Starting /dee2/code/volunteer_pipeline.sh SRR7172096 current disk space = 3111674036224 free memory = 1464207276 SRR7172096 SRAfilesize 8f8efd313a839ead040536707c07058e SRR7172096.sra SRR7172096.sra file validated SRR7172096 is paired end SRR7172096 is conventional basespace SRR7172096 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172096_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.62 18.0 18.0 18.0 18.0 31.0 2 22.784 18.0 18.0 27.0 18.0 31.0 3 24.13825 25.0 18.0 29.0 18.0 31.0 4 29.077 32.0 27.0 32.0 25.0 33.0 5 31.5395 32.0 32.0 33.0 30.0 33.0 6 36.15275 37.0 36.0 38.0 33.0 38.0 7 36.9275 38.0 37.0 38.0 35.0 38.0 8 37.133 38.0 38.0 38.0 36.0 38.0 9 37.13375 38.0 38.0 38.0 36.0 38.0 10-14 37.273199999999996 38.0 38.0 38.0 36.4 38.0 15-19 37.4444 38.0 38.0 38.0 36.8 38.0 20-24 37.42435 38.0 38.0 38.0 37.0 38.0 25-29 37.416650000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.386700000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.3763 38.0 38.0 38.0 37.0 38.0 40-44 37.298700000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.26095 38.0 38.0 38.0 36.6 38.0 50-54 37.136700000000005 38.0 38.0 38.0 36.0 38.0 55-59 37.030950000000004 38.0 38.0 38.0 36.0 38.0 60-64 36.89059999999999 38.0 38.0 38.0 35.2 38.0 65-69 36.83275 38.0 38.0 38.0 35.0 38.0 70-74 36.6684 38.0 38.0 38.0 34.2 38.0 75-79 36.6099 38.0 38.0 38.0 34.0 38.0 80-84 36.5889 38.0 38.0 38.0 34.2 38.0 85-89 36.41465 38.0 37.4 38.0 34.0 38.0 90-94 36.3031 38.0 37.0 38.0 33.8 38.0 95-99 36.229299999999995 38.0 37.0 38.0 33.6 38.0 100-104 35.9628 38.0 37.0 38.0 32.6 38.0 105-109 35.747400000000006 38.0 36.8 38.0 31.4 38.0 110-114 35.6146 38.0 36.2 38.0 30.6 38.0 115-119 35.3731 38.0 36.0 38.0 29.4 38.0 120-124 35.2068 38.0 36.0 38.0 28.6 38.0 125-129 34.7929 38.0 35.0 38.0 27.8 38.0 130-134 34.5918 38.0 35.0 38.0 27.0 38.0 135-139 34.0634 38.0 34.2 38.0 23.4 38.0 140-144 33.55309999999999 38.0 34.0 38.0 21.0 38.0 145-149 32.678749999999994 38.0 33.4 38.0 14.4 38.0 150-151 28.958750000000002 36.0 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 3.0 14 0.0 15 3.0 16 0.0 17 3.0 18 1.0 19 6.0 20 6.0 21 9.0 22 12.0 23 10.0 24 6.0 25 12.0 26 16.0 27 27.0 28 19.0 29 32.0 30 43.0 31 58.0 32 104.0 33 148.0 34 256.0 35 479.0 36 1357.0 37 1389.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.70787689097548 3.051643192488263 32.49869587897757 34.74178403755869 2 16.408204102051023 11.530765382691346 51.55077538769385 20.51025512756378 3 17.625 26.8 31.324999999999996 24.25 4 23.200000000000003 33.85 24.925 18.025 5 20.925 36.525 23.1 19.45 6 16.35 35.699999999999996 25.3 22.650000000000002 7 12.675 20.45 45.875 21.0 8 18.224999999999998 20.3 28.975 32.5 9 17.724999999999998 21.95 31.35 28.975 10-14 19.625 30.104999999999997 26.11 24.16 15-19 19.925 28.53 27.634999999999998 23.91 20-24 19.63 28.53 27.955000000000002 23.885 25-29 19.400000000000002 28.965000000000003 27.805000000000003 23.830000000000002 30-34 19.515 29.74 27.195000000000004 23.549999999999997 35-39 20.05 28.994999999999997 27.435 23.52 40-44 19.814999999999998 29.215000000000003 27.200000000000003 23.77 45-49 20.405 29.225 27.224999999999998 23.145 50-54 19.814999999999998 29.244999999999997 27.365000000000002 23.575 55-59 19.285 29.24 27.805000000000003 23.669999999999998 60-64 19.975 28.71 27.375 23.94 65-69 19.705000000000002 28.860000000000003 27.975 23.46 70-74 20.14 28.835 27.675 23.35 75-79 20.375 29.465000000000003 27.389999999999997 22.770000000000003 80-84 20.285 28.110000000000003 27.500000000000004 24.104999999999997 85-89 19.965 28.815 27.644999999999996 23.575 90-94 20.349999999999998 29.07 27.07 23.51 95-99 20.51 28.71 27.21 23.57 100-104 20.31 28.88 27.474999999999998 23.335 105-109 20.395 29.060000000000002 27.060000000000002 23.485 110-114 20.39 29.509999999999998 26.855 23.244999999999997 115-119 20.855 29.12 26.889999999999997 23.135 120-124 20.93 28.32 27.37 23.380000000000003 125-129 20.705000000000002 28.470000000000002 27.425 23.400000000000002 130-134 21.0 28.975 26.46 23.565 135-139 20.810000000000002 28.549999999999997 27.275 23.365 140-144 20.69 28.904999999999998 27.08 23.325000000000003 145-149 21.18 28.449999999999996 26.534999999999997 23.835 150-151 20.9 28.1 26.9625 24.0375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 3.0 24 6.5 25 8.5 26 7.0 27 7.5 28 10.5 29 15.0 30 21.0 31 31.5 32 44.0 33 51.5 34 63.0 35 79.0 36 98.5 37 118.0 38 148.5 39 165.5 40 175.5 41 202.0 42 237.5 43 268.5 44 275.5 45 280.0 46 274.0 47 263.0 48 233.5 49 195.5 50 161.0 51 133.5 52 114.5 53 80.5 54 56.0 55 42.0 56 29.0 57 25.0 58 19.5 59 10.5 60 8.5 61 8.0 62 5.5 63 4.0 64 3.5 65 2.5 66 2.0 67 2.0 68 1.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.15 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.07500000000000001 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.6375 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.8500000000000001 0.0 0.0 0.0 0.0 110-111 1.0125 0.0 0.0 0.0 0.0 112-113 1.15 0.0 0.0 0.0 0.0 114-115 1.3 0.0 0.0 0.0 0.0 116-117 1.55 0.0 0.0 0.0 0.0 118-119 1.8625 0.0 0.0 0.0 0.0 120-121 2.0875 0.0 0.0 0.0 0.0 122-123 2.3125 0.0 0.0 0.0 0.0 124-125 2.55 0.0 0.0 0.0 0.0 126-127 2.8125 0.0 0.0 0.0 0.0 128-129 3.2 0.0 0.0 0.0 0.0 130-131 3.4749999999999996 0.0 0.0 0.0 0.0 132-133 3.7375 0.0 0.0 0.0 0.0 134-135 4.137499999999999 0.0 0.0 0.0 0.0 136-137 4.4375 0.0 0.0 0.0 0.0 138-139 4.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAATCC 10 0.0068343505 144.975 3 >>END_MODULE SRR7172096 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172096_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.15575 33.0 33.0 34.0 33.0 34.0 2 33.2635 34.0 33.0 34.0 33.0 34.0 3 33.32825 34.0 33.0 34.0 33.0 34.0 4 33.237 34.0 33.0 34.0 33.0 34.0 5 33.19025 34.0 33.0 34.0 33.0 34.0 6 37.3845 38.0 38.0 38.0 37.0 38.0 7 37.52675 38.0 38.0 38.0 38.0 38.0 8 37.48725 38.0 38.0 38.0 38.0 38.0 9 37.47475 38.0 38.0 38.0 38.0 38.0 10-14 37.4658 38.0 38.0 38.0 38.0 38.0 15-19 37.441 38.0 38.0 38.0 38.0 38.0 20-24 37.42355 38.0 38.0 38.0 38.0 38.0 25-29 37.40305 38.0 38.0 38.0 37.6 38.0 30-34 37.3864 38.0 38.0 38.0 37.2 38.0 35-39 37.31175 38.0 38.0 38.0 37.0 38.0 40-44 37.32455 38.0 38.0 38.0 37.0 38.0 45-49 37.2623 38.0 38.0 38.0 37.0 38.0 50-54 37.192899999999995 38.0 38.0 38.0 37.0 38.0 55-59 37.1218 38.0 38.0 38.0 36.6 38.0 60-64 37.09945 38.0 38.0 38.0 36.8 38.0 65-69 37.016 38.0 38.0 38.0 36.0 38.0 70-74 36.86515 38.0 38.0 38.0 35.8 38.0 75-79 36.87935 38.0 38.0 38.0 36.0 38.0 80-84 36.74335 38.0 38.0 38.0 35.0 38.0 85-89 36.5745 38.0 38.0 38.0 34.4 38.0 90-94 36.48365 38.0 38.0 38.0 34.2 38.0 95-99 36.4174 38.0 38.0 38.0 34.0 38.0 100-104 36.2653 38.0 38.0 38.0 34.0 38.0 105-109 36.0884 38.0 37.6 38.0 33.4 38.0 110-114 35.9108 38.0 37.2 38.0 33.0 38.0 115-119 35.709500000000006 38.0 37.0 38.0 31.6 38.0 120-124 35.3943 38.0 36.4 38.0 30.0 38.0 125-129 35.2033 38.0 36.0 38.0 29.4 38.0 130-134 34.79045000000001 38.0 35.4 38.0 27.8 38.0 135-139 34.628550000000004 38.0 35.0 38.0 27.8 38.0 140-144 34.19975000000001 38.0 34.6 38.0 24.4 38.0 145-149 33.39095 38.0 34.0 38.0 19.0 38.0 150-151 29.051000000000002 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 3.0 5 0.0 6 0.0 7 1.0 8 0.0 9 1.0 10 1.0 11 2.0 12 1.0 13 3.0 14 2.0 15 0.0 16 3.0 17 3.0 18 5.0 19 3.0 20 4.0 21 7.0 22 6.0 23 9.0 24 10.0 25 12.0 26 13.0 27 21.0 28 31.0 29 27.0 30 39.0 31 40.0 32 69.0 33 104.0 34 141.0 35 269.0 36 716.0 37 2450.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.975 14.7 19.1 30.225 2 24.525 21.575 35.625 18.275 3 20.424999999999997 26.05 30.725 22.8 4 24.15 34.55 20.4 20.9 5 22.1 38.1 21.975 17.825 6 17.625 37.5 23.75 21.125 7 16.8 16.075 45.65 21.475 8 20.925 20.625 27.85 30.599999999999998 9 21.775 24.0 28.749999999999996 25.474999999999998 10-14 22.6 28.549999999999997 26.724999999999998 22.125 15-19 22.400000000000002 28.410000000000004 28.044999999999998 21.145 20-24 22.6 27.68 28.16 21.560000000000002 25-29 22.655 27.755000000000003 28.499999999999996 21.09 30-34 22.485 27.339999999999996 28.860000000000003 21.315 35-39 22.91 27.785 28.59 20.715 40-44 23.055 27.74 28.415000000000003 20.79 45-49 23.025000000000002 27.325 28.335 21.315 50-54 23.06 27.525 28.144999999999996 21.27 55-59 23.294999999999998 28.46 27.63 20.615 60-64 23.48 28.12 27.384999999999998 21.015 65-69 22.439999999999998 28.005000000000003 28.799999999999997 20.755000000000003 70-74 22.985 27.905 28.449999999999996 20.66 75-79 23.565 27.775 28.499999999999996 20.16 80-84 22.830000000000002 27.83 28.444999999999997 20.895 85-89 23.580000000000002 27.72 28.16 20.54 90-94 23.89 27.375 28.555000000000003 20.18 95-99 23.169999999999998 28.194999999999997 28.044999999999998 20.59 100-104 23.419999999999998 28.025 27.794999999999998 20.76 105-109 23.665 27.48 28.560000000000002 20.294999999999998 110-114 23.755000000000003 26.99 28.16 21.095 115-119 24.295 27.445000000000004 27.97 20.29 120-124 24.195 27.52 28.345 19.939999999999998 125-129 24.240000000000002 27.92 27.93 19.91 130-134 24.23 27.41 28.01 20.349999999999998 135-139 24.235 27.900000000000002 27.575 20.29 140-144 24.195 27.750000000000004 27.93 20.125 145-149 24.57 28.494999999999997 27.205000000000002 19.73 150-151 24.1875 27.537499999999998 28.275 20.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 1.0 24 2.0 25 3.5 26 4.5 27 5.5 28 5.5 29 7.5 30 14.5 31 22.0 32 23.5 33 29.0 34 40.0 35 64.0 36 95.5 37 108.5 38 133.0 39 165.0 40 196.5 41 243.0 42 262.5 43 261.5 44 271.5 45 284.5 46 285.0 47 255.5 48 240.5 49 212.5 50 162.0 51 146.5 52 117.0 53 83.0 54 67.0 55 49.0 56 34.5 57 24.0 58 19.0 59 16.5 60 12.5 61 9.0 62 6.0 63 2.5 64 1.5 65 1.0 66 1.5 67 1.5 68 1.5 69 1.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.07500000000000001 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.6125 0.0 0.0 0.0 0.0 106-107 0.725 0.0 0.0 0.0 0.0 108-109 0.825 0.0 0.0 0.0 0.0 110-111 0.9624999999999999 0.0 0.0 0.0 0.0 112-113 1.1 0.0 0.0 0.0 0.0 114-115 1.275 0.0 0.0 0.0 0.0 116-117 1.525 0.0 0.0 0.0 0.0 118-119 1.8375 0.0 0.0 0.0 0.0 120-121 2.075 0.0 0.0 0.0 0.0 122-123 2.325 0.0 0.0 0.0 0.0 124-125 2.55 0.0 0.0 0.0 0.0 126-127 2.8125 0.0 0.0 0.0 0.0 128-129 3.2 0.0 0.0 0.0 0.0 130-131 3.4749999999999996 0.0 0.0 0.0 0.0 132-133 3.7375 0.0 0.0 0.0 0.0 134-135 4.1625 0.0 0.0 0.0 0.0 136-137 4.512499999999999 0.0 0.0 0.0 0.0 138-139 4.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCAAGC 10 0.006830828 145.0 5 CCAAGCG 10 0.006830828 145.0 6 >>END_MODULE Read 461048 spots for SRR7172096.sra Written 461048 spots for SRR7172096.sra Read 461048 spots for SRR7172096.sra Written 461048 spots for SRR7172096.sra Read 461048 spots for SRR7172096.sra Written 461048 spots for SRR7172096.sra Read 461048 spots for SRR7172096.sra Written 461048 spots for SRR7172096.sra Read 461048 spots for SRR7172096.sra Written 461048 spots for SRR7172096.sra Read 461048 spots for SRR7172096.sra Written 461048 spots for SRR7172096.sra Read 461048 spots for SRR7172096.sra Written 461048 spots for SRR7172096.sra Read 461048 spots for SRR7172096.sra Written 461048 spots for SRR7172096.sra Read 461048 spots for SRR7172096.sra Written 461048 spots for SRR7172096.sra Read 461048 spots for SRR7172096.sra Written 461048 spots for SRR7172096.sra Read 461048 spots for SRR7172096.sra Written 461048 spots for SRR7172096.sra Read 461048 spots for SRR7172096.sra Written 461048 spots for SRR7172096.sra Read 461049 spots for SRR7172096.sra Written 461049 spots for SRR7172096.sra Read 461048 spots for SRR7172096.sra Written 461048 spots for SRR7172096.sra Read 461048 spots for SRR7172096.sra Written 461048 spots for SRR7172096.sra Read 461048 spots for SRR7172096.sra Written 461048 spots for SRR7172096.sra Read 461048 spots for SRR7172096.sra Written 461048 spots for SRR7172096.sra Read 461048 spots for SRR7172096.sra Written 461048 spots for SRR7172096.sra Read 461048 spots for SRR7172096.sra Written 461048 spots for SRR7172096.sra Read 461048 spots for SRR7172096.sra Written 461048 spots for SRR7172096.sra SRR ids: ['SRR7172096.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_693vrjp_ SRR7172096.sra spots: 9220961 blocks: [[1, 461048], [461049, 922096], [922097, 1383144], [1383145, 1844192], [1844193, 2305240], [2305241, 2766288], [2766289, 3227336], [3227337, 3688384], [3688385, 4149432], [4149433, 4610480], [4610481, 5071528], [5071529, 5532576], [5532577, 5993624], [5993625, 6454672], [6454673, 6915720], [6915721, 7376768], [7376769, 7837816], [7837817, 8298864], [8298865, 8759912], [8759913, 9220961]] SRR7172096 file size 3104502 SRR7172096 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172096 SRR7172096_1.fastq SRR7172096_2.fastq Input file: SRR7172096_1.fastq Paired file: SRR7172096_2.fastq trimmed: SRR7172096-trimmed-pair1.fastq, SRR7172096-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 16:58:07 2025 >> started Fri Feb 14 16:58:18 2025 >> done (11.385s) 9220961 read pairs processed; of these: 4883 ( 0.05%) short read pairs filtered out after trimming by size control 3066 ( 0.03%) empty read pairs filtered out after trimming by size control 9213012 (99.91%) read pairs available; of these: 5483438 (59.52%) trimmed read pairs available after processing 3729574 (40.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 3 0.00% 21 1 0.00% 22 3 0.00% 23 0 0.00% 24 5 0.00% 25 2 0.00% 26 1 0.00% 27 6 0.00% 28 3 0.00% 29 3 0.00% 30 3 0.00% 31 7 0.00% 32 6 0.00% 33 3 0.00% 34 4 0.00% 35 3 0.00% 36 5 0.00% 37 1 0.00% 38 6 0.00% 39 1 0.00% 40 5 0.00% 41 3 0.00% 42 6 0.00% 43 7 0.00% 44 10 0.00% 45 6 0.00% 46 4 0.00% 47 14 0.00% 48 9 0.00% 49 16 0.00% 50 19 0.00% 51 20 0.00% 52 29 0.00% 53 17 0.00% 54 31 0.00% 55 36 0.00% 56 42 0.00% 57 34 0.00% 58 39 0.00% 59 42 0.00% 60 63 0.00% 61 60 0.00% 62 57 0.00% 63 75 0.00% 64 78 0.00% 65 91 0.00% 66 112 0.00% 67 124 0.00% 68 137 0.00% 69 159 0.00% 70 172 0.00% 71 186 0.00% 72 227 0.00% 73 277 0.00% 74 320 0.00% 75 349 0.00% 76 464 0.01% 77 494 0.01% 78 505 0.01% 79 646 0.01% 80 733 0.01% 81 797 0.01% 82 917 0.01% 83 1079 0.01% 84 1405 0.02% 85 1573 0.02% 86 1841 0.02% 87 2053 0.02% 88 2181 0.02% 89 2378 0.03% 90 2504 0.03% 91 2685 0.03% 92 2925 0.03% 93 3197 0.03% 94 3548 0.04% 95 3683 0.04% 96 3998 0.04% 97 4340 0.05% 98 4574 0.05% 99 4910 0.05% 100 5204 0.06% 101 5617 0.06% 102 6174 0.07% 103 6569 0.07% 104 7017 0.08% 105 7672 0.08% 106 7750 0.08% 107 8374 0.09% 108 8943 0.10% 109 9558 0.10% 110 9998 0.11% 111 10468 0.11% 112 11199 0.12% 113 11481 0.12% 114 12527 0.14% 115 12845 0.14% 116 13605 0.15% 117 14450 0.16% 118 15209 0.17% 119 15326 0.17% 120 16650 0.18% 121 16999 0.18% 122 17960 0.19% 123 19011 0.21% 124 20158 0.22% 125 21412 0.23% 126 23092 0.25% 127 23888 0.26% 128 25109 0.27% 129 26672 0.29% 130 28531 0.31% 131 30395 0.33% 132 32510 0.35% 133 35106 0.38% 134 37729 0.41% 135 40399 0.44% 136 44107 0.48% 137 47693 0.52% 138 52377 0.57% 139 57308 0.62% 140 64051 0.70% 141 72651 0.79% 142 83996 0.91% 143 98124 1.07% 144 119711 1.30% 145 149832 1.63% 146 197847 2.15% 147 280251 3.04% 148 436300 4.74% 149 788576 8.56% 150 2318633 25.17% 151 3729574 40.48% 9213012 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=29 prefix-density=0.26 prefix-fanout=2.2 sequence=AGTTCATCTCAGACCTCTCGAAGAACATCTGAACTGGTGCAAAACCTGCAATGATTGT criterion=fanout-score sequence-density=0.09 sequence-density-rank=17 fanout-score=52.38 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=16.6 sequence=ACCACCACCATG criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=4.80 fanout-score-rank=18 prefix-density=0.32 prefix-fanout=3.5 sequence=TGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.11 sequence-density-rank=12 fanout-score=24.06 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=8.4 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7172096 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 16:59:30 Started mapping on | Feb 14 16:59:31 Finished on | Feb 14 17:00:29 Mapping speed, Million of reads per hour | 571.84 Number of input reads | 9213012 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 8780062 Uniquely mapped reads % | 95.30% Average mapped length | 293.65 Number of splices: Total | 8608640 Number of splices: Annotated (sjdb) | 8452685 Number of splices: GT/AG | 8473930 Number of splices: GC/AG | 106616 Number of splices: AT/AC | 6019 Number of splices: Non-canonical | 22075 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.04% Deletion average length | 2.43 Insertion rate per base | 0.02% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 247623 % of reads mapped to multiple loci | 2.69% Number of reads mapped to too many loci | 19226 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.72% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 192318 192318 192318 N_multimapping 247623 247623 247623 N_noFeature 221275 8689011 264124 N_ambiguous 91395 420 42950 UnstrandedReadsAssigned:8467392 PositiveStrandReadsAssigned:90631 NegativeStrandReadsAssigned:8472988 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172096 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172096-trimmed-pair1.fastq SRR7172096-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,213,012 reads, 8,397,279 reads pseudoaligned [quant] estimated average fragment length: 249.714 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,041 rounds 52401 SRR7172096.ke.tsv 34699 SRR7172096.se.tsv 87100 total ==> SRR7172096.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1769.29 557 35.2589 Potri.005G024800.1.v4.1 1035 786.286 146 20.7962 Potri.004G059700.1.v4.1 961 712.316 16 2.5157 Potri.007G009000.2.v4.1 1416 1167.29 1 0.0959476 Potri.003G141000.2.v4.1 2943 2694.29 301 12.5122 Potri.016G087400.1.v4.1 270 76.4024 629.59 922.918 Potri.015G069301.1.v4.1 564 320.144 0 0 Potri.010G195200.1.v4.1 1773 1524.29 117 8.59669 Potri.012G127500.1.v4.1 977 728.298 2938 451.808 ==> SRR7172096.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 75 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 266 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 108 SRR7172096 completed mapping pipeline successfully