337500000000002 24.0625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 1.5 24 2.5 25 3.0 26 6.5 27 10.5 28 11.0 29 18.5 30 28.5 31 36.0 32 44.5 33 60.0 34 75.0 35 89.5 36 107.0 37 123.0 38 154.0 39 191.5 40 233.5 41 254.0 42 251.5 43 258.5 44 271.0 45 255.0 46 226.5 47 225.0 48 221.0 49 183.5 50 152.5 51 133.0 52 97.5 53 72.0 54 53.0 55 36.0 56 26.5 57 22.0 58 17.5 59 13.0 60 9.5 61 5.0 62 3.0 63 2.5 64 3.5 65 4.5 66 2.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.5874999999999999 0.0 0.0 0.0 0.0 110-111 0.6625 0.0 0.0 0.0125 0.0 112-113 0.7875000000000001 0.0 0.0 0.025 0.0 114-115 0.925 0.0 0.0 0.025 0.0 116-117 1.15 0.0 0.0 0.025 0.0 118-119 1.3875000000000002 0.0 0.0 0.025 0.0 120-121 1.5875 0.0 0.0 0.025 0.0 122-123 1.825 0.0 0.0 0.025 0.0 124-125 2.0125 0.0 0.0 0.025 0.0 126-127 2.2249999999999996 0.0 0.0 0.025 0.0 128-129 2.4749999999999996 0.0 0.0 0.025 0.0 130-131 2.75 0.0 0.0 0.025 0.0 132-133 3.15 0.0 0.0 0.025 0.0 134-135 3.4875 0.0 0.0 0.025 0.0 136-137 4.0 0.0 0.0 0.025 0.0 138-139 4.4 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATGAA 10 0.0068378756 144.95 5 AAAAAAA 35 0.00354369 20.707142 55-59 >>END_MODULE SRR7172094 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172094_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0515 33.0 33.0 34.0 32.0 34.0 2 33.12375 34.0 33.0 34.0 33.0 34.0 3 33.20675 34.0 33.0 34.0 33.0 34.0 4 33.18175 34.0 33.0 34.0 33.0 34.0 5 33.193 34.0 33.0 34.0 33.0 34.0 6 37.32625 38.0 38.0 38.0 37.0 38.0 7 37.47 38.0 38.0 38.0 37.0 38.0 8 37.36375 38.0 38.0 38.0 37.0 38.0 9 37.38775 38.0 38.0 38.0 37.0 38.0 10-14 37.3598 38.0 38.0 38.0 37.0 38.0 15-19 37.349000000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.3361 38.0 38.0 38.0 37.0 38.0 25-29 37.273 38.0 38.0 38.0 37.0 38.0 30-34 37.29055 38.0 38.0 38.0 37.0 38.0 35-39 37.13035 38.0 38.0 38.0 36.6 38.0 40-44 37.2051 38.0 38.0 38.0 36.8 38.0 45-49 37.159499999999994 38.0 38.0 38.0 36.4 38.0 50-54 37.118849999999995 38.0 38.0 38.0 36.0 38.0 55-59 37.05005 38.0 38.0 38.0 36.0 38.0 60-64 36.9499 38.0 38.0 38.0 36.0 38.0 65-69 36.889199999999995 38.0 38.0 38.0 35.6 38.0 70-74 36.8084 38.0 38.0 38.0 35.0 38.0 75-79 36.719800000000006 38.0 38.0 38.0 34.6 38.0 80-84 36.6377 38.0 38.0 38.0 34.4 38.0 85-89 36.55605 38.0 38.0 38.0 34.0 38.0 90-94 36.3489 38.0 38.0 38.0 34.0 38.0 95-99 36.213350000000005 38.0 37.2 38.0 33.6 38.0 100-104 36.171949999999995 38.0 37.0 38.0 33.4 38.0 105-109 35.94185 38.0 37.0 38.0 32.0 38.0 110-114 35.7292 38.0 37.0 38.0 31.0 38.0 115-119 35.52405 38.0 36.4 38.0 30.6 38.0 120-124 35.341449999999995 38.0 36.0 38.0 29.8 38.0 125-129 34.913349999999994 38.0 35.4 38.0 27.6 38.0 130-134 34.571549999999995 38.0 35.0 38.0 25.6 38.0 135-139 34.2851 38.0 34.8 38.0 24.2 38.0 140-144 33.540600000000005 38.0 33.8 38.0 21.4 38.0 145-149 32.5928 38.0 33.2 38.0 14.8 38.0 150-151 28.04625 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 1.0 12 0.0 13 2.0 14 2.0 15 3.0 16 4.0 17 0.0 18 4.0 19 1.0 20 2.0 21 8.0 22 11.0 23 11.0 24 13.0 25 16.0 26 19.0 27 20.0 28 29.0 29 31.0 30 52.0 31 66.0 32 95.0 33 103.0 34 180.0 35 339.0 36 808.0 37 2177.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.2 13.425 16.6 35.775 2 21.975 22.650000000000002 38.1 17.275 3 21.625 26.8 30.125 21.45 4 24.55 34.300000000000004 21.575 19.575 5 23.95 36.825 21.85 17.375 6 15.425 38.65 26.125 19.8 7 16.875 14.174999999999999 46.85 22.1 8 20.05 20.65 29.549999999999997 29.75 9 22.6 23.075000000000003 28.775000000000002 25.55 10-14 22.365 28.585 26.705000000000002 22.345000000000002 15-19 22.14 28.449999999999996 28.499999999999996 20.91 20-24 22.75 28.249999999999996 28.17 20.830000000000002 25-29 22.575 28.599999999999998 27.79 21.035 30-34 22.770000000000003 27.965 28.194999999999997 21.07 35-39 22.485 27.63 28.625 21.26 40-44 22.925 28.23 28.26 20.585 45-49 22.775000000000002 27.82 28.53 20.875 50-54 23.325000000000003 28.28 28.565 19.830000000000002 55-59 23.145 28.08 28.285 20.49 60-64 22.965 28.299999999999997 28.17 20.565 65-69 22.985 28.199999999999996 28.610000000000003 20.205000000000002 70-74 22.805 28.655 28.16 20.380000000000003 75-79 23.645 27.639999999999997 28.42 20.294999999999998 80-84 23.275000000000002 27.845 28.849999999999998 20.03 85-89 23.145 27.994999999999997 28.720000000000002 20.14 90-94 22.884999999999998 27.950000000000003 28.525 20.64 95-99 24.035 27.834999999999997 27.865000000000002 20.265 100-104 23.205000000000002 27.529999999999998 28.999999999999996 20.265 105-109 23.474999999999998 27.37 28.749999999999996 20.405 110-114 23.155 28.194999999999997 28.634999999999998 20.015 115-119 23.599999999999998 27.644999999999996 28.335 20.419999999999998 120-124 23.830000000000002 28.139999999999997 28.134999999999998 19.895 125-129 23.599999999999998 28.134999999999998 27.92 20.345 130-134 23.93 28.02 28.205000000000002 19.845 135-139 23.53 27.99 28.634999999999998 19.845 140-144 24.03 28.549999999999997 27.52 19.900000000000002 145-149 23.810000000000002 28.325 27.905 19.96 150-151 24.0375 27.375 28.199999999999996 20.3875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 1.0 22 1.0 23 2.5 24 2.5 25 0.0 26 4.0 27 7.5 28 6.5 29 9.0 30 17.0 31 27.0 32 35.5 33 41.0 34 46.5 35 62.5 36 89.5 37 127.5 38 153.0 39 168.0 40 199.5 41 230.5 42 270.5 43 286.0 44 284.0 45 279.5 46 268.5 47 244.5 48 213.0 49 199.0 50 166.5 51 135.5 52 100.5 53 76.0 54 60.5 55 40.5 56 33.5 57 31.0 58 24.5 59 15.5 60 8.5 61 4.0 62 5.5 63 4.0 64 4.5 65 3.0 66 1.5 67 2.5 68 2.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72382626161185 99.3 2 0.20085362791865427 0.4 3 0.025106703489831784 0.075 4 0.025106703489831784 0.1 5 0.025106703489831784 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0125 0.0 108-109 0.5874999999999999 0.0 0.0 0.025 0.0 110-111 0.6625 0.0 0.0 0.025 0.0 112-113 0.7875000000000001 0.0 0.0 0.025 0.0 114-115 0.925 0.0 0.0 0.025 0.0 116-117 1.15 0.0 0.0 0.025 0.0 118-119 1.3875000000000002 0.0 0.0 0.025 0.0 120-121 1.5875 0.0 0.0 0.025 0.0 122-123 1.8375 0.0 0.0 0.025 0.0 124-125 2.05 0.0 0.0 0.025 0.0 126-127 2.2875 0.0 0.0 0.025 0.0 128-129 2.575 0.0 0.0 0.025 0.0 130-131 2.875 0.0 0.0 0.025 0.0 132-133 3.275 0.0 0.0 0.025 0.0 134-135 3.6125 0.0 0.0 0.025 0.0 136-137 4.125 0.0 0.0 0.025 0.0 138-139 4.550000000000001 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTCCT 10 0.006830828 145.0 4 TTCTCCT 10 0.006830828 145.0 6 GCATCCC 10 0.006830828 145.0 145 AAAAAAA 70 7.343502E-4 14.5 25-29 >>END_MODULE Read 625220 spots for SRR7172094.sra Written 625220 spots for SRR7172094.sra Read 625220 spots for SRR7172094.sra Written 625220 spots for SRR7172094.sra Read 625220 spots for SRR7172094.sra Written 625220 spots for SRR7172094.sra Read 625220 spots for SRR7172094.sra Written 625220 spots for SRR7172094.sra Read 625239 spots for SRR7172094.sra Written 625239 spots for SRR7172094.sra Read 625220 spots for SRR7172094.sra Written 625220 spots for SRR7172094.sra Read 625220 spots for SRR7172094.sra Written 625220 spots for SRR7172094.sra Read 625220 spots for SRR7172094.sra Written 625220 spots for SRR7172094.sra Read 625220 spots for SRR7172094.sra Written 625220 spots for SRR7172094.sra Read 625220 spots for SRR7172094.sra Written 625220 spots for SRR7172094.sra Read 625220 spots for SRR7172094.sra Written 625220 spots for SRR7172094.sra Read 625220 spots for SRR7172094.sra Written 625220 spots for SRR7172094.sra Read 625220 spots for SRR7172094.sra Written 625220 spots for SRR7172094.sra Read 625220 spots for SRR7172094.sra Written 625220 spots for SRR7172094.sra Read 625220 spots for SRR7172094.sra Written 625220 spots for SRR7172094.sra Read 625220 spots for SRR7172094.sra Written 625220 spots for SRR7172094.sra Read 625220 spots for SRR7172094.sra Written 625220 spots for SRR7172094.sra Read 625220 spots for SRR7172094.sra Written 625220 spots for SRR7172094.sra Read 625220 spots for SRR7172094.sra Written 625220 spots for SRR7172094.sra Read 625220 spots for SRR7172094.sra Written 625220 spots for SRR7172094.sra SRR ids: ['SRR7172094.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5ql3imt7 SRR7172094.sra spots: 12504419 blocks: [[1, 625220], [625221, 1250440], [1250441, 1875660], [1875661, 2500880], [2500881, 3126100], [3126101, 3751320], [3751321, 4376540], [4376541, 5001760], [5001761, 5626980], [5626981, 6252200], [6252201, 6877420], [6877421, 7502640], [7502641, 8127860], [8127861, 8753080], [8753081, 9378300], [9378301, 10003520], [10003521, 10628740], [10628741, 11253960], [11253961, 11879180], [11879181, 12504419]] SRR7172094 file size 4215636 SRR7172094 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172094 SRR7172094_1.fastq SRR7172094_2.fastq Input file: SRR7172094_1.fastq Paired file: SRR7172094_2.fastq trimmed: SRR7172094-trimmed-pair1.fastq, SRR7172094-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 04:26:06 2025 >> started Fri Feb 14 04:26:21 2025 >> done (14.135s) 12504419 read pairs processed; of these: 4583 ( 0.04%) short read pairs filtered out after trimming by size control 3430 ( 0.03%) empty read pairs filtered out after trimming by size control 12496406 (99.94%) read pairs available; of these: 7583566 (60.69%) trimmed read pairs available after processing 4912840 (39.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 2 0.00% 21 1 0.00% 22 4 0.00% 23 3 0.00% 24 5 0.00% 25 3 0.00% 26 2 0.00% 27 2 0.00% 28 5 0.00% 29 3 0.00% 30 1 0.00% 31 6 0.00% 32 7 0.00% 33 6 0.00% 34 3 0.00% 35 4 0.00% 36 3 0.00% 37 5 0.00% 38 7 0.00% 39 7 0.00% 40 7 0.00% 41 3 0.00% 42 4 0.00% 43 13 0.00% 44 10 0.00% 45 7 0.00% 46 12 0.00% 47 10 0.00% 48 18 0.00% 49 10 0.00% 50 23 0.00% 51 35 0.00% 52 26 0.00% 53 25 0.00% 54 37 0.00% 55 37 0.00% 56 46 0.00% 57 53 0.00% 58 50 0.00% 59 65 0.00% 60 76 0.00% 61 86 0.00% 62 101 0.00% 63 97 0.00% 64 102 0.00% 65 121 0.00% 66 134 0.00% 67 167 0.00% 68 172 0.00% 69 202 0.00% 70 221 0.00% 71 258 0.00% 72 336 0.00% 73 357 0.00% 74 405 0.00% 75 462 0.00% 76 516 0.00% 77 586 0.00% 78 655 0.01% 79 715 0.01% 80 879 0.01% 81 928 0.01% 82 1155 0.01% 83 1289 0.01% 84 1672 0.01% 85 2030 0.02% 86 2153 0.02% 87 2510 0.02% 88 2621 0.02% 89 2874 0.02% 90 3097 0.02% 91 3242 0.03% 92 3817 0.03% 93 3972 0.03% 94 4469 0.04% 95 4737 0.04% 96 5202 0.04% 97 5587 0.04% 98 5898 0.05% 99 6496 0.05% 100 7083 0.06% 101 7522 0.06% 102 8157 0.07% 103 8885 0.07% 104 9407 0.08% 105 10354 0.08% 106 10660 0.09% 107 11345 0.09% 108 12326 0.10% 109 12859 0.10% 110 13646 0.11% 111 14368 0.11% 112 15275 0.12% 113 16375 0.13% 114 17587 0.14% 115 18575 0.15% 116 19541 0.16% 117 20676 0.17% 118 21284 0.17% 119 22596 0.18% 120 23656 0.19% 121 25083 0.20% 122 26798 0.21% 123 28181 0.23% 124 29913 0.24% 125 31642 0.25% 126 34055 0.27% 127 35870 0.29% 128 38733 0.31% 129 40621 0.33% 130 43514 0.35% 131 46673 0.37% 132 49911 0.40% 133 53907 0.43% 134 57949 0.46% 135 62359 0.50% 136 66542 0.53% 137 72874 0.58% 138 79680 0.64% 139 88074 0.70% 140 96627 0.77% 141 108173 0.87% 142 124684 1.00% 143 144852 1.16% 144 174016 1.39% 145 216461 1.73% 146 280871 2.25% 147 388918 3.11% 148 595641 4.77% 149 1067524 8.54% 150 3100268 24.81% 151 4912840 39.31% 12496406 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=5.61 fanout-score-rank=16 prefix-density=0.35 prefix-fanout=3.8 sequence=AAGCACCATTATACAAACATGAGCTGACCAACTGATAGATTAACTACTGCTTTGTTGGAACCATGTCCATGTGTCCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACACTTGCAGCCATTCTCAGCACCGAAGTCCATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=36 fanout-score=183.59 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=21.8 sequence=ATCATCAACTCCACATAGTTCAAGTTTCCAAGCATACATGAAAACACCTTGAAAGTTGAAGCAGCCAACAAAGCAGTGACGCGTACACAAGACAAAGGATTTATAGGAACCCTTTGCTGTTTATTATTATTTAACAA criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=5.36 fanout-score-rank=20 prefix-density=0.69 prefix-fanout=1.8 sequence=TGCAAGTGTGGATCAAACTGCACCTGTGATCCATGCTCCTGCAAATGAGGACACATGGACATGGTTCCAACAAAGCAGTAGTTAATCTATCAGTTGGTCAGCTCATGTTTGTATAATGGTGCTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=34 fanout-score=26.50 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=2.5 sequence=AGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGG SRR7172094 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 04:27:06 Started mapping on | Feb 14 04:27:06 Finished on | Feb 14 04:28:53 Mapping speed, Million of reads per hour | 420.44 Number of input reads | 12496406 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 11574057 Uniquely mapped reads % | 92.62% Average mapped length | 293.38 Number of splices: Total | 10730079 Number of splices: Annotated (sjdb) | 10477762 Number of splices: GT/AG | 10539796 Number of splices: GC/AG | 142396 Number of splices: AT/AC | 10217 Number of splices: Non-canonical | 37670 Mismatch rate per base, % | 0.49% Deletion rate per base | 0.04% Deletion average length | 2.29 Insertion rate per base | 0.03% Insertion average length | 2.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 329826 % of reads mapped to multiple loci | 2.64% Number of reads mapped to too many loci | 42590 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.28% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 598128 598128 598128 N_multimapping 329826 329826 329826 N_noFeature 475935 11458247 534785 N_ambiguous 129486 717 72061 UnstrandedReadsAssigned:10968636 PositiveStrandReadsAssigned:115093 NegativeStrandReadsAssigned:10967211 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172094 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172094-trimmed-pair1.fastq SRR7172094-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,496,406 reads, 10,838,564 reads pseudoaligned [quant] estimated average fragment length: 245.885 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,104 rounds 52401 SRR7172094.ke.tsv 34699 SRR7172094.se.tsv 87100 total ==> SRR7172094.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.12 1364 69.6409 Potri.005G024800.1.v4.1 1035 790.115 275 31.5086 Potri.004G059700.1.v4.1 961 716.152 14 1.76974 Potri.007G009000.2.v4.1 1416 1171.12 0 0 Potri.003G141000.2.v4.1 2943 2698.12 389.605 13.0723 Potri.016G087400.1.v4.1 270 76.0649 421.439 501.576 Potri.015G069301.1.v4.1 564 322.775 0 0 Potri.010G195200.1.v4.1 1773 1528.12 569 33.7088 Potri.012G127500.1.v4.1 977 732.121 7206 891.043 ==> SRR7172094.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 24 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 319 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 344 SRR7172094 completed mapping pipeline successfully