Starting /dee2/code/volunteer_pipeline.sh SRR7172095 current disk space = 3085889937408 free memory = 1582257112 SRR7172095 SRAfilesize 0045734f6c47f79d6c516d4b6f5af87f SRR7172095.sra SRR7172095.sra file validated SRR7172095 is paired end SRR7172095 is conventional basespace SRR7172095 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172095_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.1215 18.0 18.0 25.0 18.0 31.0 2 21.27525 18.0 18.0 27.0 18.0 29.0 3 25.518 27.0 25.0 27.0 18.0 30.0 4 29.5405 32.0 27.0 32.0 25.0 33.0 5 31.768 32.0 32.0 33.0 30.0 33.0 6 35.8585 37.0 36.0 38.0 33.0 38.0 7 36.87975 38.0 37.0 38.0 35.0 38.0 8 36.8645 38.0 38.0 38.0 35.0 38.0 9 37.114 38.0 38.0 38.0 36.0 38.0 10-14 37.29215 38.0 38.0 38.0 36.8 38.0 15-19 37.37645 38.0 38.0 38.0 37.0 38.0 20-24 37.341300000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.2651 38.0 38.0 38.0 36.8 38.0 30-34 37.004549999999995 38.0 38.0 38.0 35.8 38.0 35-39 36.8056 38.0 38.0 38.0 35.4 38.0 40-44 36.89885 38.0 38.0 38.0 36.0 38.0 45-49 37.0642 38.0 38.0 38.0 36.2 38.0 50-54 37.15990000000001 38.0 38.0 38.0 36.0 38.0 55-59 37.17059999999999 38.0 38.0 38.0 36.4 38.0 60-64 37.173249999999996 38.0 38.0 38.0 36.4 38.0 65-69 37.14470000000001 38.0 38.0 38.0 36.0 38.0 70-74 37.0317 38.0 38.0 38.0 36.0 38.0 75-79 36.915949999999995 38.0 38.0 38.0 36.0 38.0 80-84 36.6764 38.0 38.0 38.0 34.8 38.0 85-89 36.67235000000001 38.0 38.0 38.0 34.8 38.0 90-94 36.4107 38.0 38.0 38.0 34.0 38.0 95-99 36.4424 38.0 38.0 38.0 33.8 38.0 100-104 36.41025 38.0 38.0 38.0 34.0 38.0 105-109 36.3556 38.0 38.0 38.0 34.0 38.0 110-114 36.1295 38.0 37.0 38.0 33.2 38.0 115-119 36.012899999999995 38.0 37.0 38.0 33.0 38.0 120-124 35.82195 38.0 37.0 38.0 32.0 38.0 125-129 35.42425 38.0 36.0 38.0 31.0 38.0 130-134 35.042 38.0 36.0 38.0 28.2 38.0 135-139 34.61445 38.0 35.0 38.0 27.2 38.0 140-144 33.9062 38.0 33.4 38.0 23.6 38.0 145-149 33.13655 38.0 33.0 38.0 18.4 38.0 150-151 28.265500000000003 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 1.0 9 0.0 10 2.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 2.0 17 1.0 18 1.0 19 6.0 20 2.0 21 6.0 22 8.0 23 3.0 24 10.0 25 18.0 26 18.0 27 21.0 28 36.0 29 45.0 30 50.0 31 63.0 32 88.0 33 120.0 34 207.0 35 364.0 36 924.0 37 1998.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 2.9499999999999997 52.400000000000006 9.6 35.05 2 11.0 34.150000000000006 34.35 20.5 3 16.35 32.625 25.674999999999997 25.35 4 20.3 38.6 20.875 20.225 5 18.775 40.325 21.7 19.2 6 16.150000000000002 38.25 23.75 21.85 7 12.55 20.599999999999998 44.5 22.35 8 16.375 21.9 29.625 32.1 9 18.075 22.375 30.625000000000004 28.925 10-14 19.420826247874363 30.28408522556767 26.172851855556665 24.1222366710013 15-19 19.605 28.765 27.26 24.37 20-24 20.080000000000002 28.775000000000002 27.500000000000004 23.645 25-29 19.945 29.09 27.705000000000002 23.26 30-34 19.465 29.24 27.77 23.525 35-39 19.355 29.01 27.365000000000002 24.27 40-44 19.689999999999998 29.4 27.22 23.69 45-49 19.54 29.335 27.68 23.445 50-54 19.785 28.845 27.544999999999998 23.825 55-59 19.89 29.294999999999998 27.644999999999996 23.169999999999998 60-64 19.79 29.299999999999997 27.229999999999997 23.68 65-69 19.82 28.59 27.800000000000004 23.79 70-74 19.73 29.365000000000002 27.29 23.615 75-79 19.98 28.494999999999997 27.750000000000004 23.775 80-84 19.695 28.915000000000003 28.035 23.355 85-89 19.86 28.54 28.194999999999997 23.405 90-94 19.945 28.720000000000002 27.98 23.355 95-99 19.88 28.715000000000003 27.3 24.104999999999997 100-104 19.96 29.015 27.32 23.705000000000002 105-109 19.950000000000003 28.585 27.77 23.695 110-114 20.03200320032003 28.782878287828783 28.012801280128013 23.17231723172317 115-119 20.84708470847085 28.352835283528353 27.412741274127413 23.387338733873385 120-124 20.204040808161633 28.455691138227646 27.830566113222645 23.509701940388076 125-129 20.123141612854784 28.818140861991292 27.556690193722783 23.502027331431147 130-134 20.25 29.110000000000003 27.029999999999998 23.61 135-139 20.330000000000002 28.599999999999998 27.075 23.995 140-144 20.419999999999998 28.27 27.735 23.575 145-149 20.755000000000003 28.470000000000002 27.48 23.294999999999998 150-151 19.8875 28.825 27.200000000000003 24.087500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 1.0 17 1.0 18 0.0 19 0.5 20 1.5 21 1.5 22 2.0 23 4.0 24 4.5 25 4.0 26 4.0 27 8.0 28 11.5 29 15.5 30 27.5 31 40.5 32 51.0 33 54.0 34 68.5 35 91.5 36 100.0 37 108.5 38 143.0 39 174.0 40 203.5 41 232.5 42 256.0 43 286.5 44 278.5 45 273.0 46 280.5 47 255.0 48 223.5 49 186.0 50 144.0 51 114.0 52 80.0 53 56.5 54 53.0 55 47.5 56 34.5 57 24.0 58 17.0 59 9.5 60 6.0 61 5.0 62 4.0 63 4.0 64 2.0 65 1.0 66 0.5 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.03 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.01 115-119 0.01 120-124 0.02 125-129 0.11499999999999999 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.1749999999999998 0.0 0.0 0.0 0.0 110-111 1.275 0.0 0.0 0.0 0.0 112-113 1.3 0.0 0.0 0.0 0.0 114-115 1.3625 0.0 0.0 0.0 0.0 116-117 1.6 0.0 0.0 0.0 0.0 118-119 1.8875 0.0 0.0 0.0 0.0 120-121 2.1624999999999996 0.0 0.0 0.0 0.0 122-123 2.4749999999999996 0.0 0.0 0.0 0.0 124-125 2.85 0.0 0.0 0.0 0.0 126-127 3.2375 0.0 0.0 0.0 0.0 128-129 3.625 0.0 0.0 0.0 0.0 130-131 3.925 0.0 0.0 0.0 0.0 132-133 4.2125 0.0 0.0 0.0 0.0 134-135 4.575 0.0 0.0 0.0 0.0 136-137 5.050000000000001 0.0 0.0 0.0 0.0 138-139 5.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATTTTT 10 0.006830828 145.0 9 >>END_MODULE SRR7172095 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172095_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.57575 33.0 33.0 34.0 32.0 34.0 2 32.7505 33.0 33.0 34.0 32.0 34.0 3 32.8115 34.0 33.0 34.0 32.0 34.0 4 32.77475 34.0 33.0 34.0 32.0 34.0 5 32.73275 34.0 33.0 34.0 32.0 34.0 6 36.91375 38.0 38.0 38.0 36.0 38.0 7 36.94075 38.0 38.0 38.0 36.0 38.0 8 37.01825 38.0 38.0 38.0 37.0 38.0 9 37.0205 38.0 38.0 38.0 37.0 38.0 10-14 36.933749999999996 38.0 38.0 38.0 36.6 38.0 15-19 36.81825 38.0 38.0 38.0 36.0 38.0 20-24 36.74615 38.0 38.0 38.0 36.0 38.0 25-29 36.7187 38.0 38.0 38.0 36.0 38.0 30-34 36.769850000000005 38.0 38.0 38.0 36.0 38.0 35-39 36.7296 38.0 38.0 38.0 36.0 38.0 40-44 36.621249999999996 38.0 38.0 38.0 35.8 38.0 45-49 36.69 38.0 38.0 38.0 35.8 38.0 50-54 36.6604 38.0 38.0 38.0 36.0 38.0 55-59 36.60755 38.0 38.0 38.0 36.0 38.0 60-64 36.58075 38.0 38.0 38.0 35.2 38.0 65-69 36.511849999999995 38.0 38.0 38.0 35.0 38.0 70-74 36.4697 38.0 38.0 38.0 35.2 38.0 75-79 36.4409 38.0 38.0 38.0 35.0 38.0 80-84 36.32885 38.0 38.0 38.0 34.2 38.0 85-89 36.11305 38.0 38.0 38.0 33.8 38.0 90-94 35.9991 38.0 38.0 38.0 33.6 38.0 95-99 35.7736 38.0 37.6 38.0 32.6 38.0 100-104 35.6494 38.0 37.0 38.0 31.2 38.0 105-109 35.6309 38.0 37.0 38.0 31.8 38.0 110-114 35.57195 38.0 37.0 38.0 31.0 38.0 115-119 35.52455 38.0 37.0 38.0 30.6 38.0 120-124 35.1599 38.0 36.6 38.0 29.8 38.0 125-129 34.848749999999995 38.0 36.0 38.0 28.2 38.0 130-134 34.516949999999994 38.0 35.8 38.0 26.6 38.0 135-139 33.8629 38.0 34.0 38.0 22.0 38.0 140-144 33.227799999999995 38.0 33.0 38.0 18.2 38.0 145-149 32.467949999999995 38.0 33.0 38.0 11.4 38.0 150-151 26.869999999999997 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 21.0 3 8.0 4 3.0 5 4.0 6 1.0 7 2.0 8 6.0 9 2.0 10 1.0 11 3.0 12 1.0 13 1.0 14 4.0 15 1.0 16 4.0 17 3.0 18 6.0 19 3.0 20 6.0 21 7.0 22 17.0 23 12.0 24 13.0 25 19.0 26 20.0 27 30.0 28 24.0 29 42.0 30 49.0 31 62.0 32 83.0 33 107.0 34 168.0 35 303.0 36 600.0 37 2364.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.510766149223834 16.750125187781673 14.72208312468703 28.01702553830746 2 23.3 23.3 34.225 19.175 3 21.075 27.224999999999998 30.25 21.45 4 23.375 36.0 21.6 19.025 5 22.0 38.15 20.599999999999998 19.25 6 17.4 37.425000000000004 25.174999999999997 20.0 7 17.150000000000002 16.575 44.65 21.625 8 20.974999999999998 21.65 26.700000000000003 30.675 9 21.2 24.675 27.950000000000003 26.174999999999997 10-14 22.856857057117136 28.053416024807444 26.90807242172652 22.181654496348905 15-19 22.919583916783356 27.635527105421083 28.350670134026807 21.094218843768754 20-24 22.545 28.835 28.105000000000004 20.515 25-29 22.575 28.549999999999997 27.894999999999996 20.979999999999997 30-34 22.855 28.425 27.505000000000003 21.215 35-39 22.37 28.51 28.599999999999998 20.52 40-44 22.78 28.28 28.02 20.919999999999998 45-49 22.965 28.16 28.075 20.8 50-54 22.439999999999998 28.16 28.79 20.61 55-59 23.735 28.535 27.655 20.075000000000003 60-64 22.915 28.08 28.285 20.72 65-69 22.5 28.035 29.15 20.315 70-74 23.395 27.765 28.189999999999998 20.65 75-79 23.505000000000003 28.134999999999998 28.405 19.955000000000002 80-84 22.8 28.139999999999997 28.49 20.57 85-89 23.455000000000002 27.865000000000002 28.125 20.555 90-94 23.575 27.894999999999996 28.155 20.375 95-99 23.695 28.199999999999996 27.700000000000003 20.405 100-104 24.315 27.944999999999997 27.700000000000003 20.04 105-109 23.565 28.095 28.225 20.115 110-114 23.810000000000002 28.199999999999996 28.249999999999996 19.74 115-119 23.445 28.535 27.92 20.1 120-124 24.055 28.08 27.715 20.150000000000002 125-129 23.89 28.63 27.845 19.634999999999998 130-134 24.425 28.74 26.985 19.85 135-139 24.39 27.785 28.395 19.43 140-144 24.77 27.715 27.810000000000002 19.705000000000002 145-149 24.88 27.235 28.02 19.865 150-151 25.087500000000002 28.9375 26.9625 19.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.5 21 2.0 22 2.5 23 3.0 24 3.5 25 5.0 26 3.5 27 1.5 28 5.0 29 10.0 30 11.5 31 15.5 32 33.0 33 40.5 34 43.0 35 60.5 36 87.5 37 108.0 38 129.5 39 167.5 40 206.5 41 253.0 42 285.0 43 289.0 44 275.0 45 266.0 46 265.5 47 248.0 48 225.0 49 212.0 50 185.0 51 141.0 52 105.5 53 80.0 54 61.5 55 41.0 56 27.5 57 25.0 58 22.0 59 18.0 60 11.5 61 5.0 62 2.5 63 2.5 64 2.0 65 1.0 66 1.5 67 1.0 68 0.0 69 1.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.03 15-19 0.02 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64859437751004 99.25 2 0.32630522088353414 0.65 3 0.0 0.0 4 0.0251004016064257 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.7125 0.0 0.0 0.0 0.0 104-105 0.8999999999999999 0.0 0.0 0.0 0.0 106-107 1.0875 0.0 0.0 0.0 0.0 108-109 1.2000000000000002 0.0 0.0 0.0 0.0 110-111 1.2999999999999998 0.0 0.0 0.0 0.0 112-113 1.325 0.0 0.0 0.0 0.0 114-115 1.3875 0.0 0.0 0.0 0.0 116-117 1.625 0.0 0.0 0.0 0.0 118-119 1.925 0.0 0.0 0.0 0.0 120-121 2.2 0.0 0.0 0.0 0.0 122-123 2.5 0.0 0.0 0.0 0.0 124-125 2.875 0.0 0.0 0.0 0.0 126-127 3.275 0.0 0.0 0.0 0.0 128-129 3.6625 0.0 0.0 0.0 0.0 130-131 3.95 0.0 0.0 0.0 0.0 132-133 4.2875 0.0 0.0 0.0 0.0 134-135 4.6625 0.0 0.0 0.0 0.0 136-137 5.125 0.0 0.0 0.0 0.0 138-139 5.512499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCCTGA 10 0.006830828 145.0 5 ATGTGCA 10 0.006830828 145.0 9 GTTGGAA 10 0.006830828 145.0 1 CATGCTG 10 0.006830828 145.0 8 >>END_MODULE Read 714982 spots for SRR7172095.sra Written 714982 spots for SRR7172095.sra Read 714982 spots for SRR7172095.sra Written 714982 spots for SRR7172095.sra Read 714982 spots for SRR7172095.sra Written 714982 spots for SRR7172095.sra Read 714982 spots for SRR7172095.sra Written 714982 spots for SRR7172095.sra Read 714982 spots for SRR7172095.sra Written 714982 spots for SRR7172095.sra Read 714982 spots for SRR7172095.sra Written 714982 spots for SRR7172095.sra Read 714982 spots for SRR7172095.sra Written 714982 spots for SRR7172095.sra Read 714982 spots for SRR7172095.sra Written 714982 spots for SRR7172095.sra Read 714982 spots for SRR7172095.sra Written 714982 spots for SRR7172095.sra Read 714982 spots for SRR7172095.sra Written 714982 spots for SRR7172095.sra Read 714982 spots for SRR7172095.sra Written 714982 spots for SRR7172095.sra Read 714982 spots for SRR7172095.sra Written 714982 spots for SRR7172095.sra Read 714982 spots for SRR7172095.sra Written 714982 spots for SRR7172095.sra Read 714982 spots for SRR7172095.sra Written 714982 spots for SRR7172095.sra Read 714982 spots for SRR7172095.sra Written 714982 spots for SRR7172095.sra Read 714994 spots for SRR7172095.sra Written 714994 spots for SRR7172095.sra Read 714982 spots for SRR7172095.sra Written 714982 spots for SRR7172095.sra Read 714982 spots for SRR7172095.sra Written 714982 spots for SRR7172095.sra Read 714982 spots for SRR7172095.sra Written 714982 spots for SRR7172095.sra Read 714982 spots for SRR7172095.sra Written 714982 spots for SRR7172095.sra SRR ids: ['SRR7172095.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mxv1m7cm SRR7172095.sra spots: 14299652 blocks: [[1, 714982], [714983, 1429964], [1429965, 2144946], [2144947, 2859928], [2859929, 3574910], [3574911, 4289892], [4289893, 5004874], [5004875, 5719856], [5719857, 6434838], [6434839, 7149820], [7149821, 7864802], [7864803, 8579784], [8579785, 9294766], [9294767, 10009748], [10009749, 10724730], [10724731, 11439712], [11439713, 12154694], [12154695, 12869676], [12869677, 13584658], [13584659, 14299652]] SRR7172095 file size 4823982 SRR7172095 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172095 SRR7172095_1.fastq SRR7172095_2.fastq Input file: SRR7172095_1.fastq Paired file: SRR7172095_2.fastq trimmed: SRR7172095-trimmed-pair1.fastq, SRR7172095-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 05:37:40 2025 >> started Fri Feb 14 05:37:55 2025 >> done (15.097s) 14299652 read pairs processed; of these: 20921 ( 0.15%) short read pairs filtered out after trimming by size control 21447 ( 0.15%) empty read pairs filtered out after trimming by size control 14257284 (99.70%) read pairs available; of these: 8368863 (58.70%) trimmed read pairs available after processing 5888421 (41.30%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 5 0.00% 21 3 0.00% 22 6 0.00% 23 8 0.00% 24 7 0.00% 25 7 0.00% 26 13 0.00% 27 3 0.00% 28 5 0.00% 29 5 0.00% 30 8 0.00% 31 4 0.00% 32 2 0.00% 33 3 0.00% 34 6 0.00% 35 9 0.00% 36 11 0.00% 37 9 0.00% 38 3 0.00% 39 8 0.00% 40 16 0.00% 41 7 0.00% 42 10 0.00% 43 12 0.00% 44 10 0.00% 45 6 0.00% 46 6 0.00% 47 23 0.00% 48 10 0.00% 49 25 0.00% 50 22 0.00% 51 24 0.00% 52 32 0.00% 53 28 0.00% 54 34 0.00% 55 37 0.00% 56 65 0.00% 57 151 0.00% 58 128 0.00% 59 132 0.00% 60 105 0.00% 61 118 0.00% 62 128 0.00% 63 148 0.00% 64 153 0.00% 65 159 0.00% 66 191 0.00% 67 236 0.00% 68 273 0.00% 69 311 0.00% 70 334 0.00% 71 401 0.00% 72 429 0.00% 73 542 0.00% 74 585 0.00% 75 665 0.00% 76 796 0.01% 77 976 0.01% 78 1298 0.01% 79 1123 0.01% 80 1378 0.01% 81 1449 0.01% 82 1699 0.01% 83 2074 0.01% 84 3836 0.03% 85 4326 0.03% 86 4366 0.03% 87 4322 0.03% 88 4451 0.03% 89 4589 0.03% 90 4864 0.03% 91 5051 0.04% 92 5644 0.04% 93 6015 0.04% 94 6460 0.05% 95 6833 0.05% 96 7485 0.05% 97 8261 0.06% 98 8486 0.06% 99 9174 0.06% 100 9732 0.07% 101 10585 0.07% 102 11186 0.08% 103 12007 0.08% 104 12599 0.09% 105 13500 0.09% 106 14021 0.10% 107 15153 0.11% 108 15772 0.11% 109 16296 0.11% 110 17592 0.12% 111 18147 0.13% 112 19466 0.14% 113 20597 0.14% 114 21873 0.15% 115 23128 0.16% 116 24434 0.17% 117 25583 0.18% 118 26668 0.19% 119 27769 0.19% 120 29320 0.21% 121 31175 0.22% 122 32702 0.23% 123 34765 0.24% 124 36808 0.26% 125 38661 0.27% 126 40931 0.29% 127 43160 0.30% 128 45094 0.32% 129 47337 0.33% 130 49472 0.35% 131 51610 0.36% 132 54746 0.38% 133 58626 0.41% 134 62046 0.44% 135 66173 0.46% 136 70295 0.49% 137 75247 0.53% 138 81971 0.57% 139 88988 0.62% 140 98139 0.69% 141 107961 0.76% 142 124019 0.87% 143 138593 0.97% 144 164980 1.16% 145 200197 1.40% 146 250606 1.76% 147 334907 2.35% 148 498188 3.49% 149 952548 6.68% 150 3992846 28.01% 151 5888421 41.30% 14257284 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=39 prefix-density=0.18 prefix-fanout=2.2 sequence=CGACACCATCAT criterion=fanout-score sequence-density=0.09 sequence-density-rank=11 fanout-score=398.17 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=36.3 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=11.08 fanout-score-rank=15 prefix-density=0.27 prefix-fanout=5.4 sequence=ATGATGGTGTCG criterion=fanout-score sequence-density=0.09 sequence-density-rank=15 fanout-score=126.23 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=23.4 sequence=GAAGAAGAGAGG SRR7172095 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 05:38:45 Started mapping on | Feb 14 05:38:45 Finished on | Feb 14 05:40:07 Mapping speed, Million of reads per hour | 625.93 Number of input reads | 14257284 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 13474091 Uniquely mapped reads % | 94.51% Average mapped length | 293.02 Number of splices: Total | 13706574 Number of splices: Annotated (sjdb) | 13491201 Number of splices: GT/AG | 13487016 Number of splices: GC/AG | 172808 Number of splices: AT/AC | 9231 Number of splices: Non-canonical | 37519 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.04% Deletion average length | 2.23 Insertion rate per base | 0.02% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 383758 % of reads mapped to multiple loci | 2.69% Number of reads mapped to too many loci | 36134 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.46% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 420917 420917 420917 N_multimapping 383758 383758 383758 N_noFeature 318520 13348286 382427 N_ambiguous 132526 671 70166 UnstrandedReadsAssigned:13023045 PositiveStrandReadsAssigned:125134 NegativeStrandReadsAssigned:13021498 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172095 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172095-trimmed-pair1.fastq SRR7172095-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,257,284 reads, 12,886,530 reads pseudoaligned [quant] estimated average fragment length: 249.621 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,044 rounds 52401 SRR7172095.ke.tsv 34699 SRR7172095.se.tsv 87100 total ==> SRR7172095.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1769.38 526 23.221 Potri.005G024800.1.v4.1 1035 786.379 98 9.7344 Potri.004G059700.1.v4.1 961 712.438 11 1.20604 Potri.007G009000.2.v4.1 1416 1167.38 0 0 Potri.003G141000.2.v4.1 2943 2694.38 329 9.53789 Potri.016G087400.1.v4.1 270 79.7085 824 807.491 Potri.015G069301.1.v4.1 564 322.688 0 0 Potri.010G195200.1.v4.1 1773 1524.38 67 3.43318 Potri.012G127500.1.v4.1 977 728.406 2148 230.343 ==> SRR7172095.se.tsv <== Potri.001G166300.v4.1 4 Potri.001G448400.v4.1 14 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 231 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 83 SRR7172095 completed mapping pipeline successfully